true false exercise the following statements can be true t or false f choose the appropriate letter t or f
Read the passage and decide if the following statements are TRUE or FALSE
... elevator runs to the top of the pedestal, and steps within the statue lead to the crown The Statue of Liberty was presented to the United States by the people of France in the Independence Day The ... copper The Statue of Liberty was put up on October 28th, 1886 It was a gift of friendship from the people of France to the people in the United States The Statue was built in France Then it was taken ... Indian travelers took maize to the other part of the world It is estimated that about 200 million people who use the Internet network around the world Most people use the Internet to get information...
- 8
- 1,872
- 1
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE
... have been raised by the auditors in their report and for one of them, the verification performed by the auditors was found to be highly insufficient to guarantee the reliability of the accounts The ... the IAS norms which state in their 'Framework for the preparation and presentation of financial statements' that 'the objective of financial statement is to provide information about the financial ... output constitutes more than 50 % of the total production of the like product produced by that portion of the Community industry expressing either support for or opposition to the complaint However,...
- 66
- 538
- 4
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?
... production, sales, profits, productivity etc.; - The interests of the Community: the costs for the Community of taking measures must not be disproportionate to the benefits Unlike the WTO's Anti-dumping ... the authorities of the importing country may take selling price offered by distributor to the first independent importer to be the normal price - The other two methods are alternatives they are ... Community industry The Community industry often communicates unofficially with officers of the Commission to determine whether there is sufficient evidence to justify the initiation of an investigation...
- 84
- 544
- 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf
... functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article The following supplementary ... of the presence or absence of NADPH (Fig 6, lower gel) These results correspond well with the phenomenon that PrPSc from hamster cannot convert recombinant mouse PrP into the PK-resistant form ... NAD, nor ascorbate, which merely works as an electron donor, possess this activity Therefore, it outlines that this enhancement depends on both electron transfer and structural similarity Nevertheless,...
- 10
- 342
- 0
The Research Tax Credit’s Design and Administration Can Be Improved potx
... option of switching to that credit in future years if it suited them better That small probability of switching in the future can reduce the negative future effects that the taxpayer expects to ... significant effect on the MER they received from the credit The lack of current tax liabilities was another factor that affected the MERs of many credit claimants In 2005, 44 percent of total net ... proprietorship, a partnership, a trust or estate or a corporation that is carrying on a trade or business The average effective rate (AER) of the credit equals the total credit benefit that the taxpayer...
- 119
- 1,692
- 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
... demonstrated that the mutation increased the half-life of total cellular Cx43 from to h [51] The disparity between these results may be due to the difference in cell lines used or to the fact that ... degradation between WT and the Y286A mutant but not between WT and any of the other mutants We expected to see a greater difference between WT and Y286A given that assay of the Y286A mutant in ... buffer containing b-mercaptoethanol and dithiothreitol for 10 7002 to strip off protein Then the samples were centrifuged for 10 at high speed at C All of the supernatant (containing the protein)...
- 14
- 433
- 0
Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps
... artery from the true lumen artery from the false lumen (Figure 1d) The right femoral artery was perfused from the false lumen while the left from the compressed true lumen and the functioning femoral-femoral ... reconstruction image of the thoracic aorta showing complete replacement of ascending aorta and aortic arch, the FET in the descending thoracic aorta and the saphenous vein grafts originating from the ... strict postoperative monitoring of these patients is required in order to detect the possible evolution of the aortic lesions, which can demand prompt intervention The future management of these...
- 5
- 571
- 0
Báo cáo y học: "Retention of foreign body in the gut can be a sign of congenital obstructive anomaly: a case report" potx
... Competing interests The authors declare that they have no competing interests Authors' contributions SPS assessed and interpreted the patient's gastrointestinal symptoms and the investigations ... consent was obtained from the parents of the child for publication of this case report and accompanying image A copy of the written consent is available for review by the Editor-in-Chief of this journal ... with the possibility of another obstructive lesion in the small bowel The foreign body was presumed to be lodged somewhere in the ileal loops The child was then subjected to exploratory laparotomy...
- 3
- 387
- 0
Báo cáo y học: " Polyclonal antibody against the DPV UL46M protein can be a diagnostic candidate" pot
... reaction The highest titer of the agar diffusion reaction of the anti-UL46M antiserum from the rabbits showed that the largest positive dilution multiple was 1:8 (Figure 4d) The highest titer of ... significant theoretical and practical value for understanding the molecular mechanism of DPV For the preparation of the anti-UL46 rabbit antibody, factors had to be considered First, the collecting ... diffused at 37°C for 24 h The largest dilution multiple of the sediment band identified the antibody titer ? Detection of the titer of anti-UL46M rabbit antibody by ELISA A 96-well microtiter...
- 10
- 271
- 0
Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot
... by the Ethics Committee of the University of Hirosaki Patients or their relatives gave informed consent A total of 50 patients admitted to the general ICU of the University of Hirosaki Hospital ... equivalent Competing interests The author(s) declare that they have no competing interests Authors' contributions HI designed the study, performed statistical analysis and drafted the manuscript HN, ... and TT collected data from the patients and performed calculations KH designed the study and evaluated the data All authors read and approved the final manuscript Acknowledgements The authors thank...
- 6
- 286
- 0
Báo cáo y học: "How the relationships between general practitioners and intensivists can be improved: the general practitioners'''' point of view" ppt
... discharge letter was the only contact with the ICU team Ninety-three percent of the GPs reported meeting the family during the patient's ICU stay (more than one meeting for 47%) A lack of information ... (36%) and the poor quality of information (85%) were the two major reasons for the patient's family to meet the GP GP and intensivist relationships at patient discharge Fifty-nine percent of the GPs ... patients, whereas only 33% of intensivists reported getting in touch with GPs The former finding was confirmed in the present study because GPs reported that the ICU team informed them of patient...
- 9
- 362
- 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
... lecture ought to start with an introduction to some important area of biology and end with a list of some of the major outstanding problems in that area and what sort of things would help get them solved ... chemists can t understand one another because the physical chemists speak a different jargon from synthetic organic chemists and so on And he says that biologists are better off because most biologists ... about this I mean, there’s no significant difference between 43% and 40% Clifford: If they think this is a big improvement, they’re barking up the wrong tree Mink: Uh, yes, as it were Clifford:...
- 2
- 190
- 0
Báo cáo y học: "In critically ill patients the procalcitonin level can be misleading" pdf
... Abbreviations ICU, intensive care unit; PCT, procalcitonin Competing interests The authors declare that they have no competing interests Author details Department of Critical Care, University Medical ... Koeze et al Critical Care 2011, 15:422 http://ccforum.com/content/15/2/422 on a test with unknown test characteristics, such as PCT, in patients presenting with criteria meeting the Surviving ... guidelines for severe sepsis or septic shock Fortunately, the Surviving Sepsis Campaign bundle is clear on this point and these patients received appropriate antibiotics in accordance with this guideline...
- 2
- 189
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... effect The binding of Hh to the receptor Patched (Ptc) triggers the signaling pathway by blocking the inhibitory activity of Ptc on Smoothened GPC3 competes with Ptc for Hh binding The interaction ... issues that requires attention in the near future is the cellular and molecular basis of the context specificity that characterizes glypican activity For example, what is the reason for the opposite ... that the stimulatory mechanism is based on the ability of glypicans to facilitate and /or stabilize the interaction of Wnts with their signaling receptors, the Frizzled proteins (Figure 2) [22] This...
- 6
- 390
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
... tTGAAAtTCtTTaTCgc pep*-fur1 4.56 -116 gTGAtAtTGAaaTTCtT 394231 -122 tTGAcAtTGAaaaTCAT AraC-type regulator tTGAtttTGAgTTTCAT cTGgtttTCATTaTCAT FoxR GGDEF domain protein 3.91 4.72 tTGAAAATCATTTTCgc ... -93 4.46 ATGAtttTCtTTTTCAa hdd* Flavodoxin 4.31 AcaAAAATCAaTTTCAa 208641 fld* -195 -189 tTGAcAtTGATTTTCgT ? tTGActtTGATTTTCAc tTGAtttTCgTTTTCAa genY*(C)-genZ* Regulator, Zn-dependent peptidase, ... Article R90 Rodionov et al http://genomebiology.com/2004/5/11/R90 (a) DD|394579 DV|206736 ACCCCATGT -TTATGTCTTTTTTTTATTCTGAT TTTGCCGCTTGACATTTTGCTAAAAATTTCACAAGACGTTGTC ATTCATTGTGCCCTTTGCAGTGCGTTCTGATTTTCGCGCTTTGCCGCTTGACATTTTGTAAATTTTTTCACAAGACGGAATC...
- 27
- 356
- 0
Báo cáo y học: "Clustering of phosphorylation site recognition motifs can be exploited to predict the targets of cyclin-dependent kinase" potx
... + foldedness) When the variables did not all contribute significantly, we report NS (not significant) For the other sets, the P values are for the addition of the least significant term to the ... identified the optimal cluster using SBN as described above To compute the position of the cluster, we calculated the distance between the start of the protein and the start of the cluster, and between ... cluster, and between the end of the cluster and the end of the protein We then took the minimum of these divided by the length of the protein to be the position We computed the foldedness as If = 2.785...
- 14
- 258
- 0
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
... necessarily the best theoretically possible, but they represent the best estimate given the limitations of data, time, and budget Financial Direct Costs The total financial direct costs under the different ... export projects in Cambodia, the Lao PDR, and CSG Exports from Viet Nam to the Lao PDR represent flows into the southern part of the Lao PDR; at the same time, Viet Nam is importing from the northern ... Total Cost Comparisons The costs of major impacts of power generation within the LMB are added to the direct costs of electricity generation to obtain estimates of the total costs of alternative...
- 50
- 456
- 0
When telling the world what you want to achieve can be counterproductive
... studies (the pattern was directionally consistent with the effect) There are several possible explanations for this First, a number of factors that contribute to the facilitative effect have been ... support condition, the participants could leave their signature on the attached petition form in support of the campaign They were then instructed to put the petition form into an envelope, and their ... publicity (or their consent to publicize) that the goal is important to them Overall, the three accounts suggest that goal publicity directs attention to the goal and strengthens motivations to act...
- 64
- 557
- 0
Maternal Mortality in the Gambia: Contributing factors and what can be done to reduce them
... and time of death then the duty roster for that week was retrieved to identify the particular staff or staffs who were on duty It was a really labor intensive task but that the head midwife of the ... could be a product of many factors It could be that as the death occurred at the hospital they are with the opinion that it is the hospital that should report such cases or may be a deliberate act ... services to resort to using other means of transportation from one facility to another because the ambulance at the facility of contact is not available This may be due to the ambulance is away on other...
- 141
- 527
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008