the substring method creates a substring out of the string inside inputbox text between indexes beginning and ending
Báo cáo sinh học: " Research Article A Spectral Regularization Method for a Cauchy Problem of the Modified Helmholtz Equation" potx
... equation in the interval 1, L Hence it is natural to assume knowledge about u at a second point Let us summarize what we have so far The constant C in Lemma 2.4 is unchanged The propagated data ... Xiong, C L Fu, and J Cheng, “Spectral regularization methods for solving a sideways parabolic equation within the framework of regularization theory,” Mathematics and Computers in Simulation, vol ... u is valid in a large interval < x < L, L > By imposing a priori bounds on the solution at x and at x > 1, we obtain an estimate of the difference between the exact solution u and a regularized...
- 13
- 325
- 0
Báo cáo y học: "Getting a buzz out of the bee genome" pot
... in mammals, nematodes, and other animals [22,23] Thus it appeared that a relatively recent duplication had occurred in the ancestors of Lepidoptera and Diptera around 300 million years ago, and ... Tsuchimoto M, Yasuo S, Funada M, Aoki M, Sasagawa H, Yoshimura T, Tadauchi O, Cameron SA, Kitagawa Y, Kadowaki T: Conservation of novel Mahya genes shows the existence of neural functions common between ... Hymenoptera, honey bees have an extraordinary sex-determining mechanism known as haplo-diploidy: females are normally diploid and a product of sexual congress; males are haploid and develop parthenogenetically...
- 4
- 309
- 0
The US econom is there a way out of the woods
... Although the three balances must always sum to exactly zero, no single balance is more a residual than either of the other two Each balance has a life of its own, and it is the level of real output ... Price of Existing Homes (left-hand scale) Aggregate Market Value of Homes (right-hand scale) Sources: Bureau of Economic Analysis, Federal Reserve, Association of Realtors, and authors’ calculations ... prospects have been transformed as a consequence of the devaluation of the dollar (21 percent for the broad measure since 2002, and more than 50 percent against the euro)7 and the unusually rapid growth...
- 11
- 198
- 0
Báo cáo hóa học: " Research Article A New General Iterative Method for a Finite Family of Nonexpansive Mappings in Hilbert Spaces Urailuk Singthong1 and Suthep Suantai1, 2" potx
... 2.27 Acknowledgments The authors would like to thank the referees for valuable suggestions on the paper and thank the Center of Excellence in Mathematics, the Thailand Research Fund, and the Graduate ... and Applications, vol 116, no 3, pp 659–678, 2003 S Atsushiba and W Takahashi, “Strong convergence theorems for a finite family of nonexpansive mappings and applications,” Indian Journal of Mathematics, ... Shang, Y Su, and X Qin, “Strong convergence theorems for a finite family of nonexpansive mappings,” Fixed Point Theory and Applications, vol 2007, Article ID 76971, pages, 2007 A Kangtunyakarn and...
- 12
- 427
- 0
A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot
... [10] The ASCE division includes AAA+, ABC, PilT, superfamily 1/2 (SF1/2) helicases, and RecA/F1/F0 classes of ATPases, and a large assemblage of NTPases related to the AP(apoptotic) and NACHT families ... downstream of the Walker B aspartate is a shared feature of the KAP and NACHT families [13] In the KAP family proteins, one of these aspartates might function as the protonabstracting negative charge ... iteration of this search retrieved apparent orthologs of ARMS from other animals, such as Danio, Drosophila, Anopheles and Caenorhabditis, and a homolog from the cyanobacterium Anabaena The subsequent...
- 10
- 275
- 0
Báo cáo y học: " Gingival and plaque decontamination: Can we take a bite out of VAP" potx
... Critical Care Vol 10 No Somal and Darby Colonization of the oropharynx by pathogenic bacteria is a key step in the development of VAP Poor oral hygiene and excess dental plaque are particularly ... oral hygiene and VAP prevention The development of simple and reproducible methods and tools to assess and define the state of dentition, oral hygiene, and bacterial burden would be of great value ... potential to favorably impact VAP, perhaps when coupled with other VAP preventative measures Further clinical investigations are needed to address a number of outstanding questions and issues related...
