tolerated although the band is filled and has been readjusted intermittent black stool gastroscopy reveals intraluminal position of a part of the band
báo cáo khoa học: "Sentinel lymph node biopsy using dye alone method is reliable and accurate even after neo-adjuvant chemotherapy in locally advanced breast cancer - a prospective study" pps
... Results All 30 cases were of locally advanced carcinoma (i.e stage IIb and stage III) The age of the patients ranged from 32-85 years with a mean age of 47.3 years and a standard deviation of 10.98 ... value, negative predictive value, false negative rate and accuracy on the basis of distribution of 30 cases into four categories of SLN and axilla expression patterns Data analysis was performed ... cases in the present study, out of a total of 15 cases that had a positive axilla after ALND Of the two “false negative cases”, one was a “non responder” that was N2 (both pre and post NACT) and...
- 7
- 303
- 0
My life story book This book has been given to you to help you collect lots of different information about
... certificate, drawings, school report cards, awards and certificates, postcards or pictures of the place you were born, a drawing of your family tree, and information about the holidays and special ... the page you want is not on this list, the book has lots of blank pages in it that you can use to write extra things on, draw on or paste pictures on You can also ask for more of these blank pages ... called, ‘Health Record’, ‘Visits with My Family’, ‘Awards and Certificates’, ‘Places I Have Lived’, ‘What Makes Me Happy’, ‘What Makes Me Sad’, ‘Things I Like to Do’, and ‘In the Future’ If the...
- 48
- 528
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members ... strands and 8), the final helix of the AAA domain (a helix 10) and the C-terminal helix (a helix 11) This C-terminal region of Vps4 has been defined in the PFAM database as the ‘Vps4 oligomerization...
- 23
- 490
- 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... digesting the fragment with HindIII and Bgl II and the plasmid with HindIII and Bam HI The fragment was ligated into the plasmid and the integrity of the insertion was validated by digesting the plasmid ... domain (Fig 7B) DISCUSSION There is mounting evidence that inflammatory cell infiltrates play a significant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue ... tissue and releasing pro-inflammatory agents Activated eosinophils, neutrophils, macrophages and lymphocytes increase in number at sites of inflammation and each are capable of modifying the overall...
- 14
- 540
- 0
Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot
... time-consuming and computation intensive to calculate the age-standardised mortality (ASM) rates at a Statistical Local Area (SLA) level, we used the aggregated data to examine the feasibility of linking ... had 163 SLAs in 2001), and in rural and remote areas that make up the majority of Queensland territory, each LGA is also an SLA The LGA information, including name, code and area (km ), was Page ... at the LGA level in Queensland It indicates that central Queensland, far north (part of Peninsula of Cape York), north-western areas (coastal areas of Gulf of Carpentaria), part of western, part...
- 10
- 356
- 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a time-dependent manner, we looked at the pattern of TSA-induced histone acetylation ... Structural alterations in nucleosomal organization caused by TSA treatment Changes in the acetylation status of histones by TSA treatment may cause changes in the organization of chromatin Such altered ... on treatment of oocytes with TA or TSA Positions of tri-, di-, and the mononucleosomal bands are indicated, as is the hormone-induced subnucleosomal fragment (Fig 5A and B, compare lane and 8,...
- 10
- 500
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... mutagenesis reactions together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A ... inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG used for the experiment ... effects of a combination of key residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses...
- 12
- 740
- 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... both the transmembrane arginine and at least part of the cytoplasmic tail for its association with the FcR c-chain, although it is not clear how the cytoplasmic tail supports the association The ... convulxin, and the bottom part was blotted for FcR c-chain detection The positions of GPVI (55 kDa) and other bands of lower molecular mass, probably products of degradation, are indicated by arrows A ... stimulated or not with PMA for 24 h GPVI was a nity-precipitated using convulxin and detected by ligand blotting as a band of 55 kDa Additional bands of lower molecular mass are indicated The associated...
- 10
- 506
- 0
Blindsided Why the Left Tackle Is Overrated and Other Contrarian Football Thoughts doc
... receiver near the end of his career (Paul Warfield), and a dominant running back (Larry Csonka) is a partial indicator that Miami wasn’t quite as strong as the other dynasty candidates of that era Add ... in the league was in Vainisi’s league, either Having the combination of both the best coach and the best talent evaluator of their era gave the Packers one of the biggest edges of any team in any ... business and allowed me to expand the scope of my research to the kinds of areas that James reached later in his career The eclectic nature of James’s work is actually one of the great, and seemingly...
- 275
- 637
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and ... indicates clearly that the two compounds are incorporated into tubulin at the same site Another biochemical characteristic of tubulin is its ability to act as substrate of the detyrosinating ... antisera were usually collected 15 days after each injection and tested for affinity and specificity and stored at )20 °C Mouse monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total a- tubulin...
- 9
- 518
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... spectrum of material from peaks 3*, and after partial CPY hydrolysis (C) MALDI mass spectra of peak 2* material before (upper part) and after (lower part) CPY treatment (642 Da, sodium salt of deoxyhexose-containing ... in their amino-acid sequences: the former has proline and isoleucine at positions and 10, respectively, and the latter has alanine and threonine (Fig 1).] The elution of the ST mutant peptide at ... at the beginning of the chromatogram (peaks 1*, 2*, 3*, and in Fig 5A) For peaks and 2, molecular masses of 2025 and 2041 Da were obtained as before (Table 1) The molecular mass of peak 3* was...
