this is called a granitic gneiss because its mineralogy matches that of the igneous intrusive rock granite its texture marks it as metamorphic
''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf
... in the details of the game than in the game play itself; the unfolding of the answers IS the narrative that has me hooked… a meta-narrative" [20] In another editorial "Meta Mystery," Maria Bonasia, ... nongame sites In this sense, it is reasonable to argue that nothing about this virtual play was simulated The computer-driven alternate reality the Beast created was make-believe, but every aspect ... level, this statement emphasizes the location-based aspects of pervasive entertainment The Nokia Game, like the Beast, is played "in reality," that is, in everyday, real environments with players'...
- 10
- 583
- 0
Báo cáo y học: " Minimal acupuncture is not a valid placebo control in randomised controlled trials of acupuncture: a physiologist''''s perspective" pps
... relevant in the context of placebo effects It has an 'exotic' conceptual framework with an emphasis on the 'individual as a whole' It is associated with frequent patient-practitioner contacts, and ... Furthermore, acupuncture analgesia is probably associated with its counter-regulation of spinal glial activation, PTX-sensitive Gi/o protein-mediated and MAP kinase-mediated signal pathways, and ... (in patients with pain) [49-53] Deactivation of limbic structures has been associated with an increased activity in hypothalamus and the resulting activation of pain and sympathetic inhibiting...
- 9
- 469
- 0
A novel interval method for validating state enclosures of the
... φ1 initial approx (case 1) φ2 initial approx (case 1) 1 0 −1 −1 initial approx (case 2) initial approx (case 2) −2 10 −2 (a) Enclosure of the first state variable 10 t t (b) Enclosure of the second ... either analytically or numerically To obtain an initial approximation for the analytical reference solution a set of linear ODEs xapp (t) = flin (xapp (t)) ˙ (9) with the same dimension as the ... simulation results on the quality of the initial approximation, and the perturbation approach for calculation of analytical reference solutions Second, VAL E NC IA-IVP is compared in detail with...
- 12
- 373
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; ... CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, ... indicated that an N-terminal aspartate is not necessary for neurotoxicity An additional advantage of the N-terminal methionine is the fact that this residue will not be easily seen in NMR spectra...
- 16
- 691
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... Accordingly, the OAAI is not a measure of the total activity of the obstetric anesthesia services Based on these limitations, it is important to appreciate that although the OAAI is numerically identical ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data ... denominator is a more reliable measure of activity than annual delivery numbers A limitation of the data upon which this secondary analysis is based is that data were selfreported and not corroborated;...
- 14
- 610
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... molecular mass of 202.3 kDa and an isoelectric point of 4.94 The 3¢-UTR region had 205 basepairs, and a polyadenylation degenerated signal was located 38 basepairs downstream from the stop codon After ... increase dramatically during the vitellogenic period, and then peaks one day after the blood meal [24] This particular pattern is surely related to the haematophagous regime and anautogenic features ... oviposition, when BgVgR also accumulates in the cortex of the subbasal oocyte When this subbasal oocyte occupied the basal position just after oviposition, the BgVgR had clearly accumulated in the...
- 11
- 414
- 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx
... was rather a marvel, inasmuch as she was willing to take in washing, and it well too, but Gladys had no higher rank for that She was herself rather a pathetic little soul, 39 By the Light of the ... By the Light of the Soul Chapter II Maria and her father entered the house, which was not far It was a quite new Queen Anne cottage of the better class, situated in a small lot of land, and with ... her that such an obvious fact scarcely needed words of assent “Damp as it is, too,” said her mother Mrs Edgham extended a lean, sallow hand and felt of the dainty fabric It is just as limp as a...
- 488
- 398
- 0
A MASTER''''S PROJECT SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS IN NURSING potx
... health care costs and prescription opiate abuse In addition, the paper examines the devastating consequences that opiate abuse has on the individual abuser and their family members, as well as ... States dollars The data source used was an administrative database of medical and pharmacy claims of 16 selfinsured employer health plans with approximately two million patients The data were used ... Unfortunately, the rising prescription abuse has lead to a national health care crisis, impacting many areas of our society both financially and emotionally This paper reviews the current relationship...
- 20
- 552
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... 10.1186/1749-799X-5-33 Cite this article as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic ... functional brace in the treatment of delayed union of the tibia [13-15] We speculate that this treatment was advantageous because the external fixator and functional bracing did not violate the fracture ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of...
- 4
- 402
- 0
Báo cáo lâm nghiệp: "A change in structural diversity and regeneration processes of the spruce virgin forest in Nefcerka NNR (TANAP) in relation to altitude" docx
... 1,300–1,400 Altitudinal category Stage breakdown over 1,400 the virgin forest that decides on the degree of its diversity, and namely the percentage of the overall area share of this stage as well as the ... spite of the fact that this value, in the growth stage of this spruce virgin forest, increases with the ascending altitude, its influence was not confirmed in testing (Table 1) An analysis of the ... They are acid or very acid, with great stocks of humus and with the lack of easily accessible nutrients The average annual temperature reaches about 2–2.5°C and the average annual precipitation is...
- 9
- 390
- 0
Báo cáo lâm nghiệp: " The management of snags: A comparison in managed and unmanaged ancient forests of the Southern French Alps" pot
... data; Marage, unpublished data) In unmanaged sites, the height of snags was higher in the last DBH class This situation was due to the broad range of stages of decomposition of this DBH class 3.3 ... when the degradation phase was not included in the analysis Density of SDT was not be affected by management status but was affected by developmental phase (Tab IVb) The degradation phase appeared ... increasing temporal and spatial gaps in the availability of CWD density within managed stands and an increasing distance between remnant old growth stands In our study sites, the spatial pattern of...
- 8
- 486
- 0
Báo cáo toán học: "A tight lower bound for convexly independent subsets of the Minkowski sums of planar point sets" potx
... small that the intervals [ai , + 2ε] are all disjoint: Namely, the gradient of the ith parabola at x = is smaller than the gradient of the (i + 1)st parabola at x = (or more specifically it is enough ... scaling the whole configuration, we may assume that the x-coordinates of all points of P are properly between and Then, the gradient of the ith parabola is at x = and + 2ε at x = Let ε be so small ... (2010), #N35 of convex parabolic segments: The ith segment is a part of an expanded copy of the ith parabola (containing the piece between x = and x = 1) From the discussion above, these parabolic...
- 4
- 339
- 0
Báo cáo khoa học: "Lack of Cetuximab induced skin toxicity in a previously irradiated field: case report and review of the literature" pdf
... transmembrane signaling In addition, because the severity of the skin rash has been associated with treatment efficacy [7], one should consider the possibility that the therapy may not be as ... rash in an area that had previously been irradiated for SCC and present a brief review of the literature Case Report A 78-year-old Caucasian male was diagnosed with a well differentiated squamous ... carcinoma (SCC) of the skin over the left ear This was initially excised and treated with adjuvant radiation treatment using 12 MeV electrons between January and March 2008 An initial dose of...
- 4
- 251
- 0
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... siRNA- mediated knockdown of MATR3 Pools of siRNAs were obtained from Dharmacon: MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), ... 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT Kula et al Retrovirology 2011, ... presence of Rev MATR3 has been characterized as a component of the nuclear matrix structure and has also been suggested to play a role in nuclear retention of hyperedited RNA with the assistance of the...
- 15
- 470
- 0
Báo cáo y học: "Autoimmune progesterone dermatitis in a patient with endometriosis: case report and review of the literature" potx
... JL, Krishnaswamy G: Autoimmune progesterone dermatitis and its manifestation as anaphylaxis: a case report and literature review Ann Allergy Asthma Immunol 2003, 90:469-77; quiz 477, 571 Slater ... the fact that, as mentioned above, the pathogenesis of APD is incompletely understood Treatment Autoimmune progesterone dermatitis is usually resistant to conventional therapy such as antihistamines ... identified cause, dermatologic diseases associated with the menstrual cycle have been labeled autoimmune progesterone dermatitis (APD) [4] The first documented case of APD was in 1921, in which a patient's...
- 5
- 284
- 0
A STUDY ON DEMOTIVATING FACTORS IN READING LESSONS OF THE 10th FORM STUDENTS AT HIGH SCHOOL FOR GIFTED STUDENTS, HANOI NATIONAL UNIVERSITY OF EDUCATION
... during the implementation of the study in this chapter In the next chapter, the analysis of the data and the findings will be identified in detail 21 CHAPTER 3: DATA ANALYSIS This chapter deals with ... provide an adequate explanation for this fact In addition, half of the participants thought that the time allowed in reading lessons in class was another found - out factor One of the teachers added ... of Education as well as study subjects, data collection instruments, data collection procedures and data analysis method Chapter 3, ANALYSIS OF DATA, gives a detailed analysis of data collected...
- 76
- 553
- 4
A comparative study on stability and functional properties of the proteins isolated from yellowfin tuna (Thunnus albacares) dark muscle by acidaided and alkalineaided processes
... value of viscosity The WHC can be defined as the ability of a protein gel to retain water against a gravitational force The level of water retained in a gel is affected by the same factors that ... functional properties of the proteins isolated from yellowfin tuna (Thunnus albacares) dark muscle by acid-aided and alkaline-aided processes N Kamali-Damavandi1, A R Shaviklo2*, A Motamedzadegan3 ... moisture A significant difference was found in TBARS level between the isolated products The lowest TBARS value was found in acid-aided isolate and isolate treated at pH 11.5 The TBARS value of...
- 15
- 460
- 0
DSpace at VNU: A Novel Method Based on Two Different Thicknesses of The Sample for Determining Complex Permittivity of Materials Using Electromagnetic Wave Propagation in Free Space at X-Band
... using a free-space measurement system The system consists of transmit and receive horn antennas operating at X-band The complex permittivity of materials is calculated from the values of γ, in ... between the phase angle ΔΦ measured with two material sample between the two antennas, namely: ΔΦ = Φ2 - Φ1 (11) -360di ε , is the phase angle of λ0 material sample ( i = 1,2 ) Consequently the phase ... standing wave ratio of the pyramidal horn antennas are 20 dBi and 1.15 at center frequency In this model, the distance between the antenna and the material sample is 250mm ( d0 = 250mm ) The two...
- 7
- 237
- 0
An investigation into the use of modality as a rhetorical device in President Barack Obamas State of the Union address in 2016
... for the study are quantitative and qualitative methods The former is defined as the use of numbers as its basis for making generalizations about a phenomenon; and the latter is used to gain an ... of the study as well as its aim and scope It also presents the methods used for the data collection and analysis on the data In this chapter, the significance and the structure of the study are ... about the likelihood of actualization of the situation, and it is the aspect of ability meaning that informs their categorization of ability as extrinsic 2.2.2.2 Deontic Modality (Intrinsic) Traditionally,...
- 104
- 240
- 2
122PART TWO Trading System$20.70 is a good idea, because this level doesn’t show good support. docx
... first case we use the market as an indicator This is a major difference The first case is gambling; the second is going with the odds using the relative strength of a particular stock as an indication ... consider trading when the break finally occurs The problem with a narrow range is that you can’t trade within it because as soon as the stock (index) bounces from the low, it s already almost near the ... earlier CAPITULATION Capitulation is a reversal setup It s that fast, sharp decline with vertical movement and volume-pace pickup that are necessary components because they suggest panic Capitulation...
- 27
- 283
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008