the morality of conflict resolution a critique of the state system and its management of sub national conflict
thoughts on the funding system, and its effects
... plains And what has been the issue of all these machinations and contrivances, of all this havoc and bloodshed, of this taxation and squandering, of this waste of treasure and of life? An age of ... detail all the complex transactions of twenty years of war and extravagance, nor to shew in each particular instance what has been the amount of waste and malversation; but the following statement, ... gardant, passant, or couchant, at the bidding of those who hold in their hand the golden talisman of the prophet The Garter and Clarencleux bear in mind that Adam `vas the first gentleman, and...
- 58
- 228
- 0
A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents
... Grammartical Structures of the equivalent translation The target language is English and the source Adjective Warm language is Vietnamese The data are classified into semantic and pragmatic features ... hyponym of animal 2.2.1.7 Semantic field The semantic structure of vocabulary of a language can be studied in a precise and systematic way by means of componential analysis of which the theory of ... have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Warm and its adjectives of temperature However, the adjective Warm is basically Vietnamese equivalents...
- 13
- 865
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... understand the pathway(s) and mechanism(s) involved in VBARP and its regulation apoptosis Discussion We identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1...
- 12
- 561
- 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... tissue and releasing pro-inflammatory agents Activated eosinophils, neutrophils, macrophages and lymphocytes increase in number at sites of inflammation and each are capable of modifying the overall ... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... and effective approaches to immunomodulatory therapy In an attempt to identify such new targets on inflammatory cells at sites of inflammation, we searched the Incyte EST database and found that...
- 14
- 540
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG ... pCarpNter Upper primer Lower primer CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
- 16
- 462
- 0
Alexey a zaslavsky, one property of the jerabek hyperbola and its corollaries
... Proof It suffices to apply homothety of center the centroid of ABC and coefficient − to the configuration of the previous claim Statement Let O, I be the circumcenter and incenter of ABC An arbitrary ... HYPERBOLA AND ITS COROLLARIES 55 Statement Let P be a point on the Euler line of ABC, A1 B1 C1 be the circumcevian triangle of P , and A2 , B2 , C2 be the reflections of A1 , B1 , C1 in the midpoints ... demonstrated the previous assertion and then to apply Ceva’s theorem Now let P be the point with barycentric coordinates (x : y : z) Using Lemma and Ceva’s theorem, we see that a point P has the...
- 4
- 347
- 1
Báo cáo y học: "The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions" docx
... (DCE) questionnaire, an approach that facilitates MDCA, and distributed this among 24 national health policymakers, 55 health professionals, and 163 general populations Third, our DCE analyses resulted ... it would lead to decisions that are considered fair and acceptable to stakeholders We agree with this point of view, and see much scope to integrate MCDA and A4 R The A4 R framework has been criticized ... International Center for Health Systems Research and Education (NICHE), Department of Primary and Community Care, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands 2Health...
- 3
- 276
- 0
Báo cáo y học: "orrection: The EVIDEM framework and its usefulness for priority setting across a broad range of health intervention" pdf
... Technology Assessment Program (HITAP), Ministry of Public Health, Nonthaburi, Thailand School of Public Health and Social Sciences-Muhimbili, University of Health and Social Sciences, Tanzania *Corresponding ... Center for Health Systems Research and Education (NICHE), Department of Primary and Community Care, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands Health Intervention and Technology ... Correction: The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions Sitaporn Youngkong1,2,*, Noor Tromp1, and Dereck Chitama1,3 Nijmegen International...
- 3
- 228
- 0
Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf
... emotional evaluation of internal stressors are fundamentally analyzed by the amygdala [34] Therefore the central nucleus of the lateral amygdala is involved in the coordination of stress behaviour and ... diagnosis and management of pain should endeavour to measure variables of the stress response to support rhetoric that their management approaches can manage chronic pain and disease by the application ... [6] Hypothalamic-Pituitary-Adrenal Axis (HPA Axis) The hypothalamo-pituitary-adrenocortical (HPA) axis plays a fundamental role in adaptation of the organism to homeostatic challenge, and should...
- 13
- 382
- 0
A new nodeling of the macpherson suspension system and its optimal pole placement control
... mass of passive, semi-active and active suspension systems, when the magnitude and the frequency of the road input are 0.01 m and Hz Compared to the passive system, both the semi-active and the ... disturbance and a control arm The car body is assumed to have only a vertical motion If the joint between the control arm and the car body is assumed to be a bushing and the mass of the control arm ... road, and to maintain the traction between the tire and the road The suspension systems are classified into passive and active systems according to the existence of a control input The active...
- 21
- 478
- 0
THE EFFECT OF EARNING, WORKING ENVIRONMENT, AND PROMOTION OPPORTUNITIES ON EMPLOYEES’ PERFORMANCE A COMPARISON BETWEEN THE STATE SECTOR AND OTHER SECTORS IN VIETNAM
... Cronbach’s Alpha and Coefficient: This was tested the Cronbach’s Alpha of each scale of each factor as well as the beta of the factor loading in the model Cronbach’s Alpha coefficient is a statistical ... determinants on employees’ performance and different impact on state employees and other employees 18 Using the SPSS to analyzing the data and make the data analyzing: 1- Testing reliability of scales ... income presence of attractive and competitive compensation system My company has transparent and equitable policy of salary Presence of salary that encourages better performance There are six questions...
- 65
- 540
- 1
A critical examination of the new economy and its impact on youth culture studies
... but rather as cultural narratives, serves to dramatise certain deeper conflicts of values and institutional agendas On the one hand, the popular representation of these youths as a desirable capitalist ... hours, and are prone to aggressively advancing their status or position in the social hierarchy At the same time, the sense of social and political power attached to the characteristic traits of ... our ability to appreciate and respond to, and even celebrate, what Foucault has previously identified as "what is said and what is done, rules imposed and reasons given, the planned and the taken-for-granted."...
- 275
- 443
- 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus
... Porculla (Duellman 1979; Duellman & Pramuk 1999) along the flanks of the Chinchipe, Chamaya, Huancabamba and Utcubamba rivers and tributaries (Regions Piura, Cajamarca, Amazonas) southwards along the ... 2004) The Huancabamba Depression in the Piura, Cajamarca, Amazonas and San Martin Regions is the major structural and physiographic break of the Andes consisting of a complex system of relatively ... The Herpetofauna of the Peruvian dry forest along the Andean valley of the Marañón River and its tributaries, with a focus on endemic iguanians, geckos and tegus Squamata: Iguanidae, Phyllodactylidae,...
- 264
- 492
- 0
The effect of earnings, working environment and promotion activities on employees performance a comparison between the state sector and other sectors in viet nam
... Cronbach’s Alpha and Coefficient: This was tested the Cronbach’s Alpha of each scale of each factor as well as the beta of the factor loading in the model Cronbach’s Alpha coefficient is a statistical ... determinants on employees’ performance and different impact on state employees and other employees 18 Using the SPSS to analyzing the data and make the data analyzing: 1- Testing reliability of scales ... income presence of attractive and competitive compensation system My company has transparent and equitable policy of salary Presence of salary that encourages better performance There are six questions...
- 62
- 569
- 0
The ‘performativity thesis’ and its critics: towards a political ontology of management accounting
... Economicus. On the other hand, in the case of the financial markets (Roberts and Jones, 2009) calculative agencies are distributed, and rarified transactions are framed inter alia on the basis of statements from finance theory. Overflows are obscured; this is portrayed as one of the reasons for ... Callon (1986) and Latour (2005) posit these agencies to be symmetrical; both humans and other‐than humans are symmetrical in the sense that they are both made to act by many others. The other‐than‐humans are not simply in the hands of humans. Others see humans and other‐than‐humans as interwined (Pickering 1995) or ... practitioners such as management consultants and accountants have spread the gospel of shareholder value as a next phase of succesfull business. And behind the management consultants lay the stern priesthood of the IMF laying out the terms of pure capitalism to ...
- 27
- 341
- 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... difluoride membranes and subjected them to analysis by the automatic Edman degradation method The sequence 1MALAASATIS-10 of native AsPPase was identical to that of the putative mature protein ... (O43187), Arabidopsis thaliana (AAC33503), Oryza sativa (AAC78101), Chlamydia pneumoniae (AAD19056), Chlamydia trachomatis (O84777), Mycoplasma pneumoniae (P75250), Mycoplasma genitalium (P47593), Bacillus ... by SDS/PAGE analysis The observed molecular mass of rAsPPase corresponded well to the calculated mass of the AdR44 cDNA (data not shown) The functional activity of the purified rAsPPase was determined...
- 13
- 691
- 0
Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc
... of Chlamydophila caviae also show a dual sites proportion of 15%, while the archeal genomes of Thermococcus kodakaraensis and Nanoarchaeum equitans show 17 and 20%, respectively These high ratios ... sequences from five of the groups and testing against the remaining group and a false data set The false data sets were created by dividing the remaining sequences in the ASTRAL data set (4701 sequences) ... Chlamydophila caviae (13 proteins), while in archaea the top and bottom is represented by Haloarcula marismortui (146 proteins) and Nanoarchaeum equitans (five proteins) The genomes of Oryza sativa and Xenopus...
- 8
- 481
- 0
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx
... was performed and analyzed at least twice and the reported values are the average of the two measurements with the associated standard deviation Acknowledgements Support for this research was ... for the enzymatic reduction of NADP Phosphite concentrations (labeled or unlabeled) were held at mM and the assay was started by the addition of lg of His6-tagged PTDH in each assay The data was ... cellular supply of cofactors, or the cofactors are regenerated in situ using a sacricial substrate Several reviews discuss the available methods and benets of regeneration of a number of cofactors [8,9,11,12]...
- 12
- 368
- 0
The Expedition of the Donner Party and its Tragic Fate pptx
... light-hearted good-bye, and as we approached the building of the American Tract Society, its agent came to our wagons and put into the hand of each child a New Testament, and gave to each adult a Bible, ... the leather of a pair of old boots and a pair of shoes which constituted their evening meal, and was the last of their effects available as food An extraordinary effort on the third day of the ... democratic and characteristically American A captain was chosen, and all plans of action and rules and regulations were proposed at a general assembly, and accepted or rejected by majority vote...
- 149
- 550
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25