translation rotation drive by use of magnetic particles with specific gravity smaller than a liquid
SUPERCONDUCTORS – MATERIALS, PROPERTIES AND APPLICATIONS pps
... Szymczak, Alexander I Voitenko , Masaru Kato, Takekazu Ishida, Tomio Koyama, Masahiko Machida, Florian Loder, Arno P Kampf, Thilo Kopp, C .A. C Passos, M S Bolzan, M.T.D Orlando, H Belich Jr, J.L Passamai ... Structures of d-Wave and s-Wave Superconductors (d-Dot): Analysis Using Two-Component Ginzburg-Landau Equations Masaru Kato, Takekazu Ishida, Tomio Koyama and Masahiko Machida 319 Chapter 14 Flux-Periodicity ... Kobayashi, H., Balicas, L and Brooks, J S., Superconductivity in an Organic Conductor Stabilized by a High Magnetic Field, Advanced Materials 14, 243 (2002) [9] Kobayashi, H., Kobayashi, A. , Cassoux,...
- 452
- 321
- 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... condensation of a molecule of b-alanine with a molecule of pantoate in an ATP-dependent manner to form pantothenate [1,2] Pantothenate itself is an important cofactor that is essential for CoA biosynthesis, ... and Glu for M tuberculosis and A thaliana PS) As compared with the substratefree form, the imidazole rings of His34 in the A- chain ˚ ˚ and B-chain of nPS move by A and 5.5 A, whereas the backbone ... Gopalakrishnan B, Aparna V, Jeevan J, Ravi M & Desiraju GR (2005) A virtual screening approach for thymidine monophosphate kinase inhibitors as antitubercular agents based on docking and pharmacophore...
- 16
- 791
- 0
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
... interpretation of nuclear magnetic resonance spectra of proteins Q Rev Biophys 23, 1–38 Yamazaki T, Yoshida M, Kanaya S, Nakamura H & Nagayama K (1991) Assignments of backbone 1H, 13C, and 15N resonances ... exclude glutamine, glutamate, asparagine and aspartate from the labelling scheme because of excessive cross-labelling [17] In order to avoid the use of expensive [15N]amino acids, this particular in ... that adequate protein yields can be obtained from, at most, a couple of milligrams of each amino acid [18] A more sophisticated combinatorial labelling scheme has been proposed by Parker et al...
- 6
- 461
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... Oliveira FW, Chavante SF, Santos EA, Dietrich CP & Nader HB (1994) Appearance and fate of a beta- 13 14 15 16 17 18 19 20 21 22 23 galactanase, alpha, beta-galactosidases, heparan sulfate and chondroitin ... source and age, but within a single chain there is variability The chain cap of CS is a GalNAc or GlcA residue; a 4,6-disulfated GalNAc residue, rare in the repeat region of human articular cartilage ... repeat region of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and...
- 11
- 481
- 0
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... and an eluent containing mM ammonium acetate in 25% methanol Riboavin, FMN and FAD had retention volumes of 44 mL, 10 mL and mL, respectively 5Â-TCAGAATTCCATGGATATTTGGTA CGG-3Â 5Â-GGCCAACGCAAAGGGATCCTCGAT ... from the National Institute of General Medical Sciences (to C H W.) and by the Health Services and Research Administration of the Department Administration of the Department of Veteran Aairs (to ... p.p.m.) than that of TARFH2 This fact can be ascribed to an increased p-electron density at the N(10) atom in comparison to that of free avin, and, consequently, an increased sp3 hybridization of...
- 16
- 378
- 0
Báo cáo khoa học: High-resolution NMR studies of the zinc-binding site of the Alzheimer’s amyloid b-peptide pdf
... Tanemura K, Murayama O, Akagi T, Murayama M, Sato S, Sun X, Tanaka N & Takashima A (2001) New insights on how metals disrupt amyloid beta-aggregation and their effects on amyloid-beta cytotoxicity ... aggregated and ⁄ or precipitated Assuming that zinc and To monitor the structural changes of Ab induced by metal ion interactions, CD spectra were recorded for Ab with increasing amounts of added ... exhibit a total loss of H6 and H14 resonances, and a weak H13 resonance remains at the same chemical shift The tyrosine aromatic crosspeaks are unaffected upon zinc addition B A H13 H6 FEBS Journal...
- 14
- 355
- 0
Báo cáo khoa học: P NMR studies of energy metabolism in xanthosine5¢-monophosphate overproducing Corynebacterium ammoniagenes pot
... in the phase I Intracellular ATP and ADP concentrations in phase I were estimated based on 31P NMR data The data shown are the mean ± SD Fig Changes in cellular ATP, ADP and ATP/ADP of the XMP ... intracellular metabolites, NADP was used as a concentration standard in the NMR Partially relaxed 8,9 MDP was used to estimate metabolite concentrations ND, not determined Values are the mean ± SD Average ... phase (A) Cellular ATP (s) and ADP (d) concentrations are shown (B) Cellular NADP (j) is shown To quantify the intracellular metabolites, MDP was used as a concentration standard in the NMR All...
- 5
- 304
- 0
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx
... production of a Histagged SaDHNA The primers for the PCR were 5¢-GG AATTCCATATGCAAGACACAATCTTTCTTAAAG-3¢ (forward primer with a Nde I site) and 5¢-CGGGATCCT CATTTATTCTCCCTCACTATTTC-3¢ (reverse primer with ... The Authors Journal compilation ª 2007 FEBS 2249 Mechanism and kinetics of dihydroneopterin aldolase Y Wang et al 5¢-GGAATTCCATATGGATATTGTATTTATAGAGCA AC-3¢ (forward primer with a Nde I site) and ... Y Wang et al Fig Global analysis of the quench-flow data of the SaDHNA-catalyzed reaction Data 1, 2, 3, 7, 8, and 11 were obtained with DHNP as the substrate Because the commercial DHNP contained...
- 13
- 479
- 0
Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt
... demonstrate the structural importance of the nature of the amino acid at position 81 of the encephalitogenic sequence 74–85 of guinea MBP: replacement of Asp81 with an alanine seems to break a chain ... between charged groups in water In the agonist, ˚ the side chain of Arg78 is almost always less than A from a negatively charged group, mainly Asp81 and Glu82, but also the COO– terminal of Val85 ... (Ala81–Val85) appears to be much more flexible, with Ala81 far distant from the side chain of Arg78 The side chain of Arg78 is less well defined, as in the case of aqueous solution, because of the absence of...
- 15
- 447
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... chemical exchange for Asp18 or Trp33sc with increasing amounts of some sugars Peak movements of main chain amide and amide proton of Asp18, and side chain amide and amide proton (marked by ‘sc’) of ... spaced 50 ms Gaussian-shaped pulses for saturation with ms intervals and a total saturation time of s On-resonance irradiation of the protein was conducted at a chemical shift of –0.4 p.p.m and ... binding of each of sugar; lactose, melibiose, galactose (all from Wako Chemicals, Tokyo, Japan), a- Me-Gal and b-Me-Gal (both from Seikagaku Co., Tokyo, Japan), to EW29Ch at 25 °C (pH 6.1) was measured...
- 11
- 458
- 0
Structural and equilibrium unfolding studies of sam domain of DLC1 by NMR spectroscopy
... Thanks to Associate Professor Low Boon Chuan and Zhong Dandan for their help as collaborators Thanks to Assistant Professor Liang Zhao-Xun, Dr Nikolay Korolev and Abdollah Allahverdi in Nanyang ... equivalently, the decay of transverse single-quantum coherences (Cavanagh 2007) Analysis of the relaxation of a system provides a great deal of information about the geometry and dynamics of the ... both mammalian cells and yeast (Zhang et al 2000) An intact PNT domain (moniker of SAM domain) of Ets2 specifically recognized a Cdc2-related kinase, Cdk10 (Kasten and Giordano 2001) In addition,...
- 185
- 211
- 0
Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"
... patients in the comparator group with P aeruginosa at baseline than for those without P aeruginosa For example, median duration of mechanical ventilation was 10 days for all patients with VAP ... (discharge date or death date) - randomization date + If discharge date was not available, patients were censored at late follow up In addition, all-cause overall mortality and, in patients with P aeruginosa ... proportional hazards assumption was validated for each model Statistical Analysis Software version 9.1.3 (SAS Institute, Inc., Cary, NC, USA) was used for statistical analyses P values less than 0.05...
- 10
- 557
- 1
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... hippocampal and parietal cortical regions [47]; a separate analysis of auditory-evoked potentials via brain electric source analysis and multiple-dipole modelling indicates putative generators ... is also notable that the detection of a frontal N2 is associated only with instances of a NOGO response Thus, the P300 appears to be inhibited by the appearance of the N2b in tasks of motor activity ... similar oddball paradigm using short inter-stimulus intervals, however, MMN latency and amplitude varied little as a result of increasing age, suggesting the invariance of automatic stimulus analysis...
