the human endometrium is a highly dynamic tissue that is cyclically shed repaired regenerated and remodelled primarily under the orchestration of oestrogen and progesterone in preparation for embryo implantation humans are among the very f
... tool for therapeutic applications intissue engineering and cell and gene therapy Animal studies have shown that MPC implantation can repair critical bone fracture ina rat model of femoral segmental ... ATGAGAGCCCTCACACTCCTC Antisense: GCCGTAGAAGCGCCGATAGGC Adipose-specific genes LPL Sense: GAGATTTCTCTGTATGGCACC Antisense: CTGCAAATGAGACACTTTCTC PPARγ Sense: TGAATGTGAAGCCCATTGAA Antisense: CTGCAGTAGCTGCACGTGTT ... mediators Another challenging consideration forthe clinical use of MPCs and notably T-MPCs, which are isolated from tonsil tissue frequently infected and infused with inflammatory mediators, is...
... albumin The basal data are shown as the mean ± SEM for eight experiments ofthe ratio of each mRNA at h to that at the start ofthe incubation The effects ofthe albumin arethe mean ± SEM of ... hypoxia oftissue explants and accounted forthe increase in TNFa mRNA For reasons thatare unclear, they found a different time course for TNFa inthatthe maximal increase in TNFa mRNA was seen at ... cells and pieces oftissue containing insufficient fat cells to float Fat and nonfat cells were isolated by incubating 1.0 g of cut adipose tissuein ml of incubation medium containing 1.3 mg of...
... inoculation with live attenuated vaccine candidates [7] These are important facts in favor ofa live attenuated RSV vaccine administered intranasally The most challenging aspect of developing a live ... syncytia formation, while RSV G isthe putative attachment protein andis naturally expressed as a membrane-anchored anda secreted form [9] TheF protein is indispensable for virus replication and ... lesions was incorporated For each group the mean score of each histopathological parameter was calculated Since the scoring was non-linear, the histological data were analyzed by using the nonparametric...
... can learn and develop further 5)wise inthe handling of document • A good manager must know how inthe processing data Maybe managers are afraid of cumbersome paperwork but the manager also very ... an environment where new ideas can flow and flourish, follow some of these basic leadership and management practices 7)Information processing and thinking capacity • The power of your brain is ... flexibility and social knowledge and experience of managers The objective of this skill is to enhance mutual understanding and respect on the basis of identification and recognition ofthe values...
... following ISO standards to promote the role of leader as well as define the effect ofhuman resource in applying these standard In term of practical aspect, it studies real situation of maintaining ... with the characteristics ofthe products and services inthe organization According to ISO (International Organization for Standard) “Quality management system is defined as all activity ofthe ... challenging goals and targets Creating and sustaining shared values, fairness and ethical role models at all levels ofthe organization Establishing trust and eliminating fear Providing people with the...
... denotation and connotation ofthe word so that they can avoid making any loss of connotational meaning To that, they also need flexibility inthe use of words and not translate mechanically basing ... English and Vietnamese vocabulary to a level that they are capable of chosing the right word in any case to produce a natural translation It is crucial for translators to fully understand all the ... Management The history of HRM is said to have started in England inthe early 1880s during the craftsmen and apprenticeship era and further developed with the arrival ofthe industrial revolution in the...
... cause of corrective niaintenance costs arethe failures of transformers andare therefore dependent of substation layout Two types of indicators can be calculated for service continuity: average ... simplified, e g if the transition rates ofthe repair processes are independent ofthe size ofthe area affected b) the diwrbance the size ofthe model can bs reduced by aggregating the states In ... Results indicate thatthe probability of substation connection f u x t i o n s being unavailable arethe main affected factors as well as the costs incurred as a result of this unavailability The...
... material The following supplementary material is available online: Fig S1 Regulation ofhuman Cdc45 protein during terminal differentiation This material is available as part ofthe online article ... depicted ina graph Half-life of Cdc45 protein and number of Cdc45 molecules in proliferating human cells Inhuman cells, the half-life of Cdc6 isvery short, whereas thatof Mcm3 is significantly ... imaging software v 3.0 Acknowledgements We thank A Schneider and J Fuchs for excellent technical assistance We are indebted to N Baum and B Schlott for performing the MA analysis This work was...
... cell lines To further analyze the effects of hypoxia on the expression of HO-1 and HO-2, we performed similar analyses in two human cancer cell lines, HeLa cervical cancer and HepG2 hepatoma cells ... contained RNA prepared from untreated cells harvested just before starting the experiment At the bottom of each panel, 28S rRNA of each sample was visualized by ethidium bromide staining The data ... number AAG09721) are located adjacently ina head-to-head orientation, and their transcription start sites are 1.5 kb apart We therefore analyzed the promoter function ofthe 1.5 kb 5¢-flanking...
... possesses the same characteristics ofthe interior ofthe protein matrix The script aisthe peak–peak distance between the maximum at %287 nm andthe minimum at %283 nm, andthe script b isthe peak–peak ... of amphipathic residues is shown, with the non-polar residues forming one ofthe faces ofthe helices (Fig 4B) This distribution favours a parallel packing ofthe four a- helices, supporting the ... rotamer normality correspond to Z-scores and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the...
... listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, ... means thatthe removal ofthe L-arabinose residues from the galactomannan oligosaccharides is caused by traces of an enzyme inthe b-1,4endogalactanase preparationthatis not active against the ... oligosaccharide formation was analyzed by HPAEC and MALDI-TOF MS HPAEC analysis demonstrated that already after 15 the formation of tetramers, trimers, dimers and monomers of D-galactose was visible for...
... on whether or not the property thatisthe denotation of "talk" isinthe set of properties that John has THE FIRST MECHANISM - EXTERNAL MANAGEMENT The mechanism that evaluates a formula with ... them and thus introduce an inconsistency The presence of intensional substitution failure is one ofthe important tests ofa theory of propositional attitudes This mechanism isa correlate ofthat ... second mechanism for maintaining the correctness ofthe denotations of ~-expressions basically involves incorporating the table from the first mechanism into the model In effect, the R-expressions...