- 2
- 285
- 0
Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt
... 5'-TTCTGA TAA TGC TGA AAA CAT GGG TAT and inner primer pair 5'-CTC TCG ACG CAG GAC TC and 5'-ACC CAT GCA TTT AAA GTT CTA G was used As an internal control, the human β-globin RNA was amplified ... manuscript together with SA All authors read and approved the manuscript Additional material Additional File Materials and Methods The data provided herein describes in detail the materials and ... Berthet-Colominas C, Novelli A, Battai N, Piga N, Cheynet V, Mallet F, Cusack S: Mutual conformational adaptations in antigen and antibody upon complex formation between an Fab and HIV-1 capsid...
- 8
- 266
- 0
Sách tiếng Anh cho trẻ em How to get a gorilla out of your bathtub
... them of being tangled in a bowl of spaghetti Come now, I can assure you that bringing another gorilla over to play in the backyard is a waste of time If your gorilla wanted to play with another ... order another bathtub and have it delivered to the front yard and hope the gorilla will switch, but how will you explain that to the neighbors? What about taking a two-week trip to your grandmother’s ... now?" Want to have some more fun? Walk around your house saying ‘PLEASE’ over and over again just as fast as you can "PLEASE PLEASE PLEASE PLEASE PLEASE PLEASE PLEASE PLEASE PLEASE " ...
- 17
- 347
- 1
A banking union for europe making a virtue out of necessity maria abascal tatiana alonso gispert santiago dernandez de lis wojciech AGolecki
... institutional and functional (Angeloni, 2012) Regarding the geographical scope, the Commission had proposed a mandatory participation of all EMU Member States and a voluntary participation of the rest of ... Member States, and would involve the signature of a Memorandum of Understanding (MoU) We understand that the approval of assistance by the ESM would take place under the same general rules that apply ... From harmonisation to integration Source: BBVA Research Act I: Denial and awakening With the outbreak of the global crisis financial integration in the EU started to reverse at a steady pace Fragmentation...
- 20
- 276
- 0
A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese
... all the learners that are good at 1.3 RESEARCH QUESTIONS - What are the syntactic, stylistic and semantic features of grammar and have a wide range of vocabulary can absolutely use IDHDIE and ... beliefs, and habits of native speakers is as important as a good knowledge of the languge learned This is especially true for such a tough and vague aspect of the language as idioms 5.3 LIMITATIONS AND ... conversations where the meaning of the idiom is clear collaboration and role-play activity can help them remember the Then, teachers can ask learners to guess the meaning of idioms and dialogue they...
- 14
- 1,852
- 4
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated ... transcriptional regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganization in Swiss 3T3 fibroblasts ... studied the role of Smad proteins in regulation of the RhoA ⁄ B genes, activation of these small GTPases and the induction of actin reorganization Finally, to address the biological significance of the...
- 14
- 420
- 0
Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot
... treatment condition) before calculating the displayed mean values (and standard deviations) from at least independent determinations localized and transient changes of chromatin organization that ... informatics and support with statistics for data analysis KW conceived of the study, participated in its design and helped to draft the manuscript All authors read and approved the final manuscript ... http://www.ro-journal.com/content/6/1/15 ME carried out the apoptosis measurements and helped by the gamma H2AX experiments PH and JD participated importantly in the conception of the study and provided informatics...
- 13
- 289
- 0
Báo cáo y học: "A female survivor of childhood medulloblastoma presenting with growth-hormone-induced edema and inflammatory lesions: a case report" doc
... half of the right hemisphere and in contact with the basal nuclei and the thalamus There was no evidence of recurrent disease in the posterior fossa The girl also reported headache and visual ... HEMISPHERE AND IN CONTACT WITH THE BASAL NUCLEI AND THALAMUS NO CLINICAL AMELIORATION VISUAL IMAPIRMENT, HEADACHE GH REPLACEMENT THERAPY DEXAMETHASONE Somatotropin ADMINISTRATION 0.16 mg/Kg a week ... INFLAMMATORY AREAS IN BOTH THE SUPRATENTORIAL AREA AND THE POSTERIOR FOSSA MRI: NO FURTHER INFLAMMATO RY LESIONS CLINICAL AMELIORATION STOP GH REPLACEMENT THERAPY GH REPLACEMENT THERAPY Somatotropin...
- 5
- 220
- 0
Báo cáo y học: "Cost of acute renal replacement therapy in the intensive care unit: results from The Beginning and Ending Supportive Therapy for the Kidney (BEST Kidney) Study" pps
... region The error bars represent the absolute range between the maximum anticoagulant cost of CRRT and the minimum anticoagulant cost of IRRT, and between the maximum anticoagulant cost of IRRT and ... between CRRT and IRRT were calculated The total range, the interquartile ranges (75% and 25%) and median values were calculated Results Characteristic of organizational features Organizational ... Germany, Netherlands, Norway, Sweden, Switzerland, United Kingdom, and Russia; Southern Europe: Greece, Italy, Israel, Portugal, and Spain; North America: Canada, and the United States; South America:...
- 10
- 453
- 0
A contrastive analysis of syntactic structures employed in describing trends in English and Vietnamese business articles
... time and effort, the study only investigates the English and Vietnamese syntactic structures on the levels of clauses and phrases Also, as suggested in the title of the thesis, the object of the ... Vietnamese business articles Similarities and differences are accordingly presented with a view to the data shown in charts and tables The last chapter, Implications and recommendations is a practical ... study, the methods employed to facilitate the realization of the paper and the design of the study The second part, Development, is the focus of the thesis, to which most time and effort are devoted...
- 4
- 605
- 4
A modeling study of ion implantation in crystalline silicon involving monte carlo and molecular dynamics methods
... by the aforementioned authors, Harrison’s group employed the average-force (AF) method, and concluded that the rationale and implications of this concept has theoretical and practical advantages ... range and stopping calculations over the next two decades were made by the application of numerical techniques to traditional theoretical approaches and removal of some of the approximations of ... stripped of some of its electrons and its charge state becomes a function of the target The electrons of the target then polarize around the moving ion causing a modification of the charge state of the...
- 305
- 302
- 0
Picture Dictionary Letters A - Z Beginning and Ending Sounds docx
... materials © 2009 by Kathryn J Davis Picture Dictionary a ant ax apple add anchor ankle astronaut album alligator attic ad Alps ashes © 2009 by Kathryn J Davis Picture Dictionary ā apron acorn angel ... sounds After students have learned the alphabet and mastered beginning sounds, the ending sound pages can be used in the same way, to help students begin to be aware of and recognize ending sounds ... of words and pictures for that letter Have the student name each picture and look at the word Notice that all the words on the page start with the same letter Listen for the letter sound at the...
- 50
- 507
- 2
Quan hệ tìm kiếm đặc lợi tay ba giữa việt nam, nhật bản và TQ trong ngành CN ô tô của VN - Industrialisation and the triangular rent-seeking relationship between Vietnam, Japan and China in Vietnam’s motorcycle industry - Christine Ngoc Ngo
... financial resources and the capabilities necessary to be incorporated into the Japanese and Taiwanese value chains (Fujita, 2007) The China shock inadvertently created a huge demand for standardized ... Important conditions for industrial success include the capacity of the State to pragmatically monitor and to make judgment about the performance, and the capacity to reallocate the subsidies and ... reward investment, which has already been made, and innovation that has already been achieved (Khan & Blankenburg, 2009) Learning rents, on the other hand, are given ex ante and target learning...
- 39
- 435
- 0
báo cáo hóa học:" Increased immunogenicity of surviving tumor cells enables cooperation between liposomal doxorubicin and IL-18" ppt
... materials/analysis tools: ZLJ Wrote the paper: DJP IA GC All authors have read and approved the final manuscript Acknowledgements This study was conducted at the University of Pennsylvania and was supported ... herein, warrants the clinical evaluation of this combinatorial approach in ovarian cancer http://www.translational-medicine.com/content/7/1/104 Competing interests The authors declare that they have ... significant expansion of the tumor fraction that is killed by the combined therapy The favorable safety profiles of both IL-18 and Doxil, coupled with the potent therapeutic effect of their combination...
- 9
- 468
- 0
Báo cáo sinh học: " Cellular apoptosis induced by replication of hepatitis B virus: possible link between viral genotype and clinical outcome" pptx
... characterization of hepatitis B virus surface antigen mutants in Singapore patients with hepatocellular carcinoma and hepatitis B virus carriers negative for HBsAg but positive for anti-HBs and anti-HBc ... Expression of viral microRNAs in Epstein-Barr virus-associated gastric carcinoma J Virol 2007, 81(2):1033-1036 Matsushita T, Okada T, Inaba T, Mizukami H, Ozawa K, Colosi P: The adenovirus E 1A and E1B19K ... confluency was reached Transfected cells were maintained at 37°C and examined according to the experiments FACs assay Vector pcDNA3.1(+) containing the replicative HBV genome A, B, and C were transiently...
- 5
- 363
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25