- 10
- 398
- 0
Cotton is King and The Pro-Slavery Arguments docx
... subsistence, and for guardianship and protection, and to accumulate a fund for sickness, disability, and old age The master, as the head of the system, has a right to the obedience and labor of the slave, ... He has also a right in his master as the sole arbiter in all his wrongs and difficulties, and as a merciful judge and dispenser of law to award the penalty of his misdeeds Such is American slavery, ... interesting The work of Professor Christy, on the Economical Relations of Slavery, contains a large amount of the most accurate, valuable and well arranged statistical matter, and his combinations and...
- 506
- 312
- 0
What is culture and what are the influences ofculture? pot
... The culture concept has the advantage of enabling us to look at the whole society, making clear the fact that one cannot understand group behavior except as part of the culture pattern ... barbarism by its contact with Greek culture Northern Europe raised its civilization upon the contact with Roman culture After the dark Middle Ages, contacts with Islam and the rediscovery of the ... treat everyone with equal casualness and to pretend that no rank exists It even seems insincere, and therefore irritating The crossing of different cultures can lead to misunderstandings and may...
- 7
- 506
- 1
Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx
... an association between the PTPN22 1858T variant and a disease related autoantibody, and that they co-operate to increase the relative risk of developing an autoimmune disease, in this case RA ... was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and VIC™ (the T allele) and the 3' ends contained quenchers and minor groove binders The probe for the A allele ... carried out the genotyping, the statistics and contributed to preparation of the manuscript LÄ participated in the collection of the material and registration of the pre-patient data GH is responsible...
- 6
- 322
- 0
Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt
... (5’-GCAGGGCCCCTAGGAAAAAGGGC-3’) and CRhINClaIR1 (5’-CCTTATCGATTCCATCTAGAAATAGC-3’) Similarly, HpaI (flanking RT amino acids 288/289) and SpeI (flanking RT amino acids 423/424) sites were introduced and any HpaI ... We also thank Soo-Yoon Rhee, Stanford University HIV database for help with database sequence analysis and Ross Harris, Health Protection Agency for help with statistical analysis This report is ... susceptibility and replicative capacity testing The positions of the restriction sites used for cloning of patient-derived PR-RT fragments (ApaI and ClaI) and for RT domain swapping (HpaI and SpeI) are...
- 11
- 350
- 0
the first chapter will start with the introduction to the problem that mai dong mechanical company has been facing and also the research design and methodology of the research
... 7% are technical managerial and supervisor staffs and 3% are top managerial staffs The general director has a master degree of mechanical engineering Most of top management managers have got bachelor ... been proactively building and supervising the implementation of the vision, missions, strategies and action plans of MDC They again visualized the 11 vision and missions in any where applicable ... Pipe Manufacturing Factory Position Manager Manager Manager Giai Phong Mechanical Factory Manager Planning & Sales Dept HR Dept Financial Accounting Dept Board of Project Management Manager Manager...
- 51
- 382
- 0
the virtual jirga the 2009 education policy and the medium of instruction debate in pakistan who is participating and what are the implications for balochistan
... as well as the strategy of data analysis Chapter and Chapter analyse the data in two parts The purpose of these two chapters is to find themes in the views of the participants of the debate and ... 2011) They are mostly published in major cities of Pakistan i.e Islamabad, Karachi, Lahore, Peshawar and Quetta English media is more liberal and democratic compared to its Urdu counterparts and is ... privatisation of education has expanded to the rural areas Additionally, the Ministry of Education and the Provincial Education Department encouraged Non-Governmental Organisations (NGOs) to take over abandoned...
- 286
- 1,741
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... kh a điện 14 Đèn báo ch a kh a không nằm ổ 15 Đèn cảnh báo kh a bấm điều khiển từ xa hết pin 16 Đèn cảnh báo khoảng cách 17 Đèn báo nhấn chân côn 18 Đèn báo nhấn chân phanh 19 Đèn báo kh a vô-lăng ... Đèn sương mù (sau) Đèn cảnh báo nước r a kính mức thấp Đèn cảnh báo má phanh Đèn báo bật hệ thống điều khiển hành trình Đèn báo rẽ Đèn báo cảm ứng m a ánh sáng Đèn báo chế độ lái m a đông 10 Đèn ... Đèn báo làm tan băng kính chắn gió 59 Đèn báo cốp xe mở 60 Đèn báo tắt hệ thống cân điện tử 61 Đèn báo cảm ứng m a 62 Đèn cảnh báo động cơ/khí thải 63 Đèn báo làm tan băng c a sổ sau 64 Đèn báo...
- 3
- 508
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... least far/farther(further) /the farthest (the furthest) Double comparison(So sánh kép) + Same adj: Short adj:S + V + adj + er + and + adj + er Long adj:S + V + more and more + adj Vd: The weather ... make a decision, make love… To have dinner, have a party, have a holiday… To some work, a job, homework,… III Cách sử dụng in on at thời gian At: mốc thời gian cụ thể Vd: At 6:00am, at noon, at ... Vd +She is as stupid as I/me +This boy is as tall as that one (Không lặp lại từ dùng chủ ngữ) Population ofHo Chi Minh city isn't as much as thatof Bangkok Comparative(So sánh hơn) Short Adj:S...
- 7
- 425
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose