the potentially affected fraction as a measure of ecological risk
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
... smoking status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical ... summary, a single-item self-assessment of health was consistently related to a variety of health parameters important to the military Used at a population level, this brief health status measure may ... good", and "excellent" The validity of this item as a measure of health status was assessed using health behaviors which are traditionally http://www.hqlo.com/content/4/1/57 important indicators of...
- 9
- 301
- 0
báo cáo hóa học: " Behaviour of motor unit action potential rate, estimated from surface EMG, as a measure of muscle activation level" potx
... graphs) The shape of the curve is similar as for simulation 1a, but the variability of the measurements is larger, as is reflected in the somewhat lower explained variance: the best fit was a ... electrical and physiological parameter values were based on data of the biceps brachii (default values of the software package) For a full list of parameter settings, see Table Simulation protocol ... to the location in time where a similar shape occurred) and a scale factor that is related to the amplitude and width of the wavelet The CWT of each single signal is calculated for a range of...
- 13
- 441
- 0
Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx
... test, are presented as numbers and percentages Continuous variables were compared by means of the t test and analysis of variance and are presented as the mean ± standard deviation Univariate and ... this article as: Soliman Hamad et al., Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population Journal of Cardiothoracic ... Univariate and multivariate Cox regression analyses of risk factors for late mortality† Risk factor HR late mortality Univariate analysis P value HR late mortality Multivariate analysis P value...
- 8
- 358
- 0
báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx
... defined by the Transplant Iron Score Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis Survival time was measured ... represents a or AML indicates acute myeloid leukemia; ALL, acute lymphoblastic leukemia; MDS myelodysplastic syndrome; AA, aplastic anemia plant echocardiogram or MUGA scan All measures of EF were ... were measured using a commercially available sandwich enzyme immunoassay (EIA) (Ramco Laboratories, Inc Stafford, TX) C-reactive protein was measured using an enzyme-linked immunosorbent assay...
- 9
- 320
- 0
Báo cáo y học: "Compressive stenosis of the left hepatic vein as a pathogenesis of postresectional liver failure: a case report" potx
... planning the therapeutic plan and drafting the manuscript All authors read and approved the final manuscript Acknowledgements The technical assistance of Eiji Komatsu and Toru Maeda (Department of Radiology, ... Hospital, Bunyo, Oita, 870-8511, Japan and 2Department of Surgery, National Hospital Organization Fukuoka Higashi Medical Center, Koga, 811-3195, Japan Ninomiya and Ikeda Journal of Medical Case ... tomography Transplantation 2003, 75:1561-1564 Urata K, Kawasaki S, Matsunami H, Hashikura Y, Ikegami T, Ishizone S, Momose Y, Komiyama A, Makuuchi M: Calculation of child and adult standard liver...
- 5
- 270
- 0
Suitability of insulin like growth factor 1 (IGF1) as a measure of relative growth rates in lingcod
... habitats These patterns are also evident in the univariate analyses, which showed that the mean and variance of traditional biological measurements were higher in MPAs than in non-MPAs, whereas ... patterns of IGF1 and traditional biological measurements are different In our data, it appears that traditional measurements explain more of the variation between management status (MPA or non-MPA), ... concentration was quantified by means of the radioimmunoassay developed by Shimizu et al (2000) with barramundi Lates calcarifer antibody and recombinant salmon IGF1 The assay was validated for...
- 12
- 428
- 0
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt
... for the environmental variance, considering the genetic covariance and the other environmental covariance parameters as nuisance parameters Let m be the vector of all these nuisance parameters The ... sub-diagonals and D is a diagonal matrix of the inverse of innovation variances Score and information matrices for D and L parameters can be calculated as functions of the rst and second derivatives of the ... adjusted score statistic checks the actual goodness -of- t of the environmental variance to the data whereas the previous score statistic (T r ) was a goodness -of- t measure for the environmental...
- 14
- 324
- 0
Reading Theory as a Microcosm of the Four Skills
... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions...
