trial on impact of feed on growth of mystus filamentus fingerlings fang and chaux 1949 at stage from 24 days to 99 days old was carried from 28 april 2005 to 13 july 2005 at experimental farm for aquaculture belonging to nông lâm university in hcm city
Báo cáo khoa học: "The impact of compliance with 6-hour and 24-hour sepsis bundles on hospital mortality in patients with severe sepsis: a prospective observational study" pdf
... haemoglobin target of to g/dl instead of haematocrit ≥ 30%, and used remaining hypotension after fluid resuscitation for threshold of inotropes instead of central venous oxygen saturation (ScVO2) ... activated protein C was considered in only 30% of patients; and plateau pressures were maintained < 30 cm H2O in 85% of ventilated patients The entire 24- hour sepsis bundle was achieved in only ... 316:1853-1858 National Confidential Enquiry into Patient Outcome and Death: An acute problem? A report of the National Confidential Enquiry into Patient Outcome and Death London; 2005 Mant J, Hicks...
- 7
- 394
- 0
IMPACT OF THE EXTERNAL MAGNETIC FIELD AND THE CONFINEMENT OF PHONONS ON THE NONLINEAR ABSORPTION COEFFICIENT OF a STRONG ELECTROMAGNETIC WAVE BY CONFINED ELECTRONS IN COMPOSITIONAL SUPERLATTICES
... dependence of α on Ω in case of unconfined phonon E0 in case of confined phonon (m=2, m=5) of unconfined phonon (fig.3) for both of the nonlinear and the linear absorptions Fig.4 shows the dependence of ... width of compositional superlattices and Cqm⊥ is the electron-phonon interaction factor In case of the confined electron- confined optical phonon interaction with the quantization direction in z ... H] t (7) From Eq.(7), using Hamiltonian in Eq.(1), we obtain quantum kinetic equation for confined electrons in superlattices Using the first order tautology approximation method [13] to solve...
- 6
- 328
- 0
The impact of loyalty programs service quality and store reputation on customer satisfaction and loyalty
... positive impact of communication on the customer satisfaction H1f There is a positive impact of personalization on the customer satisfaction H1g There is a positive impact of information on the customer ... anticipated negative impact of tangibility and information on customer outcome, store reputation on customer outcome and the most important findings that customer satisfaction and customer loyalty ... in relationship marketing (Anderson and Narus, 1990 ) According to Salaün and Flores (2001), information is what forms or transforms a representation in the relation which links a system to its...
- 81
- 536
- 0
báo cáo khoa học: "Co-expression and impact of prostate specific membrane antigen and prostate specific antigen in prostatic pathologies" ppt
... and PSA seem to be inversely regulated in prostate cells, especially in prostate cancer cells Little information exists concerning the role of signaling pathway in regulating cell apoptosis and ... (Suppressor of cytokine signalling-3) [28, 45] Interestingly, treatment with bFGF stimulates the expression of PSMA in LNCaP (androgendependent) cell line and restores the expression of this protein in ... immunoreactions to PSA and PSMA in NP, BPH and PC samples We obtained a negative group for PSA and/ or PSMA in each prostate type The distribution of this group was as followed: in NP, 13 in BPH and 11 in...
- 9
- 284
- 0
Báo cáo y học: "Adolescent predictors of objectively measured physical activity and sedentary behaviour at age 42: the Amsterdam Growth and Health Longitudinal Study (AGAHLS)" potx
... revision of the manuscript, and participated in the conception, design, fund raising and data acquisition of AGAHLS MC participated in the design of the study, contributed to the analyses and interpretation ... and participated in the conception, design and data acquisition of AGAHLS LK participated in the fund raising, conception and design of the study, and provided critical revision of the manuscript ... underestimates some activities, such as cycling Since cycling is a common method of transportation in the Netherlands, underestimation of physical activity may have occurred Therefore, our findings...
- 5
- 283
- 0
A STUDY ON DIFFICULTIES IN READING ENGLISH FOR ELECTRICAL AND ELECTRONICS ENGINEERING AT VINH TECHNICAL TEACHERS’ TRAINING UNIVERSITY
... useful skill to locate a specific item of information that we need Readers pass over irrelevant information and focus only the particular point of information they wanted This kind of reading is widely ... look for “What time”, in order to look for definitions, see the words define, definition, mean, refer to Ignore other information and finally write down the specific required information *Guessing ... for the study It provides an overview on the nature of reading in which definitions of reading and reading comprehension as well as classification of reading according to the purpose of reading...
