Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M 2 subtype Functional coupling of G- protein- coupled receptor and G protein originated from evolutionarily ... 5¢-CAGAATTCatg gagcagaagctgatctccgagga ggacctg ctg GTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CC...
Ngày tải lên: 07/03/2014, 11:20
... mea- surement of GSH and GSSG using the recycling assay [11]. Glutathione protein mixed disulfides were determined by reducing the protein pellet with sodium borohydride and mea- suring the released GSH ... by 1–1.5 nmolÆmg protein )1 and led to the formation of GSSG and up to 0.4 nmolÆmg protein )1 of protein mixed disulfides (Fig. 2A, B). Under these condit...
Ngày tải lên: 06/03/2014, 09:22
... 5¢-TGCAGATTCCGCAATCTG CA-3¢ [34]; 3A1–300, 5¢-AGTCCTTCTGTAATGGTG TG-3¢; 3A1–600, 5¢-TGCAGGATTGCAGAAGTCTA TT-3¢; 3A1-700, 5¢-AATTTTGGTGGATAGATAT AG-3¢; m3A1-300, 5¢-AGTCC GTCTATGGTGGTGTG-3¢; m3 A1-600, 5¢-TGCAGGA CCGTAGAGGTCTATT-3¢ (mutated ... binding sites were as follows (mutated bases underlined): site 3A1-300: 5¢-GGAGA AAGTCC GTCTATGGTGGTGTGCAGATGACACAG TTTTGGC-3¢; site 3A1-600: 5¢-GCCTCT...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf
... isolated from the whole fruit body. The primer combinations TTC CCA GAG ATC GAG TCA ATG CGT (3¢-to5¢) and TCT GTC GTA CCA ACC AGT TGA (5¢-to3¢), designed on the basis of peptides 15 (FPEIESMR) and ... SDS-PAGE, and protein bands were visualized by Coomassie Brilliant Blue R-250 staining. The 55 kDa protein band was excised from the gel and in-gel digested with mo...
Ngày tải lên: 29/03/2014, 08:20
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... was introduced using a QuikChange kit (Stratagene, La Jolla, CA, USA) and the human FVII expression plas- mid pLN174 [38]. The sense primer 5¢-GGCTGCGCAAC CGTG GCCCACTTTGGGG-3¢ and a complementary reverse ... catalytic efficiency, the overall functional defect of G3 72A- FVIIa was, if anything, smaller in the presence of TF, which suggests that the allosteric effect of...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt
... within the cholinergic ligands-binding sites of the acetylcholine receptor by photoaffinity label- ling: additional evidence for a three-loop model of the cholinergic ligands-binding sites. J Biol ... binding of agonists [23]. In the GABA A receptor, the F64L mutation of the a1 subunit had a dramatic effect on GABA sensitivity [24] and mutations of the F77 resi...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Activation of activating transcription factor 2 by p38 MAP kinase during apoptosis induced by human amylin in cultured pancreatic b-cells ppt
... unlabelled oligo- nucleotides, either specific (containing the CRE sequence), or nonspecific [containing the SP1 binding site (5¢-AT TCGATCGGGGCGGGGCGAGC-3¢) in 200-fold excess], were added to the reaction ... isolated using DNAzol reagent (Invitrogen) as previously described [16]. A 636 nt DNA fragment for the c-jun promoter was generated by PCR using primers: 5¢-CCCAAAACCACTG GCCTGG...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
... ⁄ n-3 ratio 1 and ratio 2 in the pregnant gland compared with the virgin gland, respectively, suggest- ing a preferential accumulation of n-3 over n-6 PUFA in the gland during pregnancy. Preferential ... as molecular changes observed in the gland from the transgenic mice resemble the differentiated phenotype in the gland from the early pregnant mice. The transcriptio...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: Activation, regulation, and inhibition of DYRK1A Walter Becker1 and Wolfgang Sippl2 pptx
... to the hinge region (backbone NH of M24 0) and one to the conserved K188. Based on the model of the DYRK1A ⁄ harmine complex, it is suggested that the accessible volume of the ATP bind- ing pocket ... nega- tively regulated by DYRK1A [34]. The presence of potentially destabilizing AUUUA elements in the 3¢-UTR of the DYRK1A mRNA and the PEST region in the...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: Activation of hepatocyte growth factor activator zymogen (pro-HGFA) by human kallikrein 1-related peptidases docx
... 5¢-GGGAAATGAGAAATGCAGCCA- 3¢; HGF ⁄ SF reverse, 5¢-AGTTGTATTGGTGGGTGC-3¢; GAPDH forward, 5 ¢-GTGAAGGTCGGAGTCAACG-3¢; GAPDH reverse, 5¢-GGTGAAGACGCCAGTGGACTC- 3¢. The PCR products were analyzed by ... [13]: HGFA forward, 5¢-CCACTTGGATGAGAACGTGA-3¢; HGFA reverse, 5¢-ATGATGCCGTAGAGGTAAGC-3¢; MET forward, 5¢-TTGCCAGAGACATGTATGATAAAGAATACT-3¢; MET reverse, 5¢-TTGTCACTGGGGAAATGGAT-5¢; HGF ⁄ SF...
Ngày tải lên: 23/03/2014, 07:20