use the preset styles by clicking on the drop down arrow to the bottom right of the viewable preset styles and make a selection from the displayed options
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... 5¢-CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ (An engineered PstI recognition site is single-underlined The ... with the following primers: M2-myc-EcoRI-s, 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ ... identified the human Gao (accession no NM138736) as the most similar Ga in mammals The amino acid sequence of GOA-1 is 82.2% identical to that of Gao Although the similarity of the aA–aE region and the...
- 9
- 400
- 0
A study on applying group discussion approach to enhanse speaking skills of English for the first year students at An Duong Vocational Middle School = Áp dụng đ
... readers easily understand the paper Apart from INTRODUCTION that presents the rationale, aims, scope, methods and design of the study and CONCLUSION that reviews the main content and findings of the ... cues to the point where they could use the language to express their own ideas” 1.1.2.1 Accuracy Accuracy means the correct use of language in terms of grammar, vocabulary and pronunciation According ... the class when the entire learners share the same mother tongue, they may tend to use it first because students feel unnatural to speak to one another in a foreign language, and because they feel...
- 51
- 978
- 0
Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc
... and meaning is instantiated through language use Grabe and Kaplan [5] also emphasize that only teachers who understand theory and make a transition from theory to practice can make the most appropriate ... self-evaluation, and there should be a grading schema for the teacher to the final evaluation The teacher will make the checklists understandable to students by training students to use them All of ... variation in general and stylistic variation in particular They will come to know that their Vietnamese English is one variation of the English language, and that Vietnamese English belongs to...
- 6
- 704
- 1
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
... a phosphorimager and analyzed by IMAGEQUANT software The data were fitted to a single-site binding equation Interaction between SerRS and Pex21p available SerRS proteins, and on the basis of the ... constructs as indicated on the right part of the panel, which shows the orientation on the plates that were tested b-Galactosidase activity was quantified using the Gal-ONp assay (C) The bars indicate ... mechanism Interestingly, in addition to the catalysis of the aminoacylation reaction, SerRS has also been found to participate in the synthesis and turnover of diadenosine oligophosphates (ApnA)...
- 12
- 406
- 0
Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt
... cortical and one primarily non-cortical (acute autonomic activation) The distinctness of the factors suggests that the four indicators of acute autonomic activation tapped by the STRS constitute a ... interpretable factor structure of the STRS confirms the adequacy of the two theoretical latent variables: 1) PTSD diagnostic criterion A, and 2) peritraumatic acute autonomic activation Several sample ... discarded and data from them were dropped from all subsequent analyses vation loaded onto the first factor (0.86, 0.72, 0.76, and 0.65, after rotation) The three items focusing on criteria A1 and...
- 8
- 491
- 0
báo cáo khoa học: " The implications of trade liberalization for diet and health: a case study from Central America" ppt
... capital base, economies of scale in storage and distri- bution and technological advancements in supply logistics, are able to make available a far wider range of snack foods relative to small ... stages of the nutrition transition and are experiencing rising rates of diet-related chronic disease, with associated health and economic implications [11-13] Third, information and data are available ... FAOSTAT database [14,15] FAO food balance sheet and supply utilization account data were used to provide information on food availability (for human consumption), and the ProdSTAT database provided...
- 15
- 462
- 0
báo cáo khoa học: " Effects of ulinastatin and docataxel on breast tumor growth and expression of IL-6, IL-8, and TNF-a" doc
... cells and many other cells Gong [10] demonstrated that increased TNF -a promotes invasion and metastasis in ductal carcinomas in a scalar fashion The TNF secreted by tumor-related macrophages can ... signal pathway to collaboratively down- regulate the plasminogen activator urokinase The application of UTI and etoposide can enhance the inhibition of metastasis in Lewis lung carcinoma (3LL) [2] ... GCCTGCTGCACTTTGGAGTG 3’, TNF -a anti-sense: 5’ TCGGGGTTCGAGAAGATGAT 3’, b-actin sense: 5’ GCAGAAGGAGATCACAGCCCT 3’, and b-actin anti-sense:5’ GCTGATCCACATCTGCT GGAA 3’ The SYBR Green/ROX qPCR master...
- 7
- 235
- 0
Moment and Shear, Generated by DL on the Composite Section
... truck and tandem The Design Truck Design truck axal spacing from rear The Design Tandem: The design tandem consists of a pair of 25k axles spaced 4ft apart Apply the dynamic load allowance to the ... -120.00 the other loads include slab, diaphragms (if there are any) and any other non-composite loads LRFD pre-stressed beam.mcd 7/1/2003 20 of 71 Expand area for moment and shear iterations, Also ... Service I The appropriate load combination (max or min) is shown in the total loads columns The minimum load factors for dead load are used when dead load and future wearing survace stresses are of...
- 18
- 371
- 0
Tài liệu How to use the Web to look up information on hacking ppt
... you don't understand it But in real Boolean algebra we can use the operators "and" "or" and "not" on word searches (or any searches of sets) "And" means you would have a search that turns up only ... nobody@cypherpunks.ca (John Anonymous MacDonald, a remailer node) 1996/12/12 Anyhow, this list goes on and on and on But if you specify "Carolyn Meinel hacker" and click "all" instead of "any" on the "Boolean" ... over to the Web sites listed at the end of this Guide Not only they carry archives of these Guides, they carry a lot of other valuable information for the newbie hacker, as well as links to other...
- 5
- 566
- 0
Báo cáo "The effect of Cu concentration in soil and phosphorous fertilizer on plant growth and Cu uptake by Brassia juncea L. grown on contaminated soils " doc
... increase upon the rates of Cu application, especially at the high rate of Cu above 100 ppm It can be said that the increase of rate of Cu uptake and accumulation in plants is much faster than the ... fertilizer application at the rate higher than 80kg P2O5/ha At the application rate of 80kg P2O5/ha, the height and biomass of plant are increased by 30% and 31% respectively, and the content of Cu ... combination of phosphate application on heavy metal uptake [1, 4] The main purpose of this research is to investigate the relation between contents of Cu in soil and Cu accumulation in plant, and also...
- 5
- 590
- 1
Charles Darwin: His Life in an1Charles Darwin: His Life in anAutobiographical Chapter, and in a Selected Series of His Published Letters, by Charles Darwin, Edited by Sir Francis Darwin This eBook is for the use of anyone anywhere at no cost and with potx
... fire at it with a cap on the nipple, and if the aim was accurate the little puff of air would blow out the candle The explosion of the cap caused a sharp crack, and I was told that the tutor of the ... islands of the Galapagos archipelago, and of all of them to the inhabitants of South America As far as I can judge of myself, I worked to the utmost during the voyage from the mere pleasure of ... whatever Macaulay said was final On another occasion I met at Lord Stanhope's house one of his parties of historians and other literary men, and amongst them were Motley and Grote After luncheon...
- 245
- 605
- 0
applications of biotechnology in traditional fermented foods by panel on the applications of biotechnology
... nuts, and other seeds, such as ontjom (Indonesia) and dawadawa (Savannah Africa); (c) those from tubers (cassava, aroids, potatoes), such as gari (Africa) and farinha puba (Brazil, Peru, and Ecuador); ... considered an offense to refuse a drink (15) In Brazil it is called kaschiri and in Mozambique masata Preparation of masato is similar to that of chica by the Andean Indians As a first step of ... Fermentation of the West and Central African iru or dawadawa is similar to the Japanese natto, and there is adequate literature on the preparation, biochemistry, microbiology, and industrialization...
- 207
- 532
- 0
báo cáo hóa học: "The use of body weight support on ground level: an alternative strategy for gait training of individuals with stroke" pptx
... data, and drafting the article CLPM was responsible to acquisition of data, analysis and interpretation of data, drafting the article TFS and JAB were responsible for interpretation of data and ... walking spatial-temporal parameters and for joint and segmental pattern and range of motion follow Temporal-spatial gait parameters Table depicts mean and standard deviation (± SD) of the walking ... be attributed to the adjustments the individuals had to make to walk with an unloading condition on the lower limb, and to the brief period of adaptation to the BWS system, as the use of the harness...
- 10
- 607
- 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA PB2 PB2/6U PB2/85 ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) ... a in 5' end non coding sequencea AGCAGUAGCAAGAGGAUUU(UUA) AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA...
- 11
- 427
- 0
Coaching Counseling & Mentoring How to Choose & Use the Right Technique to Boost Employee Performance by Florence M Stone_2 doc
... coaches have the advantage of seeing prospective team players on the field before they offer them a place on their team That isn’t the case for managerial coaches While you can and should contact ... team about the change, which as a manager faced with a major operational change, 60 COACHING he should have done Coaching is not a panacea, a cure-all that will make all management situations you ... good coaches, practice situational management, adapting the degree of direction they provide employees to their experience and self-confidence and to the nature and importance of the task assigned...
- 24
- 277
- 0
Coaching Counseling & Mentoring How to Choose & Use the Right Technique to Boost Employee Performance by Florence M Stone_3 docx
... would have postponed her conversation once again if she hadn’t overheard a conversation between Roxanne and another assistant, Marilyn Marilyn had noticed the typos, too, and had asked Roxanne ... implications of a continuation of that behavior You need to make clear that you’re talking not only about the effect on work itself and the standards by which the individual’s performance is being measured ... Michael, Richard, Joe, and Barbara into his of ce and asked them about the 360-degree feedback they had given him They all had nice things to say about Charlie until it came to the question of...
- 24
- 326
- 0
Coaching Counseling & Mentoring How to Choose & Use the Right Technique to Boost Employee Performance by Florence M Stone_4 pot
... performance, Chrissy learned the reason, and she and Bill agreed on an action plan Except that Bill didn’t live up to the action plan he signed off on The very next day, he was late again to work ... you a situation faced by my friend Charlie, a warehouse manager (see Chapter 5) CHARLIE: CONFRONTING GLORIA WITH THE FACTS For Gloria, Charlie’s assistant, there was actually a letter from a client ... performance As they talked, he was also able to communicate to Gloria the implications of her behavior both for the department and for her The department was short-staffed, and everyone had to pull...
- 24
- 313
- 0
Coaching Counseling & Mentoring How to Choose & Use the Right Technique to Boost Employee Performance by Florence M Stone_6 doc
... conversations, we have certain standards in the company that have to be met I think we approached those standards on a fair and reasonable basis Over the last few weeks [or months], I have told ... that the standards or other measurements you are using to make performance management decisions about an employee are realistic and are based on the actual needs of the job You have documentation ... a part of her appraisals Based on Alison’s reports, Karl felt that Shari deserved a rating of (poor) or (average), but because Alison refused to let Karl put her observations of Shari on paper,...
- 24
- 389
- 0
Coaching Counseling & Mentoring How to Choose & Use the Right Technique to Boost Employee Performance by Florence M Stone_8 pptx
... takes a certain ability One manager I know told me about a problem that arose Anna, who was located at headquarters, was mentoring Travis, a newbie at a regional of ce Anna had offered some advice ... up in the idea, Patrick mentioned the techniques he had learned to use: Pareto analysis, scatter diagrams, workflow diagrams, cause -and- effect diagrams, and variance analysis ‘‘Look I’m not as knowledgeable ... cause to end the mentoring relationship, regardless of its nature Overdependence on a mentor is a major trap, and the only way it can be addressed is by severing the relationship as soon as there...
- 24
- 302
- 0
Báo cáo khoa học: " The effects of ectomycorrhizal status on carbon dioxide assimilation capacity, water-use efficiency and response to transplanting in seedlings of Pseudotsuga menziesii (Mirb) Franco" docx
... parameters and the needle N concentrations There was a significant correlation between A and needle P concentration only in treatment Tt (fig 9a) , in the other treatments A was not related to P Stomatal ... weight (ratio of needle dry weight to needle area) Gas exchange and water -use efficiency Table II gives the mean values of CO as2 similation rate (A) , stomatal conductance (g) and water -use efficiency ... through mechanisms as diverse as improving mineral absorption and assimilation affecting hormonal balance in the plant, enhancing the Plant material contact between roots and soil, and pro- tecting...
- 13
- 437
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008