Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase Nadthanan Pinchai, Bong-Seop Lee and Eggehard Holler Institut fu ¨ r Biophysik und Physikalische Biochemie der Universita ¨ t Regensburg, Germany Physarum polycephalum is a versatile organism, dis- playing several alternative cell types and developmental transitions [1]. Uninucleate amoebae and multinucleate plasmodia constitute the two vegetative growth phases in the life cycle. These two cell types differ in cellular organization, behaviour and gene expression. In adverse conditions, amoebae reversibly transform into cysts. Usually, when the conditions are favourable, amoebae mate and develop into plasmodia. Plasmodia survive adverse conditions by transforming into another kind of cysts, spherules. When starved in the light, sporangia are formed. In favourable conditions, spores hatch to release amoebae, thus completing the cycle. Of the various cell types in the life cycle of P. polycephalum, only the plasmodium contains the water soluble polymer, b-poly(l-malate) (PMLA) [2–4]. The polymer is concentrated in the nuclei in an amount comparable with that of DNA and hi- stones [5]. Due to its structural similarity to the backbone of nucleic acids, PMLA has been proposed to bind nuclear proteins and function in a molecular transporter system ([6] and references therein). Injec- tion of PMLA into plasmodia increased the growth rate and shortened cell cycle duration, indicating that it could also be involved in the molecular events responsible for the synchronization of events in the plasmodium [7,8]. PMLA is synthesized from l-malate derived from d-glucose through the glyco- lytic pathway and the tricarboxylic acid cycle [9]. The polymer is released from the nuclei into cyto- plasm and finally to the culture medium, where it is Keywords Physarum polycephalum; plasmodium; polymalatase, polymalic acid; spherulin 3b Correspondence E. Holler, Institut fu ¨ r Biophysik und Physikalische Biochemie der Universita ¨ t Regensburg, D-93040 Regensburg, Germany Fax: +49 941 943 2813 Tel: +49 941 943 3030 E-mail: Eggehard.Holler@biologie. uni-regensburg.de (Received 4 November 2005, revised 4 January 2006, accepted 9 January 2006) doi:10.1111/j.1742-4658.2006.05131.x Polymalic acid is receiving interest as a unique biopolymer of the plasmodia of mycetozoa and recently as a biogenic matrix for the synthesis of devices for drug delivery. The acellular slime mold Physarum polycephalum is charac- terized by two distinctive growth phases: uninucleated amoebae and multi- nucleated plasmodia. In adverse conditions, plasmodia reversibly transform into spherules. Only plasmodia synthesize poly(malic acid) (PMLA) and PMLA-hydrolase (polymalatase). We have performed suppression subtrac- tive hybridization (SSH) of cDNA from amoebae and plasmodia to identify plasmodium-specific genes involved in PMLA metabolism. We found cDNA encoding a plasmodium-specific, spherulin 3a-like polypeptide, NKA48 (spherulin 3b), but no evidence for a PMLA-synthetase encoding transcript. Inhibitory RNA (RNAi)-induced knockdown of NKA48-cDNA generated a severe reduction in the level of PMLA suggesting that spherulin 3b func- tioned in regulating the level of PMLA. Unexpectedly, cDNA of poly- malatase was not SSH-selected, suggesting its presence also in amoebae. Quantitative PCR then revealed low levels of mRNA in amoebae, high levels in plasmodia, and also low levels in spherules, in agreement with the expres- sion under transcriptional regulation in these cells. Abbreviations DSDM, diluted semidefined medium; PMLA, b-poly( L-malate); RNAi, inhibitory RNA; SDM, semidefined medium; Sph, spherulin; SSH, suppression subtractive hybridisation. 1046 FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS degraded to l-malate by a plasmodium-specific hy- drolase (polymalatase) [4,5,10,11]. PMLA is a highly interesting polymer: applications in pharmacy and medicine are proposed ([6] and refer- ences therein); nanoconjugates of PMLA can be used as drug delivery vehicles [12], the crystal structure is being investigated [13]. However, little is known about the regulation of the polymer at the genetic level of its synthesis and degradation. The gene for polymalatase has been sequenced (accession number AJ543320 [14]), and distinct features of its sequenced promotor remain to be assigned to transcription control. The mechanism of PMLA synthesis has been studied in vivo, but attempts to identify the PMLA synthesizing enzyme system have been unsuccessful because of loss of syn- thetic activity during rupture of plasmodia in the pre- paration of extracts [15]. The PMLA synthetic capacity of plasmodia of the yellow strains such as P. polycephalum MC 3 VII is approximately 1 mgÆh )1 Æg plasmodia )1 [8,9] ([6] and references therein), suggesting the presence of detect- able amounts of PMLA synthetase-specific mRNA. The absence of PMLA and polymalatase in other cell types could be the result of cell specific gene expression for synthesis and degradation. To gain deeper insight, this investigation was aimed at identifying plasmo- dium-specific genes, which are involved in the synthesis of PMLA and ⁄ or its regulation, and to clarify whether the stage-specific expression of polymalatase [4,10] is regulated at the transcriptional or the translational level. We report on the identification of plasmodium- specific mRNAs on the basis of suppressive substrac- tive hybridization (SSH) using cDNAs of plasmodial extracts as tester and of amoebal extracts as driver. A large number of transcripts were found, most of them false-positive and only three true-positive. One had a high degree of identity with spherulin 3a and appeared to be involved in regulation of PMLA levels in vivo. None of the SSH-generated DNAs showed similarity with a sequence listed in the databases that would be indicative of a PMLA synthetase. Quantitative PCR revealed that polymalatase mRNA was expressed at considerably lower levels in amoebae and spherules than in plasmodia. This paralleled contents of poly- malatase protein [4,10] suggesting regulated expression at the transcriptional level. Results Isolation of differentially expressed cDNAs After SSH, differentially expressed cDNAs were ana- lysed after two rounds of PCR. The amplified products from the secondary nested PCR were ligated with pGEM Ò T-vector and were transformed into DH10B competent cells. About 70 white colonies were obtained in total, 52 of which were selected. Plasmid DNAs were isolated and analysed after restriction enzyme digestion. Each DNA sequence occurred only once in agreement with the fact that 5¢-ends of mRNAs had been isolated with the Capfinder oligo- nucleotides. Restriction to 5¢-ends was thought to reduce the complexity of bands after SSH and enhance isolation of products. Nineteen of the plasmid prepara- tions contained inserts of 150 bp and were sequenced. PCR analysis indicated three true-positive subtracted transcripts and all others to be false positives. The high ratio of false- to true-transcripts was attributed to the use of the different strains LU352 for amoebae and M 3 CVII for plasmodia. Isolation of 5¢-ends of mRNA by SSH using Capfinder oligonucleotides responded in particular to variability in this region. The three transcripts NKA8 (accession number DQ017262), NKA49 (accession number DQ017263), and NKA48 (accession number DQ017261) were plas- modium-specific, as they were not detected in amoe- bae. Fragment NKA8 contained an ORF encoding 257 amino acids and showed a putative conserved domain in the NCBI data base termed DUF343 (or gnI|CDD|26165 in the conserved domain data base), found in various cellular organisms. Fragment NKA49 encoded 37 amino acids, and no alignments were found. These two fragments were not considered fur- ther. Although the high PMLA producing activity of plasmodia had suggested the finding of an abundant cDNA for PMLA-synthetase, no such cDNA could be identified to date. Transcript of NKA48 showed the highest abundance and was further analysed. Nucleotide and deduced amino acid sequences of NKA48 were compared with the GenBank database. The results indicated a high degree of identity on the levels of nucleotides (84%) and amino acids (86%) with spherulin 3a (Figs 1 and 2), the most abundant encystment-specific protein [16], and identities with sequences of bc-crystallins (Fig. 2). The total number of amino acids is 103, correlating with a calculated molecular mass of 11271.5 and a the- oretical isoelectric point of 4.88. Because of the high similarity, the polypeptide encoded by NKA48 was named spherulin 3b. Knockdown of mRNA to NKA48 (spherulin 3b) Macroplasmodia were injected with dsRNA to NKA48 (spherulin 3b) and harvested after 24 h. Two negative controls were performed: macroplasmodia N. Pinchai et al. Cell type expression of spherulin 3b and polymalatase FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS 1047 without microinjection and macroplasmodia injected with unspecific dsRNA (generated using part of the pGEM Ò -5zf(+) vector as template [14]). The degree of mRNA knockdown was analysed by real-time PCR with actin mRNA as reference. Figure 3 shows that the ratio of mRNA to NKA48 over that of actin was significantly reduced to 1% (P<0.001). Control microinjection with unspecific dsRNA showed no effect on mRNA levels (P > 0.5), indicating that the knockdown was specific. The fact that this low residual level was obtained after 24 h suggested that the half- life of spherulin 3b mRNA was in the range of one to a few hours and much less than the half-life of 24– 36 h for spherulin 3a mRNA [16]. Inhibitory RNA (RNAi) experiments were also carried out with dsRNA to NKA8 but a reduction of only 25% of the mRNA level was observed and this was considered insignifi- cant (P > 0.1). For the relatively short NKA49, RNAi inhibition was not attempted; this decision was based on previous experience with short dsRNA. Decreased levels of PMLA after microinjection of dsRNA PMLA was measured in the extracts of the above NKA48-dsRNA injected and