0

the good type designer therefore realizes that for a new font to be successful it has to be so good that only very few recognize its novelty

101 Trích dẫn hay về thiết kế

101 Trích dẫn hay về thiết kế

Tư liệu khác

... conservative reader The good type- designer therefore realizes that, for a new font to be successful, it has to be so good that only very few recognize its novelty — Stanley Morrison Great design ... http://www.kmf-branding.com.vn/ The designer has a passion for doing something that fits somebody’s needs, but that is not just a simple fix The designer has a dream that goes beyond what exists, rather than fixing what ... just made something that wasn’t there before — Neil Gaiman Every act of creation is first an act of destruction — Pablo Picasso Design is a plan for arranging elements in such a way as best to accomplish...
  • 19
  • 534
  • 2
Gà Tò!  An mỹ Quỳnh phụ Thái bình

Gà Tò! An mỹ Quỳnh phụ Thái bình

Tư liệu khác

... loại gà ta bán 60.000đ/kg mà thôi”, anh Cảnh cho biết Mỗi lần, gà đẻ 14 - 15 trứng Sau cho ấp nuôi thời gian, anh Cảnh chọn 2- ưng ý, to đẹp đàn nuôi riêng để tiếp tục lai tạo, số lại mang hủy ... trưng gà ch a cao, to lắm” Bắt gà lên, anh bảo, đặc trưng gà có lông suốt từ khuỷu chân xuống, gọi “lông quần” Ph a sau gối gà trống có thêm chòm lông đuôi quạ, gọi “lông gối” Anh khẳng định ... Quốc gia tiến hành kiểm định kết luận: Gà vật nuôi quý hiếm, nằm danh mục bảo tồn nguồn gene quốc gia V a qua, huyện Quỳnh Phụ triển khai đề tài “Xây dựng mô hình tuyển chọn nuôi gà xã An Mỹ”...
  • 6
  • 1,025
  • 2
Configure Routing between the RSM and an External Router Connected to an ISP

Configure Routing between the RSM and an External Router Connected to an ISP

Quản trị mạng

... explain the details as we did in the last lab Cable the lab as shown in the diagram The first device to be configured will be the distribution layer switch DLSwitch Access the switch through the ... access layer switch ALSwitch Switch#show vlan Switch#show vtp stat Clear your NVRAM and reload Switch#clear start Switch#reload Now check VLAN and VTP information again Switch#show vlan Switch#show ... lets take care of the DLRouter Now that we have the VLAN information for VLAN configured on the DLSwitch We simply need to add it to the DLRouter PortChannel to participate in the Inter-VLAN Routing...
  • 13
  • 374
  • 0
Connecting to an Access Databasefrom ASP.NET

Connecting to an Access Databasefrom ASP.NET

Quản trị mạng

... files The user account requires permissions to access the share that contains the database file and folders The user account must be recognized by the Access computer For a domain user account, add ... add it to the permissions list on both computers For a user account local to the IIS computer, create a duplicate account on the Access computer with the same name and password Grant the user account ... the TEMP folder Ensure that the TEMP and TMP environment variables are properly configured Configure the Access server On the Access computer, the user account that is used to access the database...
  • 2
  • 359
  • 0
Tài liệu Converting a DataSet to an ADO Recordset docx

Tài liệu Converting a DataSet to an ADO Recordset docx

Kỹ thuật lập trình

... document and the results are output to an XmlReader The style sheet transforms the XML format for the data in the DataSet to the format required for the ADO XML data section The namespace declarations ... Indicates whether the column can contain a null value Having defined the schