us is a vast and diverse nation many regions and subcultures that account for a wide spectrum of cultural norm
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate...
- 696
- 1,001
- 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... buffer and [c-32P]-ATP MBP was used as an artificial substrate to assess the kinase activity and GST alone was used as a negative control The top panel shows the kinase assay visualized by autoradiography...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG ... GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... GCGAAGCTTTTATTTGTCATCGTCATCCTTGTAGTCTTTCCCAGCCTGTTGGGCCTG GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT...
- 14
- 517
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT All experimental protocols ... FEBS Z-i Ando et al Six1– ⁄ – ⁄ Six4– ⁄ – mice revealed specific anomalies in earlier stages of otic and nasal development and in the formation of branchial arch and some cranial ganglia, which ... GSE2043 (a complete list of these genes appears in Table S1 and a partial list is shown in Table 1) Because only a single microarray was used for each condition, genes with a relatively low level of...
- 16
- 476
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... demonstration of complete HIF- 1a degradation after each cycle of 30 of reoxygenation, showing that HIF- 1a had not accumulated in the course of intermittent hypoxia cycles, and therefore that it is ... enzymes that lead to extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and...
- 12
- 390
- 0
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria of cinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, respectively, both isolated ... Gruber for stimulating discussions, and Dr Barry Coller for the generous gifts of 6F1 and 6D1 Tara C White and Michelle A Berny are ARCS scholars, and David K Robinson is the recipient of a Johnson ... dose–response and maximal aggregation of platelets did not differ in the presence of saratin (data not shown) However, onset of aggregation was significantly delayed in the presence of saratin (Fig 1A) , and...
- 11
- 440
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... stratification Conclusions Identification of cytogenetic abnormalities using karyotyping for prognosis and treatment of hematological malignancies has been a standard diagnostic tool for many years ... were normalized to a value of 150 using the mas5 algorithm in the Affymetrix Microarray Analysis Suite 5.0 For subsequent analysis, the average probe intensity was used for triplicates Values of ... cycle and response studies CM participated in the design of the study and performed the statistical analysis YD, MAH, CM conceived of the study, and participated in its design and coordination and...
- 10
- 618
- 0
Báo cáo sinh học: " Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" pptx
... been evaluated in laboratory studies of SARS-CoV: notable among these approaches are those using siRNA [7], passive antibody transfer [8], DNA vaccination [9], vaccinia or parainfluenza virus expressing ... FACS analysis BE performed data acquisition from the immunofluorescence experiments PR and TK provided critical reagents and revised the manuscript critically NS and SN along with MV and EB participated ... EB participated in the planning of the experiments, review and interpretation of data and critical review of the manuscript All authors read and approved the content of the manuscript Acknowledgements...
- 10
- 406
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... stratification Conclusions Identification of cytogenetic abnormalities using karyotyping for prognosis and treatment of hematological malignancies has been a standard diagnostic tool for many years ... were normalized to a value of 150 using the mas5 algorithm in the Affymetrix Microarray Analysis Suite 5.0 For subsequent analysis, the average probe intensity was used for triplicates Values of ... cycle and response studies CM participated in the design of the study and performed the statistical analysis YD, MAH, CM conceived of the study, and participated in its design and coordination and...
- 10
- 665
- 0
báo cáo hóa học:" Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" docx
... been evaluated in laboratory studies of SARS-CoV: notable among these approaches are those using siRNA [7], passive antibody transfer [8], DNA vaccination [9], vaccinia or parainfluenza virus expressing ... FACS analysis BE performed data acquisition from the immunofluorescence experiments PR and TK provided critical reagents and revised the manuscript critically NS and SN along with MV and EB participated ... EB participated in the planning of the experiments, review and interpretation of data and critical review of the manuscript All authors read and approved the content of the manuscript Acknowledgements...
- 10
- 302
- 0
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot
... preparation SL carried out NK cytotoxicity assays and manuscript preparation EHG carried out statistical analysis and manuscript preparation TBG carried out patient referral, clinical data analysis ... analysis and manuscript preparation MHP carried out patient referral, clinical data analysis and manuscript preparation AF carried out study design, NK studies oversight and manuscript preparation ... preparation AAG carried out study design, project oversight, patient referral, data analysis and manuscript preparation All authors read and approved the final manuscript Acknowledgements This work was...
- 8
- 365
- 0
Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx
... functional and positional characteristics suggestive of a role in the pathogenesis in SLE, and that the potential of the cell death mechanism aponecrosis to contribute to disease warrants study ... receptor is proinflammatory and induces a form of cell death known as aponecrosis, which exhibits several characteristics of apoptosis We therefore suggest that the P2X7 receptor and gene have the ... L, Papucci L, Tani A, Schiavone N, Tempestini A, Orlandini GE, Capaccioli S, Orlandini SZ: Aponecrosis: morphological and biochemical exploration of a syncretic process of cell death sharing apoptosis...
- 8
- 429
- 0
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx
... the statistical analysis of the data and drafted the manuscript MTBR and PABR assisted directly the qRT-PCR assays and the caspase 3-like activity experiment.GLR assisted the Agro-infiltration ... NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved in a variety of developmental events as well as in biotic and ... Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring...
- 14
- 254
- 0
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
... dose and pattern of administration were in accordance with current standards Failure of organs was evaluated using the Sequential Organ Failure Assessment (SOFA) scale on admission and during ... continuous variables are expressed as median (25th and 75th percentiles) The association between risk factors and death was first examined by means of bivariate analysis This was accomplished using ... homozygous, and three bands at 139, 101 and 38 bp indicated a heterozygote at the -1082 locus Statistical analysis The main outcome measure was in-hospital mortality from any cause, but we also assessed...
- 12
- 293
- 0
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx
... biophysical studies and neutralization assays, and drafted the manuscript DT participated to the neutralization and binding assays AA participated in the design of the study and writing of the manuscript ... BL and FC performed the neutralization assays involving ENF-resistant viruses MB conceived of the study, and participated in its design and coordination and writing of the manuscript All authors ... concentration of 10 μM and in a pH 7.2 buffer, displayed a positive peak after 195 nm and two negative maxima at 208 nm-222 nm, characteristic of α-helices (Figure 2) Quantification of the α-helical...
- 12
- 304
- 0
The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function
... Ras Rho ARF ClassI:ARF1, ARF2, ARF3 ClassII: ARF4, ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases ... Arl3p, are homologues of mammalian Arl1, Arl2 and ARFRP1 respectively (Takai et al., 2001) 10 Table A comparison of the identities and divergences of the mammalian ARF and Arl subfamily of small ... for most members at the moment 12 13 human ARF1 human ARF mouse ARF2 mouse ARF2 human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human...
- 184
- 301
- 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of...
- 9
- 634
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... were evaluated by the chi-square test for categorical variables Comparison of group differences for continuous variables was carried out by one-way analysis of variance or the Kruskal-Wallis test ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
- 10
- 597
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... (2004) Mammalian GLD–2 homologs are poly (A) polymerases Proc Natl Acad Sci USA 101, 4407–4412 Nakanishi T, Kubota H, Ishibashi N, Kumagai S, Watanabe H, Yamashita M, Kashiwabara S, Miyado K & Baba ... active form of Xp54 RNA helicase in translational repression is an RNA-mediated oligomer Nucleic Acids Res 32, 1325– 1334 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita ... Arlot-Bonnemains for the Maskinp17 and AuroraA two-hybrid constructs We thank M Simonelig for critical reading of the manuscript, and J M Donnay and G Herrada for technical assistance This work was supported...
- 14
- 502
- 0
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... primer pair (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, +1405 to +1428 bp) and actin primer pair (5¢-TTCGAGCAG GAGATGGCCACC-3¢ and 5¢-GAGATCCACATCTGYTG GAAGGT-3¢) ... ReverTra Ace (TOYOBO) The cDNA was amplified with TH-specific Regulation of melanin synthesis in insect cuticle primer pair (5¢-CAGCTGCCCAGAAGAACCGCGAGA TG-3¢, +11 to +36; and 5¢-GAACTCCACGGTGAACC AGT-3¢, ... separata TH and THs reported for other animals, including humans, are also > 70%, i.e 79, 78, 72, 72, and 71% with those of Drosophila melanogaster, Apis melifera, Rattus norvegicus, Mus musculus,...
- 10
- 440
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25