- 35
- 1,101
- 1
Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot
... E150A D173A H461A Zinc binding Catalytic Zinc binding Zinc binding General base General base Zinc binding Zinc binding Zinc binding GTGCTTCAAGCAGCGATCGACATGGTGCCAC GCACACATCGCCATGGTGCCACAAAAGAACG ... ligand-binding affinity and subsequent activation of the catalytic water for substrate–enzyme tetrahedral intermediate formation This effect, in turn, resulted in only partial loss of the enzymatic ... protein carried a His.Tag and a thrombin cleavage site in tandem as 5¢-fusion partners The 5¢-fusion was removed by thrombin incubation and the native PepD protein was used for metal ion determination...
- 14
- 303
- 0
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf
... (20) physical functioning, motor functioning, autonomy, and social functioning) three months after discharge and on one domain (indicating worse HRQoL on motor functioning) nine months after discharge ... mood (together emotional functioning), communication (cognitive functioning), and social functioning Scales that measure motor functioning, social functioning and communication are applicable only ... correspond with selfevaluations, depending on the health aspect being examined For example, concordance for items and domains concerning functional limitations are higher compared to items and domains...
- 9
- 440
- 0
báo cáo khoa học: " The implications of trade liberalization for diet and health: a case study from Central America" ppt
... utilization account data were used to provide information on food availability (for human consumption), and the ProdSTAT database provided information on domestic production While FAO data have ... Food Aid (1000 tonnes) 160 Food consumption quantity (1000 tonnes) Production, import, consumption, 1000 tonnes 140 120 100 80 60 40 20 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 ... (1000 tonnes) | Chicken meat + 500 400 300 200 100 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 Figure Production, imports, and availability for consumption of...
- 15
- 462
- 0
báo cáo khoa học: " Laboratory based surveillance of travel-related Shigella sonnei and Shigella flexneri in Alberta from 2002 to 2007" ppsx
... Laboratory for Public Health (Microbiology)(ProvLab) in Calgary and Edmonton, W Demczuk and the National Microbiology Laboratory in Winnipeg, Manitoba for their support and contributions Data from ... dominance of S flexneri STs and in isolates of Indian origin and cases of traveler’s diarrhea associated with the Indian subcontinent [23] One factor driving multi-drug resistance in the Indian ... from this paper was presented in part as a poster at the 26th International Congress of Chemotherapy and Infection, Toronto, Ontario, 2009 Author details Provincial Laboratory for Public Health...
- 6
- 263
- 0
Báo cáo y học: "Frequent CXCR4 tropism of HIV-1 subtype A and CRF02_AG during late-stage disease - indication of an evolving epidemic in West Africa" docx
... before the initiation of treatment [27 ,28] The gold standard for clinical samples is Page of 13 coreceptor determination by recombinant phenotypic entry assays [29,30] Reliable bioinformatic tools ... predisposed state of changing into CXCR4 phenotype on a population level, and a confirmation of this finding in larger cohorts may have implications for viral transmission, pathogenesis and disease ... WMA performed most of the cloning and colony-PCR, and participated in optimization of the cloning strategy EV carried out cell assays, ELISA experiments, and participated in optimization of the...
- 13
- 240
- 0
an investigation of the polysemy of open close' in english and mở đóng in vietnamese (from the cognitive perspective) = nghiên cứu tính đa nghĩa của động từ mở đóng trong tiếng anh và tiếng việt
... meanings are related in a systematic and natural way According to Lakoff (1987), polysemy has to be understood as categorization, that is to say the idea that related meanings of words form categories ... different forms of initiations, involving different sorts of events, procedures, and agents In contrast, in the example in (60f), the usage of open relates to a sudden and heavy downpour of rain, and ... conception of reality is that it consists of "goings -on" : of doing, happening, feeling, being The basic semantic framework for the representation of process consists potentially of three components:...
- 49
- 783
- 1
an investigation of the polysemy of open close' in english and mở đóng in vietnamese (from the cognitive perspective) = nghiên cứu tính đa nghĩa của động từ mở đóng trong tiếng anh và tiếng việt t
... data collection in which considerations in selecting materials and the sources of data are presented Additionally, a description of data analysis is also presented Chapter – Data Analysis– contains ... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST - GRADUATE STUDIES - - BÙI THỊ NGỌC AN INVESTIGATION OF THE POLYSEMY OF ‘OPEN/CLOSE’ IN ENGLISH ... languages convey such meanings can be different Accordingly, our findings are supposed to be worthwhile to those who are interested in the field of cognitive semantics in general and polysemy in particular...
