tir8 sigirr a member of the il 1 receptor family with unique structure and regulation
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx
... Analysis of the deletion of ADH6 and ADH7 genes Agarose gel of genomic DNA of the yeast strains BJ 216 8: ADH6 ADH7, lanes and 2; BJ18: adh6D ADH7, lanes and 4; BJ05: ADH6 adh7D, lanes and 6; and ... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal 2-Methylpropanal 2-Methylbutanal 3-Methylbutanal Trans-2-nonenal Furfural Acetone 10 0 90 45 15 79 83 84 24 19 15 3...
- 8
- 378
- 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... coeluted with the recombinant allergen after affinity purification using the mAb IG12 [18 ] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage ... Areas of high similarity exist around Cys69 and Cys72 and around Trp186, Trp193 and Trp197 The positions of Cys 41, 57, 69 and 72 are especially conserved between b-expansins and cathepsin B The ... and 13 9 when compared with the proteinases of G lamblia and G gallus All Cys and Trp residues are absolutely conserved in a- expansins and b-expansins as well as in the C1 cysteine proteinases Other...
- 10
- 535
- 0
Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc
... to the child that they cannot keep The first aider should ensure that that they or another adult are available to take care of the child The first aider should tell the child that they or another ... with the traumatised person The first aider should speak clearly and avoid clinical and technical language The first aider should communicate with the person as an equal, rather than as a superior ... communicating with a traumatised child; children at large-scale traumatic events; advice for parents and guardians in the weeks following the event; dealing with avoidance behaviour and temper tantrums;...
- 15
- 342
- 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf
... SOS-X A5 01 A5 01C A5 01C T605 T605C T605C Q5 91 Q5 91 Q5 91 A5 01C 11 /11 A5 01C A5 01C A5 01C C605Y C605Y C605Y C605Y Q591L Q591L L591Q Q593L Q593L 2 /11 1/ 11 Q5 91 1 /1 L593 L593 1/ 11 L593Q L593Q L593Q 6 /11 ... 10 4 10 3 10 2 days post infection 10 D 10 6 A5 01C T605C gp 41 T605C 10 5 10 4 10 3 A5 01C T605C gp120 10 2 T605C SH T605C A5 01C A5 01C A5 01C SH gp120 10 3 wt gp 41 B A5 01C wild-type wt gp 41 gp120 Relative ... SupT1 SupT1 SupT1 SupT1 SupT1 SupT1 SupT1 SupT1 SupT1 SupT1 MT-2 MT-2 MT-2 MT-2 MT-2 MT-2 10 10 10 10 10 10 10 40 40 40 10 10 10 40 40 40 0 .1 0.3 0 .1 0.3 0 .1 0.3 0 .1 0.3 + a after weeks (12 weeks...
- 11
- 393
- 0
the subsidy regulations and vietnam’s position as a member of the wto
... Thailand and the EC55 and between Brazil, Australia, Canada, China, India, Thailand and Japan and the US in the cotton case.56 WT/DS267 WT/DS265,266,283 50 Fel! Använd fliken Start om du vill ... in Agriculture, 2003, P160 -16 5 22 The Canada – Dairy, report of the Panel, supra n 19 , para 4. 310 and Canada – Aircraff, report of the Panel, supra n 36, para 5.27 18 Fel! Använd fliken Start ... classed as financial contributions even though they are not within the strict meaning of the term. 21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was...
- 59
- 314
- 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx
... Comparative FACS analysis of the internalization of the full-length Tat protein construct and the Tat CPP Differences in the mechanisms of internalization between the Tat peptide and the Tat fused ... was proposed as the reason of this apparent increased uptake, as the rate of uptake was the same in serum-free medium [17 ] As already stated above, this Tat CPP peptide is able to vectorize various ... receptor and inhibition of steroidogenesis by an Ó FEBS 2002 15 16 17 18 19 20 21 22 HIV TAT-CRAC peptide Proc Natl Acad Sci USA 98, 12 67± 12 72 Hughes, J., Astriab, A. , Yoo, H., Alahari, S., Liang,...
- 8
- 485
- 0
Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx
... American Association of Colleges of Nursing (2 011 ) 2 010 -2 011 Enrollment and graduations in baccalaureate and graduate programs in nursing Washington, DC: Author Australian Institute of Health and ... Nurses and midwives represent around 50% of Australia’s health workforce, though the availability of clinicians varies greatly in urban and remote areas New Zealand has a total nursing workforce of ... improvement of global health and quality of care See http://www.ganes.info GANES Members American Association of Colleges of Nursing Canadian Association of Schools of Nursing Council of Deans and Heads...