control macroplasmodia harvested 24 h after microinjection and referenced to the amount of protein in the same cells. Knockdown of mRNA in Fig. 3A was found to be paralleled by a severe reduction to 3.5 ± 0.5 lg PMLAÆmg )1 protein (12% with reference to uninjected macroplasmodia; P < 0.002) (Fig. 3B). The control that had received unspecific dsRNA amounted to 20 ± 4 lg PMLAÆmg )1 protein (P > 0.05), not significantly lower than the uninjected control, indicating that the reduction in PMLA content was specifically referred to knockdown of NKA48 mRNA. As suggested by the low level of suppression of specific mRNA, no effects were notified in experiments with dsRNA to NKA8. Macroplasmodia were observed for several days after microinjection, however, significant morphologi- cal changes related to the depression of PMLA were not observed. Level of polymalatase mRNA at different stages in the life cycle The amount of polymalatase transcript at different sta- ges in the life cycle was monitored by real-time PCR using specific primers. Since the mRNA level of house- keeping genes, such as of actin, varies from one cell type to the other, a cloned fragment of the polymala- tase gene was used as an external standard and subjec- ted to the same treatment as the samples. In Fig. 3C, Fig. 1. Nucleotide sequence alignment of spherulin 3b (1) with spherulin 3a (2). Identical residues are highlighted in grey. Start and stop codons are given in bold. Forward and reverse primer for RNAi experiments are underlined. Ac, Accession Number. The alignment was car- ried out using CLUSTALW from http://www.expasy.org and BLAST from NCBI. Cell type expression of spherulin 3b and polymalatase N. Pinchai et al. 1048 FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS the level of cDNA of polymalatase (corresponding to the level of mRNA) was very low for amoebae and spherules in comparison with plasmodia (P<0.001). The expression of the gene in amoebae and plasmodia explained, why cDNA was absent after SSH screening (see above). The presence of cDNA in the stages of the life cycle indicated that the protein could have some general function. High levels specifically in plasmodia are consistent with a functional affiliation to PMLA and with a regulation of gene expression at the tran- scription level. Discussion Physarum polycephalum belongs to the mycetozoa, the multicellular eukaryotes more closely related to ani- mal–fungi than to green plants [17,18]. Mycetozoa dis- play a life cycle including the microscopic amoebae and the gigantic multinucleate plasmodium [1]. Of the various cell types only the plasmodium contains the water soluble polymer, PMLA [10]. The polymer is concentrated in the nuclei, the level being under homeo- static control, and the excess released continuously into the culture medium [5]. Its presumed function is to coordinate transport, delivery, and activity of cer- tain proteins (DNA polymerases, histones, etc.) to nuc- lei [3,7,10,19,20], and it has been suggested that it participates in the maintenance of the observed high degree of synchrony typical for plasmodia [8]. Strain M 3 CVII is one of the high PMLA producers [8]. Sev- eral other strains contain less PMLA, but no strain has been found that was devoid of the polymer. In contrast, PMLA contents of nuclei were similar in all strains. Thus, although the treatment with RNAi to spherulin 3b reported here suppressed the overall level of PMLA, the remaining low level was probably suffi- cient to support normal cell morphology. Under adverse conditions, such as starvation and desiccation in the dark, the plasmodium undergoes reversible differentiation into smaller dehydrated sphe- rules [21]. Each of the spherules contains several nuclei that overexpress particular stress proteins. Four major spherulation-specific mRNAs have been identified that emerged 24 h after beginning of starvation-induced spherulation of plasmodia and that then comprise  10% of the total mRNA [16]. Among them, spheru- Fig. 2. Structural alignment of amino acid sequence by motifs, of spherulin 3b with spherulin 3a and other members of the bc-crystallin fam- ily: (1) spherulin 3b from P. polycephalum; (2) spherulin 3a from P. polycephalum; (3) hypothetical protein YPTB2846 from Yersinia pseudo- tuberculosis; (4) hypothetical protein YmolA_01000341 from Y. mollaretii; (5) hypothetical protein Y1348 from Y. pestis; (6) c-crystallin from Danio rerio; and (7) development-specific protein S homologue from Myxococcus xanthis. The residues highlighted in black indicate glycines, serines, and aromatics that are conserved in a bc-crystallin fold. The residues shown in grey indicate the side chains and backbone sites that are involved in calcium binding [24]. The residues in the conserved tyrosine corners are in bold [24]. ‘Greek key’ motifs are highlighted with underlines: single line, first motif; broken line, second motif; double line, third motif. Motif searches were performed using PROSITE from http://www.expasy.org. Similarity search and multiple