- 7
- 483
- 2
An investigation of the polysemy of ‘open-close’ in english and ‘mỡ-đóng’ in vietnamese (from the cognitive perspective)
... Chí Minh In English Barcelona, A 1997 Clarifying and Applying the Notions of Metaphor and Metonymy within Cognitive Linguistics Atlantis XIX.1: 21-48 Biber D et al (2007), Grammar of spoken and ... Oxford handbook of Cognitive Linguistics Oxford: Oxford University Press 16 Halliday, M.A.K ( 1999 ), An Introduction to Functional Grammar Oxford: Oxford University Press 17 James, C (1980), Contrastive ... rewarding one It has helped me develop polysemy in my mind as a referent to apply to my own day -to- day practices and research in communication, teaching and learning SCOPE OF THE STUDY Within a...
- 9
- 666
- 4
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... full connections to monitors, ventilators, syringe pumps and also connection with the hospital information system for administrative patient data and laboratory results The CDSS consisted of several ... prescriptions; Monitoring, drug monitoring error; Others, errors in posology, concentration, contra-indication Page of (page number not for citation purposes) Available online http://ccforum.com/content/10/1/R21 ... Preparation instructions (incorrect or omitted solvent or dilution, if not available on standard nursing charts) Adequate drug monitoring (no monitoring, wrong drug monitoring, if necessary according...
- 9
- 738
- 1
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... wishes for more information The questionnaire contains the following scales: (a) Information about the disease; (b) Information about medical tests; (c) Information about treatment; (d) Information ... patient consultation For each patient, a detailed registration is made, including information about FIGO (International Federation of Gynecology and Obstetrics) stage, grade, treatment, complications, ... Information on other services, and single items: (a) Written information; (b) Information on CDs or tape/ video; (c) Satisfaction with the amount of information; (d) Desire for more information; (e)...
- 8
- 786
- 0
The Impact of Education on Economic Growth Theory, Findings, and Policy Implications potx
... number of earned doctorates among faculty and administrators … [and] student-faculty ratios. 13 No consensus exists regarding the ideal combination of such measures in the formation of an index of ... the notion that the true return to education may be twice that found through OLS estimation of the Mincerian wage equation .24 An ongoing examination of the rates of return to education throughout ... developing nations 15 services;29 2) faster rates of innovation within industry; 3) more informed voting choices among the electorate.30 Private rates of return to education are still useful in the...
- 30
- 1,097
- 4
The impact of related variety on regional employment growth in Finland 1993- 2006: high-tech versus medium/low-tech potx
... product innovations are especially relevant for high-tech sectors We investigate regional growth in Finland between 1993 and 2006, a period during which the economy of Finland changed into a high-tech ... challenges for future research on this topic Related variety and regional growth Agglomeration economies refer to external economies of scale that arise from firms being concentrated close to one another ... terms of population, universities, trade associations, research laboratories and so on, facilitates the creation and absorption of new knowledge, which in turn may lead to innovative performance...
- 35
- 425
- 0
The imPact of high and groWing government debt on economic groWth an emPirical inveStigation for the euro area docx
... the accumulation of government debt was in general slow and occurred mainly in relation to wars According to the Encyclopaedia Britannica, the national debt of England was initiated to finance the ... have an impact on the economic growth rate To this end, we investigate the impact of debt on: (i) private saving and private investment (gross fixed capital formation) rate; (ii) public investment ... indicators, as proxied by the share of domestic private credit in GDP and the long-term interest rate; (v) indicators of openness of the economy to capture the possibility of foreign saving inflows...
- 42
- 715
- 0
the impact of human capital on economic growth. a case study in post-soviet ukraine, 1989 - 2009
... Economic Growth Education Corruption, Reform, and Growth 2.5.1 Basis for Corruption 2.5.2 Education Corruption 2.5.3 Education Corruption in Ukraine 2.5.4 Impact of Education Corruption on Growth ... relationships of institutions, human capital, and economic growth Institutions define patterns of behavior in organizations, often dictate them, and regulate their functioning and structure Institutions ... results of GDP growth to investment, savings, and education for the Russian Federation and Ukraine, 1990 –2010 4.8 Regression results of GDP growth to investment, savings, and education for the Russian...
- 228
- 843
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25