- 6
- 562
- 0
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot
... TYR 31 8A TRP22 9A Trp229 LEU23 4A LEU10 0A Tyr1 81 LEU10 0A Cys1 81 I VAL10 8A Asp 110 PHE22 7A Asp186 Asp185 O O K126 O O O TYR18 8A Tyr1 81 O LEU23 4A VAL10 6A LEU10 0A Trp229 TYR 31 8A Asn103 Fig K-49 and KNA-53 ... LEU23 4A ASN10 3A TYR18 8A Tyr1 81 D H O O O K126 Asp 110 VAL10 8A O O O TYR18 8A VAL10 8A O Asp 110 O O O VAL10 6A Asp186 TYR18 8A Trp229 Asp186 PHE22 7A NNRTIbp Asp185 K126 O LEU22 8A O NNRTIbp Asp185 Tyr188 ... 14 4 414 57 ê 2 011 The Authors Journal compilation ê 2 011 FEBS F Esposito et al Alizarines as new dual HIV -1 RT inhibitors A E VAL10 6A PHE22 7A VAL10 8A Asp 110 O K49 Asp 110 O LEU23 4A Asp186 K49 VAL108A...
- 14
- 425
- 0
Báo cáo khoa học: The study of G-protein coupled receptor oligomerization with computational modeling and bioinformatics doc
... Fingleton B (19 85) Spatial Data Analysis by Example Wiley, Chichester 58 Fraczkiewicz R & Braun W (19 98) Exact and efficient analytical calculation of the accessible surface areas and their gradients ... interactions and the molecular details of signaling Structural details from computational modeling and bioinformatics As anticipated above, structural details from computational modeling and bioinformatics ... Illinois press, Champaign, IL 81 Pazos F, Sanchez-Pulido L, Garcia-Ranea JA, Andrade MA, Atrian S & Valencia A (19 97) Comparative analysis of different methods for the detection of specific regions...
- 13
- 515
- 0
Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc
... Elite ABC kits (Vector, Burlingame, CA, USA) and diaminobenzidine (Kirkegaard and Perry, Gaitherburg, MD, USA) as a chromogen [11 ,12 ] The polyclonal antibodies, goat antihuman Ang -1 and Ang-2, and ... http://arthritis-research.com/content/4/3/2 01 Supplementary Table The sequence for the designed Tie receptors and ligands Names Forward primers TaqMan probes Reverse primers Ang -1 GCC ATT ACC AGT CAG AGG CAG T CAT GCT AAG AAT TGA GTT AAT ... cells and fibroblasts within the pannus, which are the putative target of this cytokine [18 ,19 ] The localization of Ang -1 is similar to that of VEGF, which further supports the crucial role of the...
- 9
- 424
- 0
Báo cáo khoa học: The carbohydrate-binding module family 20 – diversity, structure, and function doc
... Brevibacterium helvolum AAL 812 32 BAD84 711 AAC49622 AAN750 21 CAA86997 AAN85206 AAQ18643 AAK76874 AAH47502 CAA86906 AAH62008 AF276085 AAN28 817 ABF95644 AAM93999 AAA23872 AAP72268 AAA34632 AAA58642 AAB95369 ... 3.2 .1. 60 3.2 .1. 2.4 .1. 19 2.4 .1. 19 2.4 .1. 19 BAA22993 AAA63900 BAA12 010 CAA40798 AAA22233 BAE9 418 0 AAA25707 BAA 016 00 CAA55023 AAA25059 AAB00845 640 613 6 31 566 719 615 548 614 713 655 710 20 20 20 ... thaliana Arabidopsis thaliana BAA 110 10 AAA2 512 4 AAD0 418 9 AAA25854 AAK42273 BAA290 41 NP _17 2637 NP _17 2637 NP _17 2637 558 11 02 904 7 71 718 733 10 25 10 25 10 25 the regulatory proteins AMPK [43], AKIN...
- 24
- 526
- 0
Rapid detection of epidermal growth factor receptor mutations with multiplex PCR and primer extension in lung cancer pdf
... G >A G 719 C, G 719 S 5'-TGAATTCAAAAAGATCAAAGTGCTG-3' 25 mer 215 6 G>C G 71 9A 5'-AAACTGAATTCAAAAAGATCAAAGTGCTGG-3' 30 mer 2235-2249 del E746 -A7 50 del 5'-GAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAA-3' 35 mer ... E746 -A7 50 del 5'-TCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG-3' 41 mer 2237-2254 del E746-T7 51 del 5'-(T)20AGTTAAAATTCCCGTCGCTATCAAGG-3' 46 mer 2240-2257 del L747-S752 del 5'-(T)23AGTTAAAATTCCCGTCGCTATCAAGGAAT-3 ... 5'-CTGGCACTGCTTTCCAGCAT-3' E18-3' 5'-GCTTGCAAGGACTCTGGGCT-3' E19-5' 5'-GCATCGCTGGTAACATCCAC-3' E19-3' 5'-AGATGAGCAGGGTCTAGAGC-3' E20-5' 5'-ATCGCATTCATGCGTCTTCA-3' E20-3' 5'-AGACCGCATGTGAGGATCCT-3'...
