Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M 2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals Masaomi Minaba 1 , Susumu Ichiyama 2 , Katsura Kojima 3 , Mamiko Ozaki 4 and Yusuke Kato 1 1 Immune Defense Unit, National Institute of Agrobiological Sciences, Ibaraki, Japan 2 Institute for Biomolecular Science, Faculty of Science, Gakushuin University, Tokyo, Japan 3 Silk-Materials Research Unit, National Institute of Agrobiological Sciences, Ibaraki, Japan 4 Department of Biology, Faculty of Science, Kobe University, Japan G-protein-coupled receptors (GPCRs) are membrane receptors that are activated by specific agonist binding. Activated GPCRs affect intracellular heterotrimeric G proteins, which activate specific effectors (adenylyl cyclase, phospholipase C, etc.) [1]. The heterotrimeric G protein consists of Ga,Gb and Gc subunits [2,3]. The coupling specificity with GPCRs and effectors is mainly determined by Ga, although Gb and Gc also affect the specificity. Approximately 950 GPCR genes have been found in the human genome, but only 17 Ga have been identified, which indicates that a sin- gle Ga must couple with many GPCRs [4,5]. GPCR–G protein signalling regulates various phy- siological functions in a wide variety of organisms including plants and animals [6–9]. Therefore, such physiological functions can be affected by manipula- tion of the GPCR–G protein signal transduction. Our interest is in the use of GPCRs derived from evolutio- narily distant organisms for the manipulation of G protein signalling. GPCRs recognize a wide variety of ligands. Although some ligands are conserved in many organisms (e.g. acetylcholine, serotonin), others are recognized in only a few organisms (e.g. peculiar peptide hormones). GPCRs recognizing such unique ligands are often found in evolutionarily distant organ- isms. If such GPCRs can couple with the target Ga, we can manipulate the GPCR–G protein signalling of transgenic individuals by using specific ligands that do not activate any receptors in wild-type individuals. However, the coupling of GPCRs and G proteins Keywords biotechnology; Caenorhabditis elegans; G protein; muscarinic acetylcholine receptor; nematodes Correspondence Y. Kato, Immune Defense Unit, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8634, Japan Fax ⁄ Tel: +81 29 838 6059 E-mail: kato@affrc.go.jp (Received 18 August 2006, revised 12 October 2006, accepted 17 October 2006) doi:10.1111/j.1742-4658.2006.05542.x Signal transduction mediated by heterotrimeric G proteins regulates a wide variety of physiological functions. We are interested in the manipulation of G-protein-mediating signal transduction using G-protein-coupled receptors, which are derived from evolutionarily distant organisms and recognize unique ligands. As a model, we tested the functionally coupling GOA-1, Ga i ⁄ o ortho- log in the nematode Caenorhabditis elegans, with the human muscarinic acetylcholine receptor M 2 subtype (M 2 ), which is one of the mammalian Ga i ⁄ o -coupled receptors. GOA-1 and M 2 were prepared as a fusion protein using a baculovirus expression system. The affinity of the fusion protein for GDP was decreased by addition of a muscarinic agonist, carbamylcholine and the guanosine 5¢-[3-O-thio]triphosphate ([ 35 S]GTPcS) binding was increased with an increase in the carbamylcholine concentrations in a dose- dependent manner. These effects evoked by carbamylcholine were completely abolished by a full antagonist, atropine. In addition, the affinity for carbamyl- choline decreased under the presence of GTP as reported for M 2 –Ga i ⁄ o coup- ling. These results indicate that the M 2 activates GOA-1 as well as G a i ⁄ o . Abbreviations EC 50 , 50% effective concentration; Ga,Gb and Gc, heterotrimeric G protein alpha, beta and gamma subunits; GPCR, G protein-coupled receptor; GTPcS, guanosine 5¢-[3-O-thio]triphosphate; IC 50 , 50% inhibitory concentration; M 2 , muscarinic acetylcholine receptor M 2 subtype; NMS, N-methylscopolamine; QNB, L-quinuclidinyl benzilate. 