there is no need for a here and now cause of the universe
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx
... endogenous ouabain or OLF Ouabain-sensitive and -insensitive a- isoforms of Na+/K+-ATPase in rats All isoforms of the catalytic a- peptide of Na+/K+-ATPase have similar, high affinity for ouabain [17] ... hormone and the adrenal gland the major place of synthesis of ouabain However, it is still much debated whether ouabain or OLF really exist in mammalian blood and tissues, and if they do, whether ... this a1 -isoform, as well as the highly ouabainsensitive a2 - (skeletal and heart muscle) and a3 -isoform (nerve tissue and brain) are present The exception is the kidney where more than 99.9% of...
- 4
- 423
- 0
A POLITICAL AND ECONOMIC DICTIONARY OF THE MIDDLE EAST potx
... east Abu Musa Island The island of Abu Musa, only a few sq km in area, lies in the Persian (Arabian) Gulf about midway between Iran and the United Arab Emirates (UAE), and was the source of a ... (velaya, plural velayat): Badakhshan, Badghis, Baghlan, Balkh, Bamian, Farah, Faryab, Ghazni, Ghowr, Helmand, Herat, Jowzjan, Kabol, Kandahar, Kapisa, Khowst, Konar, Kondoz, Laghman, Lowgar, Nangarhar, ... Bloc-Maarach An alliance formed between the Israel Labour Party and Mapam in 1969, after the former had been established in 1968 by Mapai, the dominant partner, Achdut HaAvoda and most of Rafi Mapam...
- 764
- 546
- 1
A Theoretical and Empirical Assessment of the Bank Lending Channel and Loan Market Disequilibrium in Poland doc
... substantial lags and the overall impact may be less than desired if there is an excess demand for bank loans (Sealey, 1979) However, since the quantity of loans and therefore the estimates of the ... ) and where Dt denotes the annual growth rate of the demand for bank i ˙ ˙ loans, St the annual growth rate of the supply of bank loans and Qt the annual growth rate of the observed amount of ... demand (supply) regime takes place if the growth rate of the quantity of loans is determined by the variables and their parameters associated with the ˙ annual increase in loan demand (supply) The...
- 36
- 473
- 0
Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx
... of moves: either an input is read and pushed onto a new stack on top of the stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and ... to the extraposition cases, I will recast it in terms of a closely related automaton, the Bottom-up EPDA (BEPDA) ~ The BEPDA consists of a finite-state control and of a stack of stacks There are ... We can then unwrap and pop the matrix clause, and then pop Vz** in the usual manner The grammar corresponding to the BEPDA of Figure is shown in Figure (the arrows again show the sequence of adjunctions):...
- 3
- 354
- 0
báo cáo hóa học:" A Process and Outcomes Evaluation of the International AIDS Conference: Who Attends? Who Benefits Most?" docx
... intention to change their behavior as a result of attending the XV IAC A major limitation of the process and outcomes evaluation is the lack of delegate data collected via the IAC registration form Without ... and Asia (32%) Using survey response as a proxy indication of attendance by country is problematic but, at this point, no other data are available Abstract data by country of work are not available ... cited a behavior change as a result of attending a past IAC Of these, 31% worked in North America, 24% in Europe and the Middle East, and 21% in Africa; 32% were administrators/managers and 29%...
- 11
- 464
- 0
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... condition (Hg and LED) as a proportion of the iris area, normalized to unity, ± S.E.M.) for sessions and for each lightRelative pupil area (calculated as a proportion of the iris area, normalized to ... participated in the data analyses and interpretation, and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The author(s) declare that they have no competing ... especially because the balance between sympathetic and parasympathetic input to the iris response can vary moment to moment, at different times of day, and for different tasks [24-26] These data...
- 9
- 363
- 0
BEYOND THE PALISADE: A GEOPHYSICAL AND ARCHAEOLOGICAL INVESTIGATION OF THE 3RD TERRACE AT ANGEL MOUNDS STATE HISTORIC SITE
... and Marshall 2011) Therefore, there remains abundant potential for broader analyses of archaeological landscapes Many analyses have been completed and ... cultural modification of the landscape stops at these walls The mere fact that there are several manifestations of the palisade wall at Angel Mounds (Black ... Therefore, while the size and goal of her analysis was much larger than what is attempted here, the breadth of artifacts that she examined was much narrower...
- 155
- 210
- 0
The stinky king a social and cultural history of the durian
... also in such account with the learned Doctors, that they think a man can neuer be satisfied therewith, and therefore they giue this fruite an honourable name, and write certaine Epigrammes thereof ... colonialism Chapters and were initially conceived as an historical analysis of the dislike for the durian in the colonial era As I scrutinised archival materials, however, I realised that the colonial ... Notwithstanding all this, I call this thesis a history of the durian, because it deals with the historical development of tastes for and attitudes towards the fruit The problem is that the histories of taste...
- 146
- 703
- 0
A field and geochemical study of the boundary between the nanga parbat haramosh massif and the ladakh arc terrane, northern pakistan
... Parbat-Haramosh Massif and the Ladakh Arc Terrane, Northern Pakistan INTRODUCTION Background The Nanga Parbat-Haramosh massif (NPHM) of northern Pakistan is an unusual geologic feature The massif ... structural grain of the high Himalaya and separates two similar island arc terranes, Ladakh to the east and Kohistan to the west The nature and origin of this unusual geologic relationship is not ... define the location and character of the eastern boundary of the Nanga Parbat massif The eastern margin of the NPHM is in northern Pakistan in the region referred to as the Deosai Plateau (Fig...