- 6
- 234
- 0
Báo cáo y học: "Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" potx
... (LG 011 8: 5'-ATGGCAACCCTGTCCCTGAG-3' and LG 011 7 5'-GGAAACCCAACCACGCTGTA-3') and Page of (page number not for citation purposes) Virology Journal 2009, 6:86 (LG 011 9: 5'-GCTAACTCTAATGCTGCCACC-3' and ... rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative [6] Additionally, RTPCR assays for caliciviruses and astroviruses were also negative [6,33] 10 0% Page of (page number ... pellet particulate matter and the supernatant was then passed through a 0.45 μm filter Total nucleic acid was isolated from 10 0 μL primary stool filtrate using QiAmp DNA extraction kit (Qiagen) according...
- 7
- 328
- 0
Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx
... (LG 011 8: 5'-ATGGCAACCCTGTCCCTGAG-3' and LG 011 7 5'-GGAAACCCAACCACGCTGTA-3') and Page of (page number not for citation purposes) Virology Journal 2009, 6:86 (LG 011 9: 5'-GCTAACTCTAATGCTGCCACC-3' and ... rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative [6] Additionally, RTPCR assays for caliciviruses and astroviruses were also negative [6,33] 10 0% Page of (page number ... pellet particulate matter and the supernatant was then passed through a 0.45 μm filter Total nucleic acid was isolated from 10 0 μL primary stool filtrate using QiAmp DNA extraction kit (Qiagen) according...
- 7
- 583
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 12 0-amino acid SEA domain followed by the C-terminal ... and Cys1 91 Gln192 sandwich the phenyl ring of benzamidine The DESC1 S1 pocket resembles the thrombin S1 pocket type because of the presence of an Ala rather than a Ser at position 19 0 The S1 specificity ... on a rotating anode generator (Rigaku, Tokyo, Japan) equipped with an image plate detector (Mar Research, Hamburg, Germany) These data were integrated with the mosflm package [23] and scaled with...
- 13
- 588
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 8 51 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 17 2 ... absent in the SAF -1 and SAF-2 isoforms Ray A & Ray BK (19 98) Isolation and functional characterization of cDNA of serum amyloid A- activating factor that binds to the serum amyloid A promoter ... exon 13 ), and the amplification product was 378 bp The primers for GAPDH were 5¢-TGCACCACCAACTG CTTAG-3¢ (forward) and 5¢-AGAGGCAGGGATGATGT TC-3¢ (reverse), and the amplification product was 17 7...
- 11
- 439
- 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot
... respectively, the S13 4A- S ⁄ S13 4A- AS, S13 3A- S ⁄ S13 3A- AS, S13 3A- S134AS ⁄ S13 3A- S13 4A- AS and S134D-S ⁄ S134D-AS pairs of primers (Table S2) Transformation of yeast cells with recombinant plasmids was performed ... bud32-D16 1A mutant is exacerbated by the additional deletion of SCH9 Wild-type BUD32-HA (WT) and mutant strains D16 1A- HA (D16 1A) , sch9D ⁄ BUD32-HA (sch9D) and sch9D ⁄ D16 1A- HA (sch9D ⁄ D16 1A) were ... exponential phase, and then incubated for 30 in galactose medium to activate the GAL regulon Total mRNAs were extracted and subjected to standard northern blot analysis GAL1 mRNA, and ACT1 mRNA (considered...
- 15
- 414
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... Allowing one substitution Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG ... EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1. 5 p=0. 01 60_HI 60M_HI Fig The ... AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG GAAGACATT ENSG00000003400 Caspase -10 10 1 675 814 8 01 355 315 963 808 418 262 6 51 725 857 caspase -10 gene, four variant motifs were identified Among them, AAACAGATG...
- 14
- 393
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... peptide a ion score Match to MASCOT L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 ... four-cysteine-containing cerato-platanin domain, and a blastp search always yielded the members of the cerato-platanin family as the best hits It is possible that they represent an ancestral cerato-platanin member ... nodorum and Sp1 of Leptosphaeria maculans) or human allergens and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It...
- 14
- 494
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... octanoate; C10, decanoate, C12, dodecanoate, C16, palmitate, BA, benzoate The data are means ± SD of triplicate assays transcripts for the SA and MACS1 genes are present only in the RE area of the ... (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢) for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc tgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagct gaccaaactccttg-3¢) for MACS1, and cloned ... and MACS1 Identity to the murine acetyl-CoA synthetase (AceCS) family was much less (20–30%) These observations indicate that the O-MACS protein is a novel member of the acyl-CoA synthetase family, ...
- 10
- 393
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008