use of keratinocytes in combination with a dermal replacement to treat skin loss
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
... AJ.[4] 1999 Clinical Outcome in a Randomised year trial of Clozapine versus treatment as usual for patients with treatment resistant illness and a history of mania Prospective randomised trial ... clozapine after standard neuroleptic treatment had failed Efficacy of clozapine was satisfactory in 55–72% of patients with organic psychosis, mania, psychotic depression or Parkinson's disease ... in making a decision about treatment However, with regard to the question that was asked, the evidence supporting use of clozapine was rather limited The approach allows clinicians to use relatively...
- 6
- 495
- 0
Báo cáo khoa học: "A phase I radiation dose-escalation study to determine the maximal dose of radiotherapy in combination with weekly gemcitabine in patients with locally advanced pancreatic adenocarcinoma" doc
... human cancer cell lines including pancreatic cancer cell lines [9-12] Thus integration of gemcitabine with radiation in a CRT protocol represents an alternative approach to improve outcome in patients ... expectancy of more than months Pre-treatment evaluation included a complete history and physical examination, a diagnostic CT scan of the abdomen with intravenous (IV) contrast, as well as a blood exam ... prescribed at the centre of the target area or at the intersection of central rays of the beam Highly conformal beams were used, with at least incident beams and 18 MV photons CT-based treatment planning...
- 7
- 433
- 0
Báo cáo y học: "A rational use of glucocorticoids in patients with early arthritis has a minimal impact on bone mass" ppt
... because controlling inflammatory activity at early stages may prevent bone loss [17-19] The aim of this study was to analyze the patterns of GC use and the reasons for its use in a population of ... design of the study and in the data acquisition, in the statistical analysis, in the interpretation of the data, and helped to draft the manuscript All authors read and approved the final version of ... higher disease activity displayed a trend toward a greater decrease in BMD at the lumbar spine, total hip, and ultradistal forearm, and the association of the mean DAS28 with BMD loss during follow-up...
- 9
- 387
- 1
Use of Dreams in Couple Counseling: A Jungian Perspective pot
... following dream: A man at the tennis club was explaining an extraordinary invention to me: a complicated apparatus, an artificial arm and hand that made it possible for each tennis player to play ... dress, language and behavior A young man who wears torn jeans to a job interview with a conservative firm is lacking in persona The same would be true if he went to a casual party in a dark suit with ... personifications often appear in dreams The persona Persona originally stood for the kind of mask that Greek actors wore to portray a certain character Its use in psychology refers to the fact that...
- 156
- 565
- 1
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt
... anti-GFP or anti-myc antibodies [30] Microplate binding assay In vitro binding of wild-type and mutated GluR -A C-termini to SAP97 PDZ domains was analyzed by using a plate binding assay Briefly, ... multidomain scaffolding protein SAP97 emerges as a strong candidate to subserve synaptic delivery of GluR -A AMPA receptors Overexpression of SAP97 drives GluR -A to synapses and increases AMPA receptor ... GluR -A and AMPA receptor mediated synaptic currents [16] SAP97 may also play a role in the endocytosis of GluR -A AMPA receptors, based on identification of a ternary complex between SAP97, GluR -A and...
- 11
- 458
- 0
Báo cáo y học: "Clinical and immunological effects of Rituximab in patients with lupus nephritis refractory to conventional therapy: a pilot study" doc
... Abud-Mendoza C, Portillo-Salazar H, AlvaradoSanchez B, Cuevas-Orta E, Moreno-Valdes R, Baranda L, Paredes-Saharopulos O, Gonzalez-Amaro R: Immune effects of therapy with Adalimumab in patients with ... Representative histograms of flow cytometry analysis of CD3+ and CD19+ cells at day 30 Statistical analysis Data were compared with the Sigma STAT software (SPSS Inc., Chicago, IL, USA) using T paired ... the American College of Rheumatology were studied The main clinical data of these patients are given in Table All patients had active disease with renal involvement, which was classified according...
- 9
- 375
- 0
Báo cáo khoa học: "Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro" ppsx
... GGGAGAAGCATTAGGAGGG CAAGGAAAGCAAGGTGGG 270 NM_000684 b2-AR 60 Forward Reverse CAGCAAAGGGACGAGGTG AAGTAATGGCAAAGTAGCG 334 NM_000024 COX-2 57 Forward Reverse TTGACCAGAGCAGGCAGATG CCAGAAGGGCAGGATACAGC ... Gene Annealing temperature(°C) Primer sequence Amplicon (bp) Accession No b-actin 60 Forward Reverse ATCGTGCGTGACATTAAGGAGAAG AGGAAGGAAGGCTGGAAGAGTG 179 NM_001101 b1-AR 60 Forward Reverse GGGAGAAGCATTAGGAGGG ... Linear Accelerator, UK) at Mev with a source -skin distance of 100 cm and at a dose rate of 200 cGy/min Cell survival analysis Colony formation assays were used to quantify the cytotoxicity of...
- 8
- 486
- 1
báo cáo khoa học: "Phase 2 study of canfosfamide in combination with pegylated liposomal doxorubicin in platinum and paclitaxel refractory or resistant epithelial ovarian cancer" docx
... planned with canfosfamide in combination with PLD, an active, well tolerated regimen in patients with platinum refractory and primary platinum resistant ovarian cancer Kavanagh et al Journal of ... effect of TELCYTA™ (TLK286) in combination with paclitaxel, doxorubicin, carboplatin, oxaliplatin, cisplatin, docetaxel, gemcitabine and iressa in human cancer cells Proceedings of the American Association ... Grossman E, Namgoong S-Y, et al: Enhanced antitumor activity of TLK286 in combination with oxaliplatin, carboplatin, doxorubicin, paclitaxel and docetaxel in human colorectal, ovarian and breast cancer...
- 11
- 255
- 0
báo cáo khoa học: "Blunt cerebrovascular trauma causing vertebral arteryd issection in combination with a laryngeal fracture: a case report" ppsx
... bleeding combined with moderate intracranial swelling without any signs of incarceration of the brain stem Evaluation of the vascular status confirmed the initial finding of retrograde filling of ... patients can be treated with anti-coagulants The most important step in diagnosing a laryngeal fracture is the physician’s awareness and appropriate clinical examination Management of laryngeal ... example, hoarseness, laryngeal pain, aphonia, asymmetry, bleeding and subcutaneous emphysema) in the laryngeal area CT is recommended to evaluate the extent of laryngeal fractures [8] In a case...
- 3
- 230
- 0
Báo cáo y học: " The appropriate use of radiography in clinical practice: a report of two cases of biomechanical versus malignant spine pain" pps
... Rosenklint A: A comparative analysis of xray findings of the lumbar spine with and without lumbar pain Spine 1984, 9:298-300 Sorensen BF: The relationship of spinal x-ray low back pain and physical ... procedures and helps the clinician provide the best care available to patients by accurately interpreting that evidence and making those interpretations available to clinicians in a readily useable ... The female patient was treated in the lumbar spine with lateral decubitus manipulation and the male patient was treated with prone manipulation of the thoracic spine Each patient initially responded...
- 8
- 297
- 0
The Influence of Gender and Ethnicity on the Use of ICT in Higher Education A Case of Arts and Social Sciences Students in Universiti Malaya
... centuries) Also, there were “push” factors within China and “pull” factors within Malaya that encouraged many Chinese men to migrate (Suryadinata, 1997, p 9) 15 Interestingly, the role of Chinese in ... Second Malaysian Plan (1971-76) as a strategy to increase Malay participation in the economy UMNO (the dominant political party in Malaysia) claimed this was to resolve the alleged root cause of the ... disadvantaged people in countries like Malaysia, and, although the labor market participation of Malaysian women appeared to have increased with the advances in the IT sector, the Faculty of Arts and...
- 125
- 440
- 0
báo cáo hóa học: " Measuring disease-specific quality of life in rare populations: a practical approach to cross-cultural translation" potx
... Backward Translation A qualified professional translator (affiliated with a commercial translating service in Canada) performed a single backward translation into the original language, for each of the ... part of the process Back translation(final language into source language) ≥ Professional, naïve translators NSE.# Professional translators NSE Professional, naïve translators NSE Translate independently ... Table 1: A comparison of cross-cultural adaptations of quality of life measures (Continued) Total number of formal translations At least forward and back translations At least forward translations...
- 8
- 473
- 0
báo cáo hóa học:" Measuring disease-specific quality of life in rare populations: a practical approach to cross-cultural translation" docx
... Backward Translation A qualified professional translator (affiliated with a commercial translating service in Canada) performed a single backward translation into the original language, for each of the ... part of the process Back translation(final language into source language) ≥ Professional, naïve translators NSE.# Professional translators NSE Professional, naïve translators NSE Translate independently ... Table 1: A comparison of cross-cultural adaptations of quality of life measures (Continued) Total number of formal translations At least forward and back translations At least forward translations...
- 8
- 459
- 0
Báo cáo hóa học: "High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study" pptx
... Vassal G, Boland I, Terrier-Lacombe MJ, et al: Activity of fotemustine in medulloblastoma and malignant glioma xenografts in relation to O6alkylguanine-DNA alkyltransferase and alkylpurine-DNA ... surgical resection of part of the small intestine The pathological analysis confirmed the diagnosis of metastases from melanoma Patient died about months later because of a rapid disseminated brain ... elevated in patient (about double of the up limit of normal range) and near the upper normal limit in patients According to AJCC melanoma staging [2], patients had M 1a staging, patients had M1b...
- 8
- 459
- 0
báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx
... likely to be taking non-steroid antiinflammatory drugs, NSAIDs, (when aspirin was excluded) and anti-allergy drugs and cold/sinus (mostly anti-histamines), and less likely to be taking aspirin In addition, ... symptom complex of CFS and because most painrelievers of the NSAID group are accessible over the counter Persons with CFS used a variety of pain relieving/antiinflammatory drugs to treat arthritis ... Sedatives - Benzodiazepines Antidepressants Asthma medications Anti-histamines Cold/sinus Anti-migraine Anti-allergy Pain relievers (includes NSAIDs and narcotics) - Narcotic pain relievers - Acetaminophen...
- 11
- 512
- 0
báo cáo hóa học:" Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" doc
... likely to be taking non-steroid antiinflammatory drugs, NSAIDs, (when aspirin was excluded) and anti-allergy drugs and cold/sinus (mostly anti-histamines), and less likely to be taking aspirin In addition, ... symptom complex of CFS and because most painrelievers of the NSAID group are accessible over the counter Persons with CFS used a variety of pain relieving/antiinflammatory drugs to treat arthritis ... Sedatives - Benzodiazepines Antidepressants Asthma medications Anti-histamines Cold/sinus Anti-migraine Anti-allergy Pain relievers (includes NSAIDs and narcotics) - Narcotic pain relievers - Acetaminophen...
- 11
- 498
- 0
Báo cáo y học: "Deactivation of endothelium and reduction in angiogenesis in psoriatic skin and synovium by low dose infliximab therapy in combination with stable methotrexate therapy: a prospective single-centre study" ppt
... Gottlieb AB, Masud S, Ramamurthi R, Abdulghari A, Romano P, Chaudhari U, Dooley LT, Fasanmade AA, Wagner CL: Pharmacodynamic and pharmacokinetic response to anti-tumor necrosis factor-α monoclonal antibody ... which was maintained throughout the study (Fig 1) At week 16 the mean PASI was 1.8 Table Demographic and clinical data of study patients at baseline Data Age (years) 49 (26–70) Male:female ratio ... improvement in clinical signs and symptoms of psoriasis and PsA Decreased cell infiltration in both skin and synovial tissue associated with clinical improvement might be explained in part by deactivation...
- 9
- 374
- 0
Báo cáo khoa học: "Acute toxicity of second generation HIV protease-inhibitors in combination with radiotherapy: a retrospective case series" pptx
... chronological order of FDA approval, saquinavir, ritonavir, indinavir, nelfinavir, lopinavir, atazanavir, fosamprenavir (pro-drug of amprenavir, which is no longer available), tipranavir, and darunavir ... of malignancies treated Nearly all patients in the Plastaras et al study were treated with nelfinavir, three were treated with saquinavir (the oldest available PI), and one was treated with amprenavir ... ritonavir and one nelfinavir) The case series included more malignancies not associated with HIV or AIDS (ductal carcinoma of the breast, renal cell carcinoma, cholangiocarcinoma, and meningioma), and...
- 8
- 357
- 0
Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx
... mucosal damage than the same total dose given as a single fraction This damage-sparing effect by fractionating the radiation was retained also when chemotherapy was added (Table 1) The initial part ... chemoradiation a standard treatment for locally advanced rectal cancer Another drug, oxaliplatin, has become widely used in adjuvant [4], as well as palliative [5,6] treatment of colorectal cancer ... administered intraperitoneally Single doses of 5-FU (Mayne Pharma) 0-200 mg/kg and of oxaliplatin (Mayne Pharma) 0-10 mg/kg were administered alone or in combination with radiotherapy When combined,...
- 7
- 298
- 0
The use of a frailty index to predict adverse health outcomes (falls, fractures, hospitalization, medication use, comorbid conditions) in people with intellectual disabilities
... related to an age-related decline in health Since falls, in the general population, increase with age, this contributes to the explanation that age-related frailty is associated to increased fall ... physician or pharmacy Total medication count included the total number of medicines taken at the point of measurement Vitamins, minerals, basic skin creams (e.g vaseline), or anti-dandruff shampoo ... according to the anatomical therapeutic chemical classification (ATC) system and diagnosis by the physician Anatomical main group Diagnosis physician First level of the ATC code Alimentary tract...
- 9
- 332
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25