alignment were carried out using CLUSTALW from http://www.expasy.org and BLAST from NCBI. Ac, Accession Number. N. Pinchai et al. Cell type expression of spherulin 3b and polymalatase FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS 1049 lin 3a is the most abundant mRNA. During differenti- ation, synthesis of PMLA discontinues, and the remaining polymer is exported into the extracellular fluid and degraded. It is assumed that the PMLA syn- thesizing enzyme is downregulated at the onset of spherulation. Despite considerable effort, knowledge of PMLA synthetase activity and its regulation is still fragment- ary [15]. To discover stage-specifc genes affiliated with PMLA metabolism and ultimately to identify the syn- thetase gene, SSH was used with mRNA of the plas- modium as the tester and mRNA of amoebae as the driver. The amoebae strain chosen was LU352, which was not identical with plasmodia of strain M 3 CVII. It was chosen because it allowed preparations of contam- ination-free RNA that, for unknown reasons, had not been possible for M 3 CVII amoebae. The choice of the different strain had the principle disadvantage of gen- erating a large portion of false-positive transcripts. Assuming that mRNA would be abundant in the plasmodium it was hoped that PMLA synthetase cDNA could be identified by SSH using amoebae as driver, which do not produce PMLA. While this cDNA could not be identified, an abundant species was revealed that encoded a 11.3-kDa polypeptide, NKA48 (named spherulin 3b), which is structurally highly related to spherulin 3a (85% identical amino acids). While NKA48 occurs in plasmodia, spherulin 3a is only found in spherules [16]. Both proteins con- tain the ‘Greek key’ typical of the bc-crystallin family of proteins. While spheruline 3a like another two- domain protein, protein S [22], responds in terms of stress proteins [23] to extreme environmental condi- tions, NKA48 has no such function. bc-Crystallins are two-domain proteins found in vertebrate eye lenses and have distant relatives in microorganisms (e.g. the proteins in Fig. 2). The bc-crystallin domain of spherulin 3a from P. poly- cephalum, considered by some as a primitive organ- ism, has been compared by X-ray crystallography with the modern lens crystalline domain fold in order to address the evolutionary origin of the vertebrate bc-crystallins [24]. Typically, two successive Greek key motives (underlined in Fig. 2, each approximately 40 amino acid residues) pair to form a domain. The domain fold contains a pair of calcium binding sites. While the bc-crystallins of lens (not shown) and lower organisms in Fig. 2 contain two domain folds, spheru- lin 3a and NKA48 contain only a single domain fold. The stability of these two proteins is highly dependent on calcium binding [25]. The typical domain motives contain a ‘tyrosine corner’ in the domain centre as seen in proteins 3–6 of Fig. 2 or slightly displaced as A B C Fig. 3. Knockdown experiments and stage specific expression of polymalatase mRNA. (A) Knockdown of NKA48 mRNA by specific dsRNA. Levels of mRNA relative to that of actin are shown 24 h after microinjection with dsRNA to NKA48 and with unspecific con- trol dsRNA to pGEM-5zf(+) vector. Standard deviations refer to experiments in triplicates. (B) PMLA content of plasmodia injected with dsRNA to NKA48 in the RNAi experiment. The data are refer- enced to protein contents. Standard deviations are shown for measurements in triplicates. (C) mRNA levels of polymalatase in different cell types during the life cycle. Levels were measured in terms of cDNA by PCR referenced to a standard as described in Experimental procedures. One-hundred per cent mRNA (plasmodia) refers to 8.91 pgÆlL )1 standard cDNA. Standard deviations are shown for measurements in triplicates. Cell type expression of spherulin 3b and polymalatase N. Pinchai et al. 1050 FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS in Protein S (7) or spherulin 3a (2). NKA48 (1) dif- fers from all of these proteins by not containing a tyrosine in a corresponding position. In contrast to NKA48, spherulin 3a is stabilized by forming dimers through disulfide bonds. Dimerization is not possible for NKA48, because it does not contain such cyste- ines. It is concluded that NKA48 is more distant from two-domain bc-crystallins as is spherulin 3a, and has evolved from this gene by gene duplication, as indicated by the high degree of sequence similarity (Fig. 1). This resulted in a structure devoid of the tyrosine corner and dimerization by disulfide forma- tion. It is also different in structure from spherulin 3a by 14 amino acid substitutions, eight of them located in the first two b-strands of the N-terminal half of NKA48, upstream of the homodimer interface and accessible for interactions with other macromolecules. It is to be shown how these mutations serve the par- ticular function of NKA48 in the regulation of PMLA synthesis. Knockdown analysis of plasmodia with dsRNA to NKA48 revealed a dramatic decrease in NKA48 mRNA to a residual 1% and a decrease in PMLA to a residual 12% compared to the contents in reference plasmodia. Because of the high sequence identity of mRNA for spherulin 3a and spherulin 3b, knockdown of spherulin 3a mRNA might have also occurred by this dsRNA treatment. However, because spherulin 3a is not transcribed in the plasmodium [16], this possibil- ity could not have effected the suppression of PMLA synthesis. Among other possibilities, this effect on PMLA synthesis could be the result of loss of induction at the transcriptional level, of loss of activation of the synthetase protein itself, or of derepression of enzyme(s) catalysing PMLA degradation. An interest- ing interplay of NKA48 with spherulin 3a could be imagined if both proteins bound competitively at the same loci but only NKA48 was an inducer and ⁄ or activator. In a physiologically meaningful mechanism, spherulin 3a would displace NKA48 during the onset of spherulation and suppress PMLA synthesizing activity. Degradation of PMLA during the onset of spherula- tion is catalysed by enzymatically active forms of polymalatase in the extraplasmodial fluid [5,10,11]. During plasmodia growth, only catalytic amounts of polymalatase are contained in the culture medium, while large amounts of zymogen reside within the plas- modium. Correspondingly, zymogen and polymalatase with different functions have been proposed, namely a PMLA hydrolysing variant in the exterior and a chap- eroning adapter variant in the interior of plasmodia [7,10,11]. Polymalatase activity depends on zymogen activation [10] at the outer surface of plasmodia (unpublished results). The enzymology has been inves- tigated in detail [5,10,11,26,27]. The hydrolytically inactive form or zymogen of polymalatase binds PMLA, chaperons it through the intracellular fluid, thus functioning as an adapter by connecting it with other proteins [7,10], and eventually manages its export into the extracellular fluid (unpub- lished data). In agreement with these activities, the role of polymalatase and its zymogen is correlated with the synthesis of PMLA by the plasmodium. Our results of real-time PCR measurements indicated high levels of mRNA in plasmodia and low levels in both amoebae and spherules. The differences parallel the occurrence of high amounts of polymalatase protein in plasmodia, very low levels in spherules, and the absence of polymalatase protein in amoebae [10]. The correlation suggested regulation of synthesis at the transcriptional level. Experimental procedures Culture conditions for the growth of plasmodia Microplasmodia of P. polycephalum strain M 3 CVII ATCC 204388 (American type Culture Collection, LGC Promo- chem, Wesel, Germany) were grown axenically in semi- defined medium (SDM) as described [28]. Cells were harvested for SSH after 2 days. Macroplasmodia were obtained by fusion of 400 lL of packed 2-day-old micro- plasmodia on agar in 13.5-cm Petri dishes according to a previously described method [29] and grown for 24 h in the dark prior to microinjections. After injection, they were grown for further 24 h and then harvested for the analyses of mRNA and PMLA content. Culture conditions for spherule preparation Spherules were induced by the transfer of 2-day-old micro- plasmodia to a non-nutrient salt medium and were shaken in the dark for 2 days at 24 °C as described [30]. After replacement with fresh salt medium, spherules were incuba- ted at 24 °C for 1 day and were harvested for real-time PCR. Culture conditions for the growth of amoebae DSPB plates (diluted SDM with phosphate buffer [28]) were inoculated with 3 · 10 5 amoebal cysts of the apogamic strain LU352 [31], 100 lL formalin-killed bacteria, and 100 lL Millipore water. The plates were incubated at 24 °C N. Pinchai et al. Cell type expression of spherulin 3b and polymalatase FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS 1051 for 48 h to allow excystment and were then transferred to 30 °C. After 4 days at 30 °C the plates became confluent and were harvested for SSH and real-time PCR. RNA isolation To isolate total RNA, amoebae and macroplasmodia were harvested from the agar plates and immediately frozen in liquid nitrogen. RNA isolation was carried out by using the QIAGEN RNeasy Ò Mini Kit (Qiagen, Hilden, Germany) and a maximum of 100 mg frozen cells. PolyA + RNA was isolated using 85 lL Dynabeads Ò (Invitrogen, Karlsruhe, Germany) oligo(dT) 25 and 25 lg total RNA and was eluted in 15 lL Tris ⁄ HCl (10 mm, pH 7.5). The eluted mRNA was immediately used for the first-strand cDNA synthesis. cDNA synthesis First-strand synthesis reactions were set up with each con- taining 0.5 lg mRNA, 10 lm oligo(dT) primer and 10 lm CapFinder oligonucleotide according to the protocol of Clontech Laboratories 1996 (Mountain View, CA). Reverse transcription was performed with Rnase H Minus M-MuLV Reverse Transcriptase (MBI Fermentas, St. Leon-Rot, Germany). After 1 h at 42 °C, 0.4 lL 100 mm MnCl 2 was added, and the sample was incubated for a fur- ther 15 min. The reaction was terminated