the ratification of the treaty of rome of 29 october 2004 establishing a constitution for europe
Reducing the Risk of Breast Cancer With Medicine: A Guide for Women potx
... Learning About Breast Cancer Breast cancer is a malignant (muh-LIG-nent) tumor that starts with cells in the breast Malignant means that the cells are cancerous and may spread to other tissue in the ... raises the risk Other risk factors It is rare, but some women are born with a gene that puts them at high risk for breast cancer Having radiation treatment at a young age also raises the risk Learning ... a past breast biopsy raises the risk of breast cancer Menstrual history Having your first period at an early age (before age 12) raises the risk Going through menopause late (after age 55) raises...
- 16
- 400
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... SRp40 ASF ⁄ SF2, SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown ... ( kb) RNAs (Fig 1) In the early phase of HIV-1 gene expression, the five 3¢ss (A3 , A4 c, A4 a, A4 b and A5 ) located in a small central part of the viral RNA are used for production of the completely ... unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 5428–5437 5418–5437 5558–5582 8047–8062 [48, 41, 15, 17, 8] A3 A5 A7 ISS ESE3 The HIV-1 encoded proteins Tat,...
- 10
- 434
- 0
C01 - Fundamentals of Management Accounting (2011 syllabus) A guide for students pot
... recommendations February 2012 Analyse Categorise Compare and contrast Put to practical use Ascertain or reckon mathematically Prove with certainty or to exhibit by practical means Make or get ready for ... inform or notify Appraise or assess the value of Propose a course of action Example from 01 Fundamentals of Management Accounting syllabus Component learning outcome – ‘Explain the importance of ... is an amalgamation of 2006 syllabus‟ Cost Determination, and Cost behaviour and Break Even analysis The FIFO, LIFO and AVCO methods of accounting for stock have been removed (but still appear...
- 7
- 502
- 2
Báo cáo khoa học: "Extraction of Tree Adjoining Grammars from a Treebank for Korean" pdf
... procedure such as Johansen (2004) and Nasr (2004) for French and Habash and Rambow (2004) for Arabic Chiang (2000) used Tree Insertion Grammars, one variation of TAG formalism for his extraction system ... of a FB-LTAG grammar proposed in Han et al (2000) to evaluate the coverage of hand-crafted grammars Our extracted template grammars cover 72.7 % of their hand-crafted subcategorization frames5 ... allow us to extract syntactic features automatically and to develop FB-LTAG Automatically extracted FB-LTAG grammars eventually use reduced tagset because FB-LTAG grammars contain their syntactic...
- 6
- 340
- 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx
... spectra (B), suggesting a lack of rigid conformation These data indicate that EspB assumes a ‘natively partially folded’ conformation, similar to the ‘molten globule’ state Spectra-based figures are ... Iizumi Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E coli effector EspB facillitates microvillus effacing and antiphagocytosis ... pathogenesis EspB as an effector of actin filament reorganization The EspB (or EarB) gene product was first identified as an important factor in EPEC attachment [14] and later characterized as a...
- 7
- 333
- 0
báo cáo khoa học: " Adaptation of barley to mild winters: A role for PPDH2" pps
... evaluated using the analysis of variance (ANOVA) procedure in SAS [49] The variable used for the analysis of each treatment and genotype was ΔC T (CT actin - CT target gene) This variable was preferred ... 5:e10065 Saisho D, Ishii M, Hori K, Sato K: Natural variation of barley vernalization requirements: Implication of quantitative variation of winter growth habit as an adaptive trait in East Asia Plant ... Author details Department of Genetics and Plant Production, Aula Dei Experimental Station, EEAD-CSIC, Avda Montañana 1005, E-50059 Zaragoza, Spain Agricultural Research Institute, Hungarian Academy...
- 13
- 246
- 0
Design of functional polymeric micelles as a carrier for anticancer drug delivery
... after the nanocarriers reach the target site from blood circulation and extravasation There are advantages and drawbacks for each of this strategy that will be discussed here The exploitation of ... open the tumour vascular endothelial cell-cell junctions wider to allow for more extravasation of nanoparticles [118] Grafting a targeting ligand onto the surface of nanocarriers on the other hand ... and Y Y Yang, “Advanced Materials for Co-Delivery of Drugs and Genes in Cancer Therapy,” Advanced Healthcare Materials (2012) 373-392 C Yang*, A Bte Ebrahim Attia*, J.P.K Tan*, X Ke, S Gao, J L...
- 185
- 1,116
- 0
Tài liệu The Little Guide To Beating Procrastination, Perfectionism and Blocks: A Manual for Artists, Activists, Entrepreneurs, Academics and Other Ambitious Dreamers docx
... right. Unlike BehavioralBased Procrastination, which is usually caused by a lack of information or training, FearBased Procrastination is caused by, as its name implies, fear. Fear is unfortunately a major force in many people’s lives: it’s often a rational, if ... know, those aren’t the actual cause of your procrastination the cause is fear but they are the activities we turn to when we are afraid, and they serve to distract us from both the fear, and the guilty knowledge that we are procrastinating. Procrastination has, in fact, ... such as procrastinating. Fear is one of the strongest emotions: scientists even believe that there is even a kind of early warning system in the amygdala (the part of the brain that governs emotion) that allows us to experience fear before we’ve consciously become aware of the thing we are afraid of. It makes sense: if a leopard is about to eat you, it’s a ...
- 87
- 610
- 0
Báo cáo y học: "The anti-vaccination movement and resistance to allergen-immunotherapy: a guide for clinical allergists" ppt
... clinical history that dates over a century, a high vaccination rate of infants in the industrialized world, and an availability of annual vaccines against influenza, immunization efforts are by far ... of allergy vaccines are available in case a patient is adamantly opposed to particular additives Of additional importance, clinicians should be able to provide a basic level of information that ... vaccination and immunotherapy: known, correlated, and unsubstantiated As is the case for all categories of therapeutics, vaccines occasionally cause side-effects and adverse drug reactions (ADRs)...
- 11
- 582
- 0
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"
... is also the Pediatrician-InCharge for the AMPATH Pediatric HIV Care Program and the Neonatal Unit of Moi Teaching and Referral Hospital ES is a Data Manager for AMPATH, based in Eldoret, Kenya ... study and participated in the acquisition of data and qualitative analyses He revised the manuscript critically and gave final approval for publication ES and BM organized the study data, contributed ... in the Department of Child Health and Paediatrics at Moi University School of Medicine and Associate Program Manager for the AMPATH partnership, serving as the Co-Director for the AMPATH research...
- 10
- 696
- 0
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
... was performed, and the pancreas was ablated directly through the surface of the pancreas with an HIFU transducer In the Group B and Group C, extracorporeal HIFU ablation the pancreas was performed ... ear veins and ketamine was infused (50 mg/h) for anesthesia Diazepam was administered as needed The HIFU ablation procedure complies with the guidance of the National Standard of China and was ... locate the target region The real-time US imaging device was used to locate the head of pancreas as the pre-designed target region The spatial volumes of the target regions in the X, Y and Z axes...
- 7
- 481
- 0
Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"
... Thioglycosides are hydrolysis-resistant, synthetic S-analogs of natural O-glucosides involved in the biosynthesis of chrysomelidial and salicin These substances are synthesized and secreted as part of a defense ... a statistically significant linear relation between the changes in membrane potential and the transport activity of the cells was observed with a correlation coefficient of 0.92, validating the ... diabetes mellitus: what is the optimal treatment regimen? Am J Med 2004; 116: 23S-29S Wagman AS, and Nuss JM Current therapies and emerging targets for the treatment of diabetes Current Pharmaceutical...
- 9
- 650
- 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... (suspended biomass) to form aerobic granular sludge for all the experiments was obtained from an aerobic basin of a municipal wastewater treatment plant (Tokyo, Japan) Table - Wastewater composition ... (including a gas-solid separator), an internal diameter of cm, and a height of 3.2 m, were used for all experiments The schematic illustration of the AUFB reactor is shown in Fig Although the AUFB reactor...
- 8
- 481
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
- 20
- 643
- 0
The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products
... Mentha piperita M rotundifolia Apiaceae Apiaceae Poaceae Apiaceae Lauraceae Lamiaceae Lamiaceae Asteraceae Lamiaceae Lamiaceae Micromeria fruticosa O basilicum O gratissimum Origanum vulgare Pelargonium ... Geraniaceae Apiaceae Apiaceae Lamiaceae Rutaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae 16 Biofumigants for the Control of Pest Infestation 393 Table 16.2 Fumigant toxicity of ... essential oils were tested for bioactivity Species Family Species Family Apium graveolens Artemisia arborescens A judaica Carum carvi Apiaceae Compositae Compositae Apiaceae Lamiaceae Lamiaceae Lamiaceae...
- 20
- 483
- 0
A study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutions
... style and heavy local voice In a foreign language center, it is vital to have at least a native teacher of that language Many English centers offer foreigners such as American, Canadian, Australian ... individual approaches second or foreign language learning 2.3.2.2 Characteristics of adults in learning a foreign language The learning of a foreign language of adults is different from that of children ... expression of much more complicated ideas Adults are often embarrassed by their lack of mastery of the language and they may develop a sense of inadequacy after experiences of frustration in trying...
- 96
- 10,573
- 53
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... remaining a bold leader, the use of formality proves to be a must in presidential speeches The 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining ... indicates the evaluation of the speaker toward the truth or probability of a representation of reality From that base, we have an account of the two types of modality in the speech and times of their ... much about the attitude and ideology of the participants, particularly the speaker In addition, the solemnity of the inaugural addresses certainly requires a high degree of formality of vocabulary...
- 44
- 578
- 0
Tài liệu The and Social EffEconomic ects of Financial Liberalization: A Primer for Developing Countries pdf
... London Chandrasekhar, C.P (2004) “Financial liberalization and the macroeconomics of poverty reduction” Draft Thematic Summary on Financial Liberalization for the Asia-Pacific Programme on the Macroeconomics ... association of financial intermediaries and non-financial corporations Financial intermediaries that are a part of these conglomerates allocate credit in favour of companies belonging to the The ... while financial liberalization does encourage new kinds of financial savings, total domestic savings typically not increase in many cases, and expansion of available financial savings is often the result...
- 20
- 482
- 0
Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx
... tích cực vay nợ (kết nghịch) => rủi ro tín dụng cao => người cho vay phản ứng nghịch khơng cho vay, kể người có rủi ro thấp thấp Rủi ro đạo đức (Moral Hazard): Xảy sau giao dịch Người vay có động ... quản lý Slide #14-6 Các quan điểm l a chọn cấu trúc tài Một công ty tài trợ cho dự án mơi theo cac cach: cách: 1.Vay nợ 2.Huy Huy động cổ phần tư tài trơ co phan va tự tai trợ Tài trợ cổ phần từ ... ò ) – Trong đo: đó: EBIT (Earnings before interest and taxes) T : Ta es Taxes EBIT x (1- T)= Lợi nhuận sau thuế nợ vàø vốán cổå phầàn h ka : Chi phí vốn trung bình theo trọng số Nếu EBIT số giá...
- 31
- 463
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25