5508 FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS derived from evolutionarily distant organisms has not been systematically examined. Mammalian Ga of heterotrimeric G protein is categ- orized into four groups (Ga s ,Ga i ⁄ o ,Ga q ⁄ 11 and Ga 12 ) [10]. Ga o is a member of the Ga i ⁄ o class. Caenorhabditis elegans, a nematode, is a genetic model organism widely used in laboratories [11]. The whole genome sequence of C. elegans has been determined in multicellular organ- isms [12]. In the genome of C. elegans,21Ga have been found [13,14]. Although some Ga appear to be unique in nematodes, orthologs of mammalian Ga s ,Ga q ,Ga 12 and Ga i ⁄ o have also been identified. GOA-1 is the Ga i ⁄ o ortholog in C. elegans [15]. GOA-1 is specifically expressed in neurons in adults [16,17]. Knockout and overexpression of goa-1, the gene encoding GOA-1, affect some behaviors such as locomotion, egg-laying and mating [16,17]. In addition, GOA-1 also regulates the susceptibility to volatile anesthetic [18] and olfactory adaptation [19]. The function of GOA-1 in neurons is partly explained as antagonizing EGL-30 (Ga q ortho- log) [20,21]. Furthermore, GOA-1 controls embryonic spindle positioning in single-cell embryos [22]. In the embryo, GOA-1 is activated by cytoplasmic guanine exchange factor-like protein, RIC-8, independently of GPCR [22]. However, there is no experimental evidence for GOA-1 activation by GPCRs. In this study, we tested the functional coupling of the mammalian Ga i ⁄ o -coupled receptor, human M 2 , to the nematode GOA-1 as a model of manipulation using GPCRs derived from evolutionarily distant organisms. The M 2 receptor has been best characterized as a Ga i ⁄ o - coupled receptor since its primary structure determin- ation in 1986 [23]. Although Gb and Gc are essential for Ga activation by GPCR [10], GPCR can activate Ga without Gb and Gc in some GPCR::Ga fusion proteins [24]. Muscarinic-agonist-dependent Ga activation can be detected in an M 2 ::Ga i1 fusion protein [25]. A large- scale preparation of the fusion protein has been estab- lished using a baculovirus expression system [25]. Therefore, M 2 receptor is one of the best models for mammalian Ga i ⁄ o -coupled receptors. The effector regu- lated by GOA-1 is still unclear, suggesting that GOA-1 activation should be directly measured to evaluate the coupling of M 2 with GOA-1. We prepared an M 2 mutant::GOA-1 fusion protein and directly assessed the muscarinic-ligand-dependent activation of GOA-1. Results Expression of M 2 ::GOA-1 fusion protein The human M 2 receptor is a Ga i ⁄ o -coupled receptor. To test whether M 2 can activate GOA-1, a fusion protein of M 2 mutant and GOA-1, myc-M 2 (N-D)I3- del::GOA-1, was expressed in the insect culture cell Sf21 using a baculovirus expression system (Fig. 1A). A B Fig. 1. Expression of myc-M 2 (N-D)I3del::GOA-1. (A) Diagram of expression construct. GOA-1 was directly fused at the C-terminus of M 2 .Amyc-epitope tag was added at the N-terminus of M 2 .To prevent rapid degradation, the central part of the third intracellular loop of M 2 was deleted. Asn at putative N-glucosylation sites near the N-terminus of M 2 were mutated to Asp to avoid various migra- tions in western blot analyses. (B) Western blot analysis of myc-M 2 (N-D)I3del::GOA-1. The membrane fraction of baculovirus- infected cells was studied. The fusion protein was detected using an alkaline phosphatase conjugated monoclonal antibody against myc. The calculated mass for the recombinant protein (78 kDa) is indicated by an arrow. Lane 1, wild-type virus infected cells; lane 2, recombinant virus infected cells. M. Minaba et al. Human GPCR activates nematode G protein FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS 5509 In this recombinant protein, GOA-1 was directly fused at the C-terminus of M 2 .Amyc-epitope tag was added at the N-terminus of M 2 . To prevent rapid degrad- ation, the central part of the third