by heating at 70 °C for 10 min, the first-strand product was purified using QIAquick PCR purification Kit (QIAGEN). Second-strand synthesis reactions were carried out using Advantage TM 2 PCR Kit (BD Biosciences Clontech, Moun- tain View, CA) and long-distance PCR (BD SMART TM PCR cDNA Synthesis Kit User Manual). Suppression subtractive hybridization Differentially expressed cDNAs in plasmodia and amoebae were identified following the SSH technique described by Diatchenko et al. [32]. Plasmodial extract mRNA was used as tester and amoebal extract mRNA as driver. Only poly(A) + RNA was used for first-strand cDNA synthesis. PCR reactions were optimized and performed in such a way that syntheses remained in the exponential phase. Care was taken that at least 25% of total cDNA was ligated with adaptors on both ends. The success of SSH was tested for an abundantly expressed housekeeping gene (actin Ppa35 [33], accession number M21500), for a less abun- dantly expressed gene lig1 [34], and for the known stage- specific genes actin-fragmin kinase [35], fragmin A [36], fragmin P [36], and polymalatase (accession no. AJ543320) using primers to the published cDNA sequences. Also, the efficiency of SSH was checked by comparing the number of PCR cycles necessary to produce equal amounts of actin cDNA in probes containing equal amounts of either sub- stracted or unsubstracted DNA. Subtracted PCR products were then ligated with pGEM Ò T-vectors (Promega, Mannheim, Germany) and were trans- formed into DH10B competent cells. The plasmids were isolated using Nucleospin Ò Plasmid Kit (Machery-Nagel, Du ¨ ren, Germany) and were sent for sequencing (MWG Biotech, Ebersberg, Germany). The blast program was used for Databases analysis. The stage specificity of the subtracted cDNA sequences was verified by conventional PCR including 20 ng of the above cloned cDNA from SSH, 1 · PCR buffer, 25 mm MgCl 2 , 10 mN dNTP mix, Taq polymerase (2.5 U, MBI Fer- mentas) and 10 lm of each of the following primers. For NKA8: forward, 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢. For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG TC-3¢. For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢. Cycling conditions were 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 54 °C for 30 s, 72 °C for 2 min, and 72 °C for 10 min. The samples were then separ- ated by electrophoresis through 2% agarose gel. Sequences and primers of the other SSH products can be obtained on request from the corresponding author. RNA interference RNAi experiments were carried out with dsRNA to NKA48 by the method essentially as described by Haindl and Holler [14]. Specific DNA template to NKA48 for dsRNA synthesis was generated from first-strand cDNA and the following primers (NKA48, accession number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢- GCCTTCTAATACGACTCACTATAGGGACCACGATG ATGGATGAAATG-3¢ (reverse). Both primers contained T7-polymerase promoter at the 5¢ terminus and were cus- tom-synthesized by MWG-Biotech. The resulting 294-bp DNA spanned the nucleotides 51–310 of the gene including the origin of transcription, and was used as template for in vitro dsRNA synthesis as described by Donze and Picard [37]. In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting DNA spanning nucleotides 21–536 of the gene (accession number DQ017262). For con- trol injections, nonspecific dsRNA was generated by the same method using a PCR-derived fragment with 592 bp, nucleotides 142–734 from the vector pGEM(R)-5zf(+) (Technical Servics, Promega Corporation, Madison, WI, USA). Each knockdown experiment was carried out with Cell type expression of spherulin 3b and polymalatase N. Pinchai et al. 1052 FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS 10 lg dsRNA, microinjected into the veins of macro- plasmodia. After 24 h, the plasmodia were analysed by real-time PCR. Real-time PCR The amount of NKA48-specific mRNA in the RNA inter- ference experiment was measured with reference to mRNA expressed for actin Ppa35 gene using the Roche-LightCycler (Roche, Mannheim, Germany). cDNA was synthesized from 2 lg total RNA of each sample and reference, and 2 lL of the purified product was subjected to real-time PCR, each containing 10 lL2· SYBR Green Master Mix, 10 lm each primer and 6 lL RNase free water using the following conditions: 15 min 95 °C activation of HotS- tarTaq DNA Polymerase and 35 cycles (15 s 94 °C, 20 s 58 °C and 20 s 72 °C). For actin, primer pairs were 5¢-CATGTGCAAGGCTGGATTTGCTG-3¢ (forward) and 5¢-ACCGACGTATGAGTCCTTTTG-3¢ (reverse) and for NKA48 5¢-GATGCTACTTCAGCGGAAACTC-3¢ (for- ward), 5¢-CACTTGAGTGTTCTGCTCCAG-3¢ (reverse). To compare mRNA expression levels of PMLA hydro- lase in the amoebae, plasmodia and spherules, a PCR frag- ment derived from the target sequence (polymalatase, accession number AJ543320) was generated as a standard for absolute quantification. To create the standard, 40 ng of plasmodial cDNA was used in a conventional PCR including 1 · PCR buffer, 25 mm MgCl 2 ,10mm dNTP mix, Taq polymerase (MBI Fermentas) and 10 lm each primer 5¢-CAAAGGGATTATGAGACAGCAG-3¢ (for- ward) and 5¢-ACTGTGCCATCCGCCTTC-3¢ (reverse). Cycling conditions were 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 2 min. The amplified product was purified by electrophor- esis on 2% agarose gel and using QIAquick Ò Gel Extrac- tion Kit (QIAGEN). Fifty nanograms pGEM Ò T-vector was ligated with 16 ng purified PCR product and was transformed into DH10B competent cells (Bethesda Research Laboratories, Frederick, MD). Plasmid isolation was carried out using the Nucleospin Ò Plasmid Kit (Machery-Nagel). For insert isolation, 12 lg plasmid DNA was digested with NcoI and SpeIat37°C for 1.5 h and was analysed on a 2% agarose gel. The purified DNA fragment was used as standard. Total RNA was isolated from cells of the different stages in the life cycle, and first-strand cDNA synthesis was per- formed in triplicate as above for mRNAs, but using 2 lg total RNA. Real-time PCR was carried out with 40 ng cDNA of each sample in parallel with five different amounts of the standard DNA, using the same primer pair for polymalatase as above and cycling conditions 95 °C for 15 min, followed by 35 cycles of 95 °C for 15 s, 58 °C for 20 s, and 72 °C for 20 s. Default settings of the Lightcycler Software Version 3.5.3 and conditions in the linear range of the PCR-reaction were ensured. Quantitative analysis of PMLA Macroplasmodia were harvested, weighed and transferred into a glass homogenizer. Two vols lysis buffer (50 mm Tris ⁄ HCl pH 7.5, 5 mm NaS 2 O 5 ,50mm EGTA, 10 mm MgCl 2 , 300 mm NaCl, 0.5% Triton X-100), 1 ⁄ 25 volume of protease inhibitor (calculated from the volume of the lysis buffer) and 1 ⁄ 1000 volume of mercaptoethanol were added. The homogenate was transferred to a clean tube and centrifuged at 20 000 g for 30 min. One hundred microlitres of the clarified lysate was removed and ali- quoted equally into two microcentrifuge tubes. One of the two aliquots was hydrolysed with 50 lL2m sulfuric acid and incubated at 95 °C for 1.5 h. Then the acid was neutralized with 50 lLof4m NaOH. The other tube was kept on ice and was used to measure the amount of endogenous malate. Polymalic acid was assessed on basis of the malate dehydrogenase reaction as described [8]. Protein was assayed according to the method of Bradford [38]. Acknowledgements The technical assistance of Hermine Reisner and Sonja Fuchs is greately acknowledged. References 1 Burland TG, Solnica KL, Bailey J, Cunningham DB & Dove WF (1993) Patterns of inheritance, development and the mitotic cycle in the protist Physarum polycephalum. Adv Microb Physiol 35, 1–69. 2 Fischer H, Erdmann ES & Holler E (1989) An unusual polyanion from Physarum polycephalum that inhibits homologous DNA polymerase-alpha in vitro. Biochem- istry 28, 5219–5226. 3 Doerhoefer S, Windisch C, Angerer B, Lavrik OI, Lee B-S & Holler E (2002) The DNA-polymerase inhibiting activity of poly (b-L-malic acid) in nuclear extract dur- ing the cell cycle of Physarum polycephalum. Eur J Biochem 269, 1253–1258. 4 Windisch C, Miller S, Reisner H, Angerer B, Achham- mer G & Holler E (1992) Production and degradation of b-poly-L-malate in cultures of Physarum polycephalum. Cell Biol Internat Reports 16, 1211–1213. 5 Schmidt A, Windisch C & Holler E (1996) Nuclear accumulation and homeostasis of the unusual polymer b-poly (L-malate) in plasmodia of Physarum polycephalum. Eur J Cell Bio 70, 373–380. 6 Lee B-S, Vert M & Holler E (2002) Water-soluble ali- phatic polyesters: Poly(malic acid)s. In Biopolymers Volume 3a Polyesters (Doi, Y & Steinbu ¨ chel, A, eds), pp. 76–103. Wiley-VCH, Weinheim, Germany. 7 Karl M, Gasselmaier B, Krieg RC & Holler E (2003) Localization of fluorescence-labeled poly(malic acid) to N. Pinchai et al. Cell type expression of spherulin 3b and polymalatase FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS 1053 the nuclei of the plasmodium of Physarum polycepha- lum. Eur J Biochem 270, 1536–1542. 8 Karl M, Anderson R & Holler E (2004) Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases growth rate. Eur J Biochem 271, 3805–3811. 9 Lee B-S & Holler E (1999) Effects of culture conditions on beta-poly(L-malate) production by Physarum polyce- phalum. Appl Microbiol Biotechnol 51, 647–652. 10 Karl M & Holler E (1998) Multiple polypeptides immunologically related to b-poly(L-malate) hydrolase (polymalatase) in the plasmodium of the slime mold Physarum polycephalum. Eur J Biochem 251, 405– 412. 11 Korherr C, Roth M & Holler E (1995) Poly(beta-L- malate) hydrolase from plasmodia of Physarum poly- cephalum. Can J Microbiol 41, 192–199. 12 Lee B-S, Fujita M, Khazenzon NM, Wawrowsky KA, Wachsman-Hogiu S, Farkas DL, Black KL, Ljubimova JY & Holler E (2006) Polycefin, a new prototype of a multifunctional nanoconjugate based on poly( b -L- malic acid) for drug delivery. Bioconjugate Chem, doi:10.1021/bc0502457. 13 Fernandez CE, Mancera M, Holler E, Bou JJ, Galbis JA & Munoz-Guerra S (2005) Low-molecular-weight poly(a-methyl b,L-malate) of microbial origin: synthesis and crytallization. Macromol Biosci 5, 172–176. 