- 5
- 680
- 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The South ... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons...
- 28
- 665
- 0
Tài liệu The Man of Letters as a Man of Business docx
... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will have wider acceptance as a book from having been a magazine serial I am ... sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has been engaged,...
- 21
- 544
- 0
Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx
... aesthetic The science of the “beautiful” in a work of art The aesthetic appeal of a work of art is defined by the visual Social, ethical moral, and contemporary standards of a society armature A ... Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal) The Huntington Library, Art ... side of a stick and two baseballs on the other—balancing out the picture balance A principal of art and design concerned with the arrangement of one or more elements in a work of art so that they...
- 6
- 681
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
- 17
- 733
- 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... Degradation of amino acid-substituted ASAs via the proteasome In order to investigate the degradation pathway of amino acid-substituted ASAs in the ER, we used Ltk– 1181 Arylsulfatase A degradation ... Pro136Leu, h) After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum Precipitated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm) ... 25 after synthesis The maturation of these late forming epitopes is accompanied by a further maturation of epitopes A2 and A5 After 25 of chase, precipitation with mAbs A2 and A5 is almost as...
- 10
- 504
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the ... general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a chains The rates of oxidation are...
- 6
- 748
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... Mitochondrial free radical generation, oxidative stress, and aging Free Rad Biol Med 29, 222–230 44 Takasawa, M., Hayakawa, M., Sugiyama, S., Hattori, K., Ito, T & Ozawa, T (1993) Age-associated damage ... replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace, D.C (1997) Mitochondrial DNA in aging and disease...
- 7
- 444
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide...
- 10
- 396
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations comes ... Canada and four comparison nations, 2001 Canada Overall rank Seats in parliament (%) Female legislators, senior of cials, managers (%) Female professional and technical workers (%) Ratio female:male ... disabilities—is relatively low as compared to all nations except the US The low US rate may reflect the lack of available Table Reports of being a victim of crime as percentage of total population...
- 17
- 843
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... Sepharose beads linked to antibodies specific to each MAP As a control, mouse brain samples were also analyzed in parallel The amount of the brain soluble fraction and dCAD cell extract used in these...
- 14
- 416
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers...
- 19
- 648
- 0
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc
... that the TRH-degrading enzyme (TRH-DE) is absent in the plasma of neonatal rats, whereas TRH is rapidly inactivated by plasma of adult rats [39] The endocrinological importance of this enzyme was ... Materials and methods TRH-degrading Lectin Brain enzyme Serum enzyme Liver enzyme SNA (Sambucus nigra A. ) GNA (Galanthus nivalis A. ) MAA (Maackia amurensis A. ) DSA (Datura stramonium A. ) ConA (Concanavalin ... conditions a molecular mass of 125 000 Da was estimated for the liver enzyme and the serum enzyme and a molecular mass of 116 000 Da for the brain enzyme, indicating that all these enzymes exist as homodimers,...
- 9
- 477
- 0
- has attracted increasing attention as a component of amperometriclglutamate sensors used in the food industry and clinical biochemistry the precursor of lgox
- chulalongkorn university in thailand this smalllab kit was created as a result of the research project entitled chemistry laboratory based on chemical safety and pollution minimization sponsored by thai research fund rdg 3072543 one of the outcomes of t
- the nature of biology as a science of life
- understand the nature of biology as a science of life
- as a result of the publications of bartolomé de las casas quizlet
- biological evolution of the saussurean sign as a component of the language acquisition device
- the future of the three tiered system as a control of marketing alcohol beverages
- pesm as a measure of sensorimotor gating
- simultaneous saccharification and fermentation as a measure of the
- pulse pressure as a measure of stroke volume
- concordance correlation as a measure of reproducibility
- gdp gnp as a measure of development
- 5 4 contact angle as a measure of wettability
- 5 5 contact angle as a measure of wetting
- functional uncertainty as a measure of fsc
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose