... from Janssen, AstraZeneca and Falk (Galenica); JH has received speaker fees from AstraZeneca; LA has received research grants and speaker fees from AstraZeneca, and is a former advisory board member ... preparation Data analysis was provided by AstraZeneca All authors read and approved the final submission Acknowledgements This study was supported by AstraZeneca We thank Anna Mett and Claire Byrne, ... productivity and associated costs (this may explain why productivity impairment was not as marked asfor other chronic diseases, as discussed above) Further investigation of the differences in productivity...
... is a candidate fora landmark A tag that has rarely been used during a long period of time is also a candidate fora landmark Outliers are candidates for landmarks in time-series data, such as ... related information and events A summary contains several landmarks Of course, summaries and landmarks change depending on viewpoints and their scale This paper proposes six main landmarks • Landmark ... logs have attributes of places in a schedule and on a calendar They are assigned by the name of the places, andthe addresses or names of shops Occasionally, places indicate homes, offices, stations,...
... is a candidate fora landmark A tag that has rarely been used during a long period of time is also a candidate fora landmark Outliers are candidates for landmarks in time-series data, such as ... related information and events A summary contains several landmarks Of course, summaries and landmarks change depending on viewpoints and their scale This paper proposes six main landmarks • Landmark ... logs have attributes of places in a schedule and on a calendar They are assigned by the name of the places, andthe addresses or names of shops Occasionally, places indicate homes, offices, stations,...
... lives that creates the confusion, the sickness andthe disease Most doctors are trained to look forthe “cause” of the disease, to look forthe viruses, to kill the viruses, the bacteria andthe ... germs This is as futile as trying to kill all the rats in a trash infested city Lets take the United States asa bench-mark for an example If the above backwards healing philosophy of treating SYMPTOMS ... this is how almost everyone approaches their health these days! We’re all looking forthe Germs, the VIRUSES, the “rats” which are the cause of disease and sickness The reality of it is, the...
... deformed like small pancakes, and have a flat bottom Consequently, their frontal area is larger than for spherical droplets having the same mass Asa result of the increased drag, the terminal ... European journals and ‘features’ In addition there has been, forthe past decade, a page entitled ‘Physics in Daily Life’ The present volume is a collection of these pages and is a feast of erudition ... decoration taste as long as we stay away from Aluminium paint andthe like What happened to the detailed balance argument? Obviously, detailed balance holds, but we have to consider one andthe same...
... with learning disabilities and with language disadvantages.” Assessment of learning As noted above, the module is assessed by the service users The grading is a percentage mark, based on the service ... requirements forthe degree courses The national occupational standards for social work (TOPSS, 200213) andthe Benchmark statement for social work (QAA, 200214) form the basis forthe assessment ... as well asthe classroom Inviting users and carers to become part of the learning and assessment of student communication skills in practice settings has very obvious benefits Service users and...
... tools used, parameter values, and output datasets Galaxy groups a series of analysis steps into a history, and users can create, copy, and version histories All datasets in a history - initial, ... history panel shows data andthe results of analyses performed by the user, as well as automatically tracked metadata and user-generated annotations Every action by the user generates a new history ... computational analyses, systematically repeating analyses, capturing all details of performed analyses, and annotating analyses Using Galaxy Pages, researchers can communicate all components of an...
... mother 'sand father 's positions From the beginning, she was affected by her father s story andthe assumption that the Indian as wild asthe wild animals It s when she reasoned ―Pa knew all about ... Americans During the research, some linguistic expressions of these features are also demonstrated based o statistics and analyses 3.2 Implications of the Study With discussions and investigations ... capitalism andthe rationallegal nation-state He emphasizes the importance of cultural influences embedded in religion asa means for understanding the genesis of capitalism andthe success of the USA...
... K, Tasaki A, Yamanaka N, Nakashima H, Kuroki H, Nakamura K, Nakamura M, Katano M Paclitaxel probably enhances cytotoxicity of natural killer cells against breast carcinoma cells by increasing ... inhibitor assay, the percentage of viable DCs was measured as described in Fig (B) Asterisk (*) and sharp (#) indicate p < 0.05 in the comparison of ContDCs vs TaxolDCs, TaxolDCs vs TaxolDCs + N-p-tosyl-L-phenylalanine ... Logan D, Mackay JA, Evans WK Lung Cancer Disease Site Group of Cancer Care Ontario s Program in Evidence-based Care Taxanes as first-line therapy for advanced non-small cell lung cancer: a systemic...
... the loss of vascular homeostasis in sepsis The normal balance between vasodilator (e.g NO, vasodilating prostaglandins) and vasoconstricting influences (e.g catecholamines, angiotensin II, platelet ... putrefaction) Pepsis was good, embodying the natural processes of maturation and fermentation while sepsis was bad and synonymous with putrefaction as characterised by bad smell It was only thousands ... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FORTHE DEGREE OF...
... such asa patient with two deleterious mutations and undetectable acid α-glucosidase activity in fibroblasts, who would have been classified asa classic infantile case of Pompe disease based ... of additional preclinical or clinical studies or additional data gathered by post-marketing surveillance.112 Clinical databases for rare diseases Clinical databases or disease registries are ... α-glucosidase.54 A second method calculates the ratio between the activity of neutral maltases andthe combined activities of acid α-glucosidase and residual maltase-glucoamylase in the presence of maltose...
... those held by the patients and QoL assessment should be performed by the patients themselves using adequate and valid measures or, in alternative, by someone who acts asa proxy or surrogate, such ... and quantitative information The majority said that QoL was interesting and important Users had seen more information and scales, and were more aware of their use; only 8% had ever used formal ... QoL assessment in oncology but that most tended to rely on a physician-base assessment rather than patient-based instruments [8] In 1998, a survey of family physicians reported that for 78% of them...
... variables were assessed by the chi-square test for qualitative variables and by the Spearman s rank-correlation coefficients for quantitative variables The variables tested by univariate analysis ... with and without chronic hepatitis and/ or cirrhosis, only (0.6%) and 13 cases (5.4%), respectively, developed grade 3-4 transaminase increases Moreover, none of these cases was symptomatic, andthe ... inclusion was censored in May 2007 to allow a minimum of 12 months of follow-up Follow-up, assessments and endpoints Patients’ assessment was performed at baseline, after the first month on treatment...
... in the thesis, the researcher wants to find out the attitudes, as well asthe cultural awareness in teaching and learning spoken English of the teachers andthe students of 10 th grade at NTT school; ... responsible for making themselves understandable to listeners through selected and adapted messages based on listeners’ understanding feedback This means that speakers use devices in order to facilitate ... producing and interpreting the target languages because they will transfer from their own language Students may use Vietnamese codes to speak and sometimes they translate on a word-by-words basis They...
... difficulties forthe student, specially, the case of: Questions-Responses and Short conversations There are basic reasons make the students poor listening: they are objective situation and subjective situation ... of the TOEIC is to measure the ability to speak, read and understand basic business English For this reason, the TOEIC has become the preferred exam for corporations, governmental agencies and ... test level 2, the case of: questions-responses and short conversations This survey has following purposes: 10 To research listening skill in TOEIC test, the case of: Questions- responses, and...
... Oedipus interpassivity Games as sensual Games as pain re- Games as replicas Games as dratemptations lievers of non-virtual life matic stages for reality construction Table 2: Reactions toward cyberspace ... function as sign-tools She unravels these material metaphors as condensed icons that absorb and conceal their indexical relations to software and hardware processes Similar to Kessler, she discusses ... good-versus-evil (Taylor 1998), we and us in Americas Army always stands forthe US Army Make no mistake, in Americas Army you are always with us/US It is one of the oldest and most common propaganda...
... It is also clear from comparisons of panels c and d that the hydrolysis rates of the Tyr146-Asn147 andthe Asn147-Ala148 bonds were similar and that, indeed, the replacement of Asn147 was also ... assay buffer For details of various enzyme incubations see Materials and methods Residual enzyme activities were measured at 37 8C in the assay buffer at 100 mM substrate concentration as described ... D-chymotrypsinogen and its mutants by D-chymotrypsin (Fig 3B), the order and speed of cleavages are as follows: the rapid cleavage of the Tyr146-Asn147 and/ or the Asn147-Ala148 bond (s) in the autolysis...
... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...
... identification of plasmodiumspecific mRNAs on the basis of suppressive substractive hybridization (SSH) using cDNAs of plasmodial extracts as tester and of amoebal extracts as driver A large number ... In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ andthe reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting ... NcoI and SpeI at 37 °C for 1.5 h and was analysed on a 2% agarose gel The purified DNA fragment was used as standard Total RNA was isolated from cells of the different stages in the life cycle, and...