- 8
- 563
- 0
Tài liệu SURVEY OF CASE STUDIES OF THE USE OF KNOWLEDGE MANAGEMENT IN SOFTWARE ENGINEERING docx
... indicates that estimation accuracy has improved, and focus on risk management has increased Ericsson Software Technology The company claims that the initiative was "more valuable" than a database ... done by collecting information that was already documented in the company, and to make it available and searchable, a kind of a bottom up way to start a knowledge management program The article ... for use of a tool and experience with it Management Packages reference information for project managers Data Packages data relevant for a software project or its activities Can be project databases...
- 24
- 705
- 0
Tài liệu STUDIES OF AMERICAN FUNGI, MUSHROOMS, EDIBLE, POISONOUS, ETC ppt
... Chemistry and Toxicology of Mushrooms, and Characters of Mushrooms, to which their names are appended, and also to Dr Chas Peck, of Albany, N Y., and Dr G Bresadola, of Austria-Hungary, to whom some of ... on our part, as well as some experience in judging of the value of such characters; the same habit of observation and discrimination we apply to everyday affairs and to all departments of knowledge ... enlarge and elongate and make their way toward the surface of the ground They are at first very minute and grow from the size of a pinhead to that of a pea, and larger Now they begin to elongate...
- 503
- 358
- 1
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a possible tumor-suppressor gene, is frequently silenced in oral squamous-cell carcinomas by aberrant promoter ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phosphoribosyltransferases is examined using saturation mutagenesis, functional analysis, and X-ray ... regulatory ligands for PRTFDC1 The catalytic efficiency and substrate specificity of PRTFDC1 was further characterized using a radiochemical assay with tritium-labeled bases as substrates, whereas...
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc
... Authors Journal compilation ª 2009 FEBS 509 Pyruvate synthesis by pyruvate oxidoreductase T Ikeda et al 34 Ozawa Y, Nakamura T, Kamata N, Yasujima D, Urushiyama A, Yamakura F, Ohmori D & Imai T (2005) ... enzyme activity of the recombinant LDH was assayed at 70 °C by monitoring the lactate-dependent NADH oxidation as the decrease in A3 40 The standard assay mixture contained mm lactate, 0.2 mm NADH and ... was incubated at 70 °C under an argon atmosphere The reaction was started by adding the NADH, acetyl-CoA and enzyme solutions to the mixture, and the decrease in A3 40 as a result of NADH oxidation...
- 10
- 619
- 1
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... homes.129) Nano -particles and Nano-materials The health effects of nano -particles and nano-materials have been reviewed.117–121) Nanomaterials are divided into two types: environmental nano -particles ... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, A and Kishi, R (2009) Relationship ... Indoor Air Quality Indoor Environ., 1, 27–34 (in Japanese) 126) Kishi, R., Saijo, Y., Kanazawa, A. , Tanaka, M., Yoshimura, T., Chikara, H., Takigawa, T., Morimoto, K., Nakayama, K and Shibata, E (2009)...
- 14
- 940
- 1
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... 5¢-TGGGCCATGCCCTTTAACAGTTATGTCACG CTG-3¢ Q81N-rev: 5¢-CAGCGTGACATAACTGTTAAA GGGCATGGCCCA-3¢ R105H-fwd: 5¢-GCTAAAAATAA R105HTGGAGCACTCCATTTTTAGCGCTCGC-3¢ rev: 5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTAT TTTTAGC-3¢ ... TTTTAGC-3¢ R105K-fwd: 5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢ R105K-rev: 5¢-GCG AGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢ Sequence verification Plasmids of the seven mutants were transformed into XL1Blue ... 5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGG CGC-3¢ E52Q-rev: 5¢-GCGCCACTTCTCGACGGGCTG GGTCAGCAGGC-3¢ Y70W-fwd: 5¢-CTGCTGGAGCT GATGTGGAAAGATCCCAAGAAG-3¢ Y70W-rev: 5¢-CTT CTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢ Q81Nfwd:...
- 10
- 504
- 0
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx
... Finland) and Vent and Taq Endonuclease I from V salmonicida and V cholerae Table List of PCR primers Restriction sites are underlined No Sequence GCTTTTAAAGTTGACTTCAAAG CTTTGAAGTCAACTTTAAAAGC CTACCATGGCACCTCCTTCTTCTTTCTCAA ... CTTTGAAGTCAACTTTAAAAGC CTACCATGGCACCTCCTTCTTCTTTCTCAA GCTGTCGACTTATTTAGTGCATGCTTTATAAACAA CTACCATGGCCCCCATCTCTTTTAGTCAT GCTGTCGACTCAGTTCGGGCATTGCTCAC polymerase from Promega were used in the PCRs Restriction ... water Knowledge on cold adaptation is in many cases based on marine secreted enzymes Detailed data on salt adaptation of marine cold-adapted secreted enzymes is lacking and may be a source of...
- 12
- 565
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25