14 Haindl M & Holler E (2005) The giant multinucleate plasmodium of Physarum polycephalum to study RNA interference in the myxomycete. Anal Biochem 342, 194– 199. 15 Willibald B, Bildl W, Lee B-S & Holler E (1999) Is b-poly(L-malate) synthesis catalysed by a combination of b-L-malyl-AMP-ligase and b-poly(L-malate) poly- merase. Eur J Biochem 269, 1085–1090. 16 Bernier F, Lemieux G & Pallotta D (1987) Gene families encode the major encystment-specific proteins of Physarum polycephalum plasmodia. Gene 59, 265– 277. 17 Baldauf SL, Roger AJ, Wenk-Siefert I & Doolittle WF (2004) A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290, 972–977. 18 Baldauf SL & Doolittle WF (1997) Origin and evolution of the slime molds (Mycetozoa). Proc Natl Acad Sci USA 94, 12007–12012. 19 Angerer B & Holler E (2005) Large complexes of b-poly(L-malate) with DNA polymerase a, histones, and other proteins in nuclei of growing plasmodia of Physarum polycephalum. Biochemistry 34, 14741– 14751. 20 Doerhoefer S, Khodyreva S, Safranov IV, Wlassoff WA, Anarbaev R, Lavrik OI & Holler E (1998) Mole- cular constituents of the replication apparatus in the plasmodium of Physarum polycephalum: identification by photoaffinity labelling. Microbiology 144, 3181–3193. 21 Chet I & Rush HP (1969) Induction of spherule forma- tion in Physarum polycephalum by polyols. J Bacteriol 100, 674–678. 22 Wistow G, Summers L & Blundell T (2005) Myxococcus xanthus spore coat protein S may have a similar struc- ture to vertebrate lens beta-gamma-crystallins. Nature 315, 771–773. 23 de Jong WW, Caspers GJ & Leunissen JAM (1998) Genealogy of the a crystallin-small heat shock protein superfamily. Int J Biol Macromol 22, 151–162. 24 Clout NJ, Kretschmar M, Jaenicker R & Slingsby C (2001) Crystal structure of the calcium-loaded spherulin 3a dimer sheds light on the evolution of the eye lens bc-crystallin domain fold. Structure 9, 115–124. 25 Rosinke B, Renner C, Mayr E, Jaenicke R & Holak T (1997) The solution structure of calcium loaded spheru- lin 3a. J Mol Biol 272, 1–11. 26 Gasslmaier B, Krell CM, Seebach D & Holler E (2000) Synthetic substrates and inhibitors of b-poly(L-malate) -hydrolase (polymalatase). Eur J Biochem 267, 5101– 5105. 27 Gasslmaier B & Holler E (1997) Specificity and direc- tion of depolymerization of b-poly(L-malate) catalysed by polymalatase from Physarum polycephalum. Fluores- cence labeling at the carboxy-terminus of b-poly (L-malate). Eur J Biochem 250, 308–314. 28 Dee J, Foxon JL, Roberts EM & Walker MH (1997) Contact with a solid substratum induces cysts in axenic cultures of Physarum polycephalum amoebae: mannitol induced detergent-resistent cells are not true cysts. Microbiology 143, 1059–1069. 29 Nygaard OP, Guttes S & Rush HP (1960) Nucleic acid metabolism in a slime mold with synchronous mitosis. Biochim Biophys Acta 38, 298–306. 30 Daniel FW & Baldwin HH (1964) Methods of culture for plasmodial myxomycetes. Meth Cell Physiol 1, 9–14. 31 Anderson R & Dee J (1990) Culture, development and genetics of physarum polycephalum – a practical manual. 9th European Physarum Conference. Leicester, UK. April 1990. 32 Diatchenko L, Lau VF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED et al. (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93, 6025– 6030. 33 Hamelin M, Adam L, Lemieux G & Pallotta D (1988) Expression of the three unlinked isocoding actin genes of Physarum polycephalum. DNA 7, 317–328. 34 Kroneder R, Cashmore AR & Marwan W (1999) Phytochrome-induced expression of lig1, a homologue of the fission yeast cell-cycle checkpoint gene hus1, is associated with the developemental switch in Cell type expression of spherulin 3b and polymalatase N. Pinchai et al. 1054 FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS Physarum polycephalum plasmodium. Curr Genet 36, 86–93. 35 Gettemans J, de Ville Y, Vandekerckhove J & Waelkens E (1993) Purification and partial amino acid sequence of actin-fragmin kinase from Physarum polycephalum. Eur J Biochem 214, 111–119. 36 T’Jampens D, Bailey J, Cook L, Constantin B, Van- deckerckhove J & Gettemans J (1999) Physarum amoebae express a distinct fragmin-like actin-binding protein that controls in vivo phosphorylation of actin by the actin-fragmin kinase. Eur J Biochem 265, 240–250. 37 Donze O & Picard D (2002) RNA interference in mam- malian cells using siRNAs synthesized with T7 RNA polymerase. Nucleic Acids Res 46, 1–4. 38 Bradford M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein util- izing the principle of protein-dye binding. Anal Biochem 72, 248–254. N. Pinchai et al. Cell type expression of spherulin 3b and polymalatase FEBS Journal 273 (2006) 1046–1055 ª 2006 The Authors Journal compilation ª 2006 FEBS 1055 . Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase Nadthanan Pinchai,. plasmo- dium -specific genes, which are involved in the synthesis of PMLA and ⁄ or its regulation, and to clarify whether the stage- specific expression of polymalatase