- 146
- 347
- 0
Waves principles of light electricity and magnetism secrets of the universe 6940
... feet) The radius of the new sphere is only twice the radius of the first sphere But the area of the second sphere is four times the area of the first That is because the area of a sphere is based ... James Clerk Maxwell took all the pieces of the electricity and magnetism puzzle and put them together His mathematical laws of electromagnetism are known as Maxwell’s equations The mathematical ... a small amount of insulation off each end of the wire Attach one end of the wire to one terminal of the battery Form the wire into a loop and place the compass near the loop of wire Arrange the...
- 65
- 594
- 0
Tài liệu Where There Is No Psychiatrist A Mental Health Care Manual ppt
... current diagnosis and important information, such as the presence of any marital problems 2.8 How to reach a diagnosis There are only a few types of diagnosis that need to be made in a general health ... through Part I at least once before reading the rest of the manual, because many of the later chapters assume that you are already familiar with the basic information on the types and treatments of ... health There are many reasons for this Probably the most important reason is that health workers not understand much about mental health and are therefore less comfortable dealing with mental health...
- 290
- 1,262
- 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
... We also thank Mr T Kobayakawa (Nagasaki University, Nagasaki, Japan) for the technical assistance This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, ... [26] that they form a dimer in an antiparallel fashion through a pair of the interactions between the middle domain and the C-terminal domain Similarly, the C-terminal 326 amino acids of barley ... Table Interaction between the middle and C-terminal domains of GRP94 The bacterial two-hybrid system was used to evaluate the binding activity The value of the combination of the middle and the...
- 9
- 364
- 0
Báo cáo y học: "Specifying and reporting complex behaviour change interventions: the need for a scientific method" potx
... period), and adherence to delivery protocols Adherence is not a characteristic of interventions per se, and is outside the focus of this paper, as are indicators of generalisation, such as the RE-AIM ... extension of these guidelines to non-pharmacological trials [36], the TREND Statement for the transparent reporting of evaluations with non-randomised designs [37] and the STROBE Statement for strengthening ... confused Having consistent terminology and sufficient information for replication appears to be more problematic for behavioural and organisational interventions than for pharmacological ones Twenty-six...
- 6
- 497
- 0
báo cáo khoa học: " Specifying and reporting complex behaviour change interventions: the need for a scientific method" pot
... period), and adherence to delivery protocols Adherence is not a characteristic of interventions per se, and is outside the focus of this paper, as are indicators of generalisation, such as the RE-AIM ... extension of these guidelines to non-pharmacological trials [36], the TREND Statement for the transparent reporting of evaluations with non-randomised designs [37] and the STROBE Statement for strengthening ... confused Having consistent terminology and sufficient information for replication appears to be more problematic for behavioural and organisational interventions than for pharmacological ones Twenty-six...
- 6
- 447
- 0
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt
... the disk, it first checks the disk cache to see if the data is there Disk caching can dramatically improve the performance of applications because accessing a byte of data in RAM can be thousands ... legal/financial counsel It is advisable to seek the advice and representation of legal/financial counsel as may be appropriate for any matters to which the legal/financial materials and information ... such backups that are independent and have integrity One such program is SafeBack, and it is freeware that is available on the Web Isolation of Files Not all the data needed for an investigation...
- 346
- 1,530
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately kDa and faint bands at approximately 14 kDa The band at approximately 14 kDa is not an impurity as it was ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart...
- 16
- 691
- 0
Beyond the Business Cycle: The Need for a Technology-Based Growth Strategy potx
... asset has radically changed the dynamics of trade among nations What the centuries’ old law of comparative advantage does not take into account is the fact that the basis for trade, i.e., a set of ... failed, as many do, to plan for and thereby make the transition to the next major technology, the smart phone, where not just basic design and manufacturing are important Operating and other software, ... competition; namely, the economy that innovates first and scales up the fastest will likely reap the largest share of the economic rewards because it is 34 a distinct advantage to start out ahead of the...
- 45
- 492
- 1
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... Aeronautics and Space Administration NIST National Institute of Standards and Technology NOAA National Oceanic and Atmospheric Administration NRC National Research Council Copyright © National ... National Oceanic and Atmospheric Administration (NOAA), the DOE, the National Institute of Standards and Technology, and several universities to gather wind data, measure structural loading, and ... characteristics for extreme events, the National Oceanic and Atmospheric Administration (NOAA), the DOE, the National Institute of Standards and Technology (NIST), and several universities are...
- 49
- 588
- 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the glycopeptide side-chain atoms of tx 5a, which ... chains of residues Thr10 and Ala12 and the carbohydrate moieties of GalNAc (GN) and Gal (G) The individual amino acids Thr10, Ala12 are represented by 10T and 1 2A, respectively, while GNH1 and ... protons (Tables and 3) Strong NOEs between the anomeric and H2 protons and J1,2 coupling constants of 4.25 Hz for both the GalNAc and Gal monosaccharides identify an a configuration for both anomeric...
- 11
- 563
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... mitochondria treated with ADP was not as great as the effect of the peptide in the absence of the nucleotide, and therefore a reliable comparison cannot be made Demonstration of the function of ANT in A ... be static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared ... Drosophila melanogaster and Xenopus laevis, both of which are similar to each other but not to A franciscana ANT regarding the 198–225 amino acid region (see below) D melanogaster may show a Ca2+-regulated...
- 15
- 505
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25