intracellular loop of M 2 was deleted [26]. Asn at putative N-glycosylation sites near the N-terminus of M 2 was mutated to Asp to avoid diversified migration in western blot analyses [27]. These modifications to M 2 do not interfere with the M 2 –Ga i ⁄ o interaction [28]. Membrane fractions of transfected cells were subjected to western blot analysis with anti-myc serum (Fig. 1B). A major band (78 kDa) was detected specifically in transfected cells expressing the recombinant protein. This is almost identical to the calculated molecular mass (77 660.17 Da), suggesting that myc-M 2 (N-D)I3del::GOA-1 was expressed over the detection sensitivity in the western blot analysis and well transferred in the membrane fraction. Binding properties of muscarinic ligands with M 2 ::GOA-1 fusion protein The binding properties of muscarinic ligands were examined to reveal whether the M 2 receptor in myc- M 2 (N-D)I3del::GOA-1 was functional. The membrane fraction expressing myc-M 2 (N-D)I3del::GOA-1 showed high-affinity binding to the radiolabeled ligands l-quinuclidinyl benzilate ([ 3 H]QNB) and N-methyl- scopolamine ([ 3 H]NMS) (Fig. 2A). This binding was abolished by addition of the full antagonist, atropine. In addition, the 50% inhibitory concentration (IC 50 ) for [ 3 H]QNB displacement was estimated for atropine (5 · 10 )8 m), and the full agonist, carbamylcholine (5 · 10 )4 m) in the absence of GTP (Fig. 2B). These IC 50 values are very like those with M 2 (N-D)I3del:: Ga i1 (5.0 · 10 )8 m for atropine, and 3.3 · 10 )4 m for carbamylcholine) [25]. These results indicate that M 2 in the GOA-1 fusion protein is functional, and the ligand-binding properties agree with that of the Ga i1 fusion protein. Activation of GOA-1 by muscarinic agonists Agonist-bound GPCRs are considered to interact with G proteins. This interaction causes a decrease in the affinity for GDP of Ga and the subsequent substitu- tion of GDP by GTP [10]. Such an agonist-dependent decrease in the affinity for GDP can be detected as the increase in binding of the nonhydrolysable GTP ana- log guanosine 5¢-[3-O-thio]triphosphate (GTPcS). This agonist-dependent decrease of GDP affinity has also been demonstrated in membrane preparations expres- sing the M2::Ga i1 fusion protein [25]. Here, similar binding properties of GDP and GTPcS were observed in the membrane preparations expressing myc-M 2 (N- D)I3del::GOA-1. The binding of GTPcS was increased by stimulation of myc-M 2 (N-D)I3del:: GOA-1 with carbamylcholine in a dose-dependent manner (Fig. 3A). The 50% effective concentration (EC 50 ) value was estimated to be 10 )5 m. The increase of GTPcS binding was completely inhibited by Fig. 2. Binding of muscarinic ligands. All experiments were performed in triplicate. Each data point represents the mean ± SEM. (A) Binding of [ 3 H]QNB and [ 3 H]NMS to myc-M 2 (N-D)I3del::GOA-1. The membrane fraction containing 10 l g recombinant protein was tested. (B) Displacement by atropine and carbamylcholine of [ 3 H]QNB binding. The experiment was performed in the presence (dotted line) or absence (solid line) of 1 m M GTP. [ 3 H]QNB binding was normalized to the value obtained at atropine ¼ 10 )13 M or carbamylcholine ¼ 10 )7 M, respectively. Human GPCR activates nematode G protein M. Minaba et al. 5510 FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS atropine (Fig. 3A), suggesting that carbamylcholine induced the substitution for GTPcS in GOA-1. The IC 50 value of the displacement of GTPcS by GDP was 3 · 10 )6 m with 0.2 mm atropine, and 10 )4 m without atropine in the presence of 1 mm carbamylcholine, which induced the maximum increase in GTPcS bind- ing (Fig. 3B), suggesting that carbamylcholine caused the decrease of GDP affinity in GOA-1. These results indicate that M 2 functionally couples with GOA-1 as well as Ga i1 . GTP affects affinity of muscarinic ligands The affinity of M 2 for agonists, but not for antago- nists, decreases on interaction with Ga i ⁄ o in the pres- ence of guanine nucleotides [28–30]. The affinity for carbamylcholine of myc-M 2 (N-D)I3del::GOA-1 dec- reased in the presence of GTP (IC 50 ¼ 3 · 10 )3 and 5 · 10 )4 m in the presence and absence of GTP, respectively; Fig. 2B). In contrast, the affinity for atro- pine was not affected by GTP (Fig. 2A). These results indicate that M 2 in the fusion protein interacts with GOA-1 as well as with Ga i1 in a GTP-sensitive manner. Discussion In this study, we have shown that the human Ga i ⁄ o - coupled receptor, M 2 , can activate GOA-1, which is the Ga i ⁄ o ortholog in the nematode C. elegans. The ligand-binding properties of M 2 mutant::GOA-1 fusion protein were similar to those of Ga i ⁄ o fusion protein. In addition, GTP causes the decrease of affinity for carbamylcholine to M 2 . These properties are almost identical to those of M2–Ga i ⁄ o coupling, suggesting that the function of GOA-1 and Ga i ⁄ o was evolutio- narily conserved in the coupling with M 2 . These results also indicate that the distinct amino acids in GOA-1 are neutral for coupling to M 2 .An alignment of GOA-1 and other M 2 -coupled Ga pro- teins is shown in Fig. 4. GOA-1 is the ortholog of mammalian Ga i ⁄ o in C. elegans. BLAST database searches identified the human Ga o (accession no. NM138736) as the most similar Ga in mammals. The amino acid sequence of GOA-1 is 82.2% identical to that of Ga o . Although the similarity of the aA–aE region and the region upstream of a4 was relatively low, the N-terminal region (aN–a1), the aF–aG region and the C-terminal region (a4–a5) were well conserved between GOA-1 and Ga o [31,32]. The five regions of the Ga-subunit involved in receptor recognition are the a2 helix, the b6 ⁄ a5 loop, the a5 helix and the N- and C- extreme termini [31]. In addition, the a4 helix and a4 ⁄ b6 loop region of Ga i1 are important for specific recognition of receptors [33]. The distinct sub- stitution observed in GOA-1 was relatively rare in those regions, suggesting that M 2 should interact with GOA-1 in a similar manner to that of Ga i ⁄ o . The EC 50 value of carbamylcholine for myc-M 2 (N- D)I3del::GOA-1 in GTPcS binding was estimated to be 10 )5 m in the presence of 1 lm GDP and 10 mm MgCl 2 . This value is greater than that of the fusion protein to Ga i1 without the N-terminal myc-tag, M 2 (N-D)I3del::Ga i1 (2.6 · 10 )7 m), under the same experimental conditions [25]. The IC 50 values of atro- pine and carbamylcholine for myc-M 2 (N-D)I3del:: GOA-1 in [ 3 H]QNB displacement was like those of M 2 (N-D)I3del::Ga i1 . In addition, the myc-tagged M 2 was reported to be indistinguishable from the unmodi- fied M 2 in [ 3 H]QNB binding [34]. These results suggest Fig. 3. Effect of carbamylcholine and atropine on [ 35 S]GTPcS bind- ing of myc-M 2 (N-D)I3del::GOA-1. All experiments were performed in triplicate. Each data point represents the mean ± SEM. (A) Increase in [ 35 S]GTPcS binding by carbamylcholine in the presence of 10 )6 M GDP. M 2 (N-D)I3del alone caused no increase in [ 35 S]GTPcS binding [25]. (B) Decrease in GDP affinity by carbamyl- choline. The experiment was performed in the presence of 1 m M carbamylcholine. Dotted line, in the presence of 0.2 mM atropine; solid line, in the absence of atropine. M. Minaba et al. Human GPCR activates nematode G protein FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS 5511 that the addition of myc-tag should not affect the lig- and-binding properties of M 2 . The mechanism of this difference in EC 50 values remains to be elucidated. To date, GOA-1 activation has been reported only in an RIC-8-dependent and GPCR-independent man- ner using the GTPcS-binding experiment. Here, we Fig. 4. Alignment of Ga activated by M 2 . Secondary structures are indicated [32]. The distinct amino acid residues only observed in GOA-1 are represented as inversed characters (gray, distinct but similarity was conserved among all Ga; black, distinct and not similar). Human GPCR activates nematode G protein M. Minaba et al. 5512 FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS represented the GPCR-dependent GOA-1 activation. Therefore, both GPCR-dependent and -independent activation of GOA-1 have been experimentally evi- denced. C. elegans is the best genetic model. The generation of transgenic C. elegans has been established and is easier than that of other animal models [35]. The results of this study indicate that the Ga i ⁄ o ⁄ GOA-1- coupled receptors may be compatible between mammals and nematodes. As mentioned previously, overexpression of GOA-1 causes various visible phe- notypes in C. elegans, suggesting that further in vivo studies should be performed using C. elegans towards the use of GPCRs derived from evolutionarily distant organisms for manipulation of G-protein signalling. In this study, M 2 was selected as a model of mamma- lian Ga i ⁄ o -coupled receptors mainly due to its conveni- ence for experimental use, i.e. the abundant expression using a baculovirus system has been established, and the pharmacological properties have been revealed in detail. Here, we evaluate M 2 for the manipulation of GOA-1 signalling in C. elegans. The natural ligand of M 2 , acetylcholine, is a neuro- and neuromuscular trans- mitter not only in mammals, but also in nematodes [36], suggesting that the use of M 2 is restricted by the influence of intrinsic acetylcholine. In C. elegans, three muscarinic acetylcholine receptors have been found (GAR-1, -2 and -3). Although the pharmacological properties of GAR-1 and -2 are clearly distinct from those of mammals [37,38], that of GAR-3 is compar- able (e.g. the muscarinic agonist, oxotremorine, is effective on GAR-3, but not on GAR-1 and -2) [39], suggesting that the manipulation of GOA-1 signalling by M 2 using muscarinic agents may be accompanied by affecting GAR-3 in C. elegans. However, gar-3 is expressed only in the pharynx and controls pharyngeal pumping [40], indicating that the side effect of the acti- vation of GAR-3 is limited. Furthermore, the pheno- type of gar-3 loss-of-function mutants is almost wild- type with the exception of a faster pharyngeal pumping rate [40], suggesting that the side effect of GAR-3 acti- vation may be avoided using M 2 transgenic worms in a gar-3 mutant background. In conclusion, M 2 is a good candidate for the manipulation of GOA-1 signalling in C. elegans under carefully controlled conditions. Experimental procedures Expression of myc-M 2 (N-D)l3del::GOA-1 fusion protein The cDNA-encoding M 2 mutant, myc-M 2 (N-D)I3del, was amplified by PCR using the M 2 (N-D)I3del::Ga i1 expression construct, pPAK-M 2 –Ga i1 [25], as a template with the following primers: M 2 -myc-EcoRI-s, 5¢-CAGAATTCatg gagcagaagctgatctccgagga ggacctg ctg GTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢. (An engineered EcoRI recognition site is single-underlined. The start codon is double-underlined. The modified original start codon of M 2 is dot-underlined. The engineered region containing myc- epitope tag encoded region is indicated in lower case.) GOA-1 cDNA was amplified by RT-PCR using total RNA separated from mix stage of C. elegans as a template with the following primers: M2-goa1-s, 5¢- CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TT CTGCAGTTAATACAA GCCGCATCCACGAAGA-3¢. (An engineered PstI recognition site is single-underlined. The overlapping region to the C-terminus of M 2 is double- underlined.) The cDNAs encoding M 2 (N-D)I3del and GOA-1 were fused by a fusion PCR using the overlapping region. The fusion cDNA contains a myc-epitope tag (EQ- KLISEEDL) and an EcoRI recognition site at the 5¢-end and a PstI recognition site at 3¢-end. The fusion PCR prod- uct was cloned into a baculovirus transfer vector, pFAST- Bac1 (Invitrogen, Carlsbad, CA) using the engineered restriction sites. Recombinant baculoviruses were generated in Sf21 insect culture cells by using a Bac-to-Bac Baculo- virus Expression Kit (Invitrogen). The conditioned medium containing the recombinant viruses was directly used for the production of recombinant protein. Sf21 cells were grown at 28 °C to an 80% confluent monolayer and infec- ted with recombinant viruses. The cells were harvested at 48 h after infection and stored at )80 °C. Membrane preparation Frozen myc-M 2 (N-D)I3del::GOA-1 expressed cells were thawed and homogenized in Sf9 buffer (20 mm Hepes ⁄ KOH, pH 8.0, 1 mm EDTA, 2 mm MgCl 2 ,2mm EGTA, 1 lm pepstatin, 10 lm leupeptin, 0.28 lm E64, 0.2 mm benzamidine, 0.5 mm phenylmethylsulfonyl fluor- ide) on ice. The homogenate was centrifuged at 150 000 g for 1 h. The pellet (membrane fraction) was resuspended in phosphate buffer (137 mm NaCl, 2.7 mm KCl, 8.1 mm Na 2 HPO 4 , 1.47 mm KH 2 PO 4 , pH 7.44). Protein concentra- tion was assessed using a BCA assay kit (Pierce, Rock- ford, IL) and adjusted at 1 mgÆmL )1 by adding phosphate buffer. Western blot Five microliters of the membrane fraction was resuspended in 1· SDS ⁄ PAGE loading buffer. SDS ⁄ PAGE was per- formed using a 3–15% (w ⁄ v) polyacrylamide gel (ATTO, Tokyo, Japan). Following electrophoresis, the gel was M. Minaba et al. Human GPCR activates nematode G protein FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS 5513 washed in Towbin transfer buffer (25 mm Tris ⁄ HCl, 192 mm glycine, 20% methanol, pH 8.3). After soaking the gel in Towbin transfer buffer containing 0.05% SDS for 15 min to facilitate the transfer efficiency of large mole- cules, proteins were transferred onto a polyvinylidene fluo- ride membrane (Immobilon P; Millipore, Billerica, MA) using a semidry blotting equipment (Trans Blot SD; Bio- Rad, Hercules, CA). After transfer, the membrane was incubated in TBS-T buffer (20 mm Tris ⁄ HCl, 140 mm NaCl, 1% Tween 20, pH 7.5) containing 5% skimmed milk as a blocking agent for 1 h. The blocked membrane was incubated with an alkaline phosphatase conjugated mono- clonal antibody against myc (Invitrogen) for 1 h. Using an AP conjugate substrate kit (Bio-Rad), myc-tagged recom- binant proteins were detected as deep violet bands. Ligand-binding assay Binding of the radiolabeled muscarinic partial antagonists, [ 3 H]QNB and [ 3 H]NMS, was assessed. The membrane fraction containing 10 lg recombinant protein was added to 100 lL of the phosphate buffer containing 0.1 nm [ 3 H]QNB or 4 nm [ 3 H]NMS in the presence or absence of 0.2 mm atropine, a full antagonist for muscarinic re- ceptors. After incubation at 30 °C for 30 min, the reac- tion was terminated by filtration using a UniFilter-96 (Hewlett Packard, Palo Alto, CA), and rinsed three times with a KPB buffer (20 mm potassium phosphate, pH 7.0, 0.1 mm NaN 3 ) to remove the free labeled compounds. Scintillation reagent (Microscint20; Hewlett Packard) was added to each well of the air-dried filter. The radioactiv- ity of the membrane fraction on the filter was measured with a scintillation counter (TopCount NXT; Hewlett Packard). To estimate the relative affinity of carbamylcholine and atropine, displacement of [ 3 H]QNB binding was estimated. The membrane fraction containing 10 lg of recombinant protein was mixed with various concentrations of carba- mylcholine or atropine in 100 lL of phosphate buffer. The solution was mixed with 1 nm (final) [ 3 H]QNB and incubated at 30 °C for 30 min. The reaction mixture was filtered, and the radioactivity was measured as described previously. GTPcS-binding assay The binding reaction was performed in 100 lL of binding assay buffer (20 mm Hepes ⁄ KOH, pH 8.0, 1 mm EDTA, 160 mm NaCl, and 10 mm MgCl 2 ) containing 0.1 nm [ 35 S]GTPcS. Various concentrations of GDP, agonists and antagonists were added depending on the experimental aim. After the addition of 10 lg of membrane fraction, the reac- tion mixture was incubated at 30 °C for 1 h. The reaction mixture was filtered, and the radioactivity was measured as described previously. Computer-assisted sequence analysis BLAST database searches were performed via http:// www.ncbi.nlm.nih.gov/BLAST/. The molecular mass was estimated via http://usexpasy.org/tools/pi_tool.html. Acknowledgements We are grateful to Professor Tatsuya Haga (Gakushuin University) for helpful suggestions and critical reading of this manuscript. This work was supported by the program for Promotion of Basic Research Activities for Innovative Biosciences, Japan. References 1 Wettachureck N & Offermanna S (2005) Mammalian G proteins and their cell type specific functions. Physiol Rev 85, 1159–1204. 2 Bourne HR (1997) How receptors talk to trimeric G proteins. Curr Opin Cell Biol 9, 134–142. 3 Lambright DG, Sondek J, Bohm A, Skiba NP, Hamm HE & Sigler PB (1996) The 2.0 A ˚ crystal structure of a heterotrimeric G protein. Nature 379, 311–319. 4 Takeda S, Kadowaki S, Haga T, Takaesu H & Mitaku S (2002) Identification of G protein-coupled receptor genes from the human genome sequence. FEBS Lett 520, 97–101. 5 Walker MW, Jones KA, Tamm J, Zhong H, Smith KE, Gerald C, Vaysse P & Branchek TA (2005) Use of Caenorhabditis elegans Ga chimeras to detect G-protein-coupled receptor signals. J Biomol Screen 10, 127–136. 6 Gether U & Kobilka BK (1998) G protein-coupled receptors. J Biol Chem 273, 17979–17982. 7 Lefkowitz RJ (1989) G protein-coupled receptors. J Biol Chem 273, 18677–18680. 8 Perfus-Barbeoch L, Jones AM & Assmann SM (2004) Plant heterotrimeric G protein function: insights from Arabidopsis and rice mutants. Curr Opin Plant Biol 7, 719–731. 9 Spiegel AM, Shenker A & Weinstein LS (1992) Recep- tor–effector coupling by G proteins: implications for normal and abnormal signal transduction. Endocrin Rev 13, 536–565. 10 Simon MI, Strathmann MP & Gautam N (1991) Diver- sity of G proteins in signal transduction. Science 252, 802–808. 11 Riddle DL, Blumenthal T, Meyer BJ & Priess JR (1997) C. elegans II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 12 The C. elegans Sequencing Consortium (1998) Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282, 2012–2018. Human GPCR activates nematode G protein M. Minaba et al. 5514 FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS 13 O’Halloran DM, Fitzpatrick DA, McCormack GP, McInerney JO & Burnell AM (2006) The molecular phylogeny of a nematode-specific clade of heterotrimeric G-protein alpha-subunit genes. J Mol Evol 63, 87–94. 14 Jansen G, Thijssen KL, Werner P, van der Horst M, Hazendonk E & Plasterk RHA (1999) The complete family of genes encoding G proteins of Caenorhabditis elegans. Nat Genet 21, 414–419. 15 Lochrie MA, Mendel JE, Sternberg PW & Simon MI (1991) Homologous and unique G protein alpha sub- units in the nematode Caenorhabditis elegans. Cell Regul 2, 135–154. 16 Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RHA & Sternberg PW (1995) Participation of the protein Go in multiple aspects of behavior in C. elegans. Science 267, 1652–1655. 17 Segalat L, Elkes DA & Kaplan JM (1995) Modulation of serotonin-controlled behaviors by Go in Caenorhabdi- tis elegans. Science 267, 1648–1651. 18 van Swinderen Metz LB, Shebester LD, Mendel JE, Sternberg PW & Crowder CM (2001) Goa regulates volatile anesthetic action in Caenorhabditis elegans. Genetics 158, 643–655. 19 Matsuki M, Kunitomo H & Iino Y (2006) Goalpha reg- ulates olfactory adaptation by antagonizing Gqalpha- DAG signaling in Caenorhabditis elegans. Proc Natl Acad Sci USA 103, 1112–1117. 20 Miller KG, Emerson MD & Rand JB (1999) Goa and diacylglycerol kinase negatively regulate the Gqa path- way in C. elegans. Neuron 24, 323–333. 21 Hajdu-Cronin YM, Chen WJ, Patikglou G, Koelle MR & Sternberg PW (1999) Antagonism between Goa and Gqa in Caenorhabditis elegans: the RGS protein EAT- 16 is necessary for Goa signaling and regulate Gqa activity. Genes Dev 13, 1780–1793. 22 Afshar K, Willard FS, Colombo K, Johnston CA, McCudden CR, Siderovski DP & Gonczy P (2004) RIC-8 is required for GPR-1 ⁄ 2-dependent Galpha func- tion during asymmetric division of C. elegans embryos. Cell 119, 219–230. 23 Kubo T, Fukuda K, Mikami A, Maeda A, Takahashi H, Mishina M, Haga T, Haga K, Ichiyama A, Kan- gawa K et al. (1986) Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetyl- choline receptor. Nature 323, 411–416. 24 Seifert R, Wenzel-Seifert K & Kobilka BK (1999) GPCR–Ga fusion proteins: molecular analysis of recep- tor–G-protein coupling. Trends Pharmacol Sci 20, 383– 389. 25 Zhang Q, Okamura M, Guo ZD, Niwa S & Haga T (2004) Effects of partial agonists and Mg 2+ ions on the interaction of M 2 muscarinic acetylcholine receptor and G protein Ga i1 subunit in the M 2 –Ga i1 fusion protein. J Biochem 135, 589–596. 26 Ichiyama S, Oka Y, Haga K, Kojima S, Tateishi Y, Shi- rakawa M & Haga T (2006) The structure of the third intracellular loop of the muscarinic acetylcholine recep- tor M 2 subtype. FEBS Lett 580, 23–26. 27 Kameyama K, Haga K, Haga T, Moro O & Sade ´ eW (1994) Activation of a GTP-binding protein and a GTP- binding-protein-coupled receptor kinase (beta-adrener- gic-receptor kinase-1) by a muscarinic receptor m 2 mutant lacking phosphorylation sites. Eur J Biochem 226, 267–276. 28 Hayashi MK & Haga T (1996) Purification and fuc- tional reconstitution with GTP-binding regulatory proteins of hexahistidine-tagged muscarinic acetyl- choline receptors (m 2 subtype). J Biochem 120, 1232– 1238. 29 Ikegaya T, Nishiyama T, Haga T, Ichiyama A, Kobaya- shi A & Yamazaki N (1990) Interaction of atrial mus- carinic receptors with three kinds of GTP-binding proteins. J Mol Cell Cardiol 22, 343–351. 30 Tota MR, Hahler KR & Schimerlik MI (1987) Recon- stitution of the purified porcine atrial muscarinic acetyl- choline receptor with purified porcine atrial inhibitory guanine nucleotide binding protein. Biochemistry 26, 8175–8182. 31 Coleman DE, Berghuis AM, Lee E, Linder ME, Gilman AG & Sprang SR (1994) Structures of active conforma- tions of G ia1 and the mechanism of GTP hydrolysis. Science 265, 1405–1412. 32 Mody SM, Ho MKC, Joshi SA & Wong YH (2000) Incorporation of Ga z -specific sequence at the carboxyl terminus increases the promiscuity of Ga 16 toward G i -coupled receptors. Mol Phamacol 57, 13–23. 33 Bae H, Anderson K, Flood LA, Skiba NP, Hamm HE & Graber SG (1997) Molecular determinants of selectiv- ity in 5-hydroxytryptamine 1B receptor–G protein inter- action. J Biol Chem 272, 32071–32077. 34 Park P, Sum CS, Hampson DR, Van Tol HH & Wells JW (2001) Nature of the oligomers formed by muscari- nic m 2 acetylcholine receptors in Sf9 cells. Eur J Phar- macol 421, 11–22. 35 Stinchcomb DT, Shaw JE, Carr SH & Hirsh D (1985) Extrachromosomal DNA transformation of Caenorhab- ditis elegans. Mol Cell Biol 5, 3484–3496. 36 Brownlee DJA & Fairweather I (1999) Exploring the neurotransmitter labyrinth in nematodes. Trends Neu- rosci 22, 16–24. 37 Lee YS, Park YS, Chang DJ, Hwang JM, Min CK, Kaang BK & Cho NJ (1999) Cloning and expression of a G protein-linked acetylcholine receptor from Caenor- habditis elegans. J Neurochem 72, 58–65. 38 Lee YS, ParkYS, Nam S, Suh S, Lee J, Kaang BK & Cho NJ (2000) Characterization of GAR-2, a novel G protein-linked acetylcholine receptor from Caenorhabdi- tis elegans. J Neurochem 75, 1800–1809. M. Minaba et al. Human GPCR activates nematode G protein FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS 5515 39 Hwang JM, Chang DJ, Kim US, Lee YS, Park YS, Kaang BK & Cho NJ (1999) Cloning and functional characterization of a Caenorhabditis elegans muscarinic acetylcholine receptor. Recept Channels 6, 415–424. 40 Steger KA & Avery L (2004) The GAR-3 muscarinic receptor cooperates with calcium signals to regulate muscle contraction in the Caenorhabditis elegans phar- ynx. Genetics 167, 633–643. Human GPCR activates nematode G protein M. Minaba et al. 5516 FEBS Journal 273 (2006) 5508–5516 ª 2006 The Authors Journal compilation ª 2006 FEBS . 5¢- CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2- goa1-PstI-as, 5¢-CCAATGCATTGG TT CTGCAGTTAATACAA GCCGCATCCACGAAGA-3¢. (An engineered PstI recognition. Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M 2 subtype Functional coupling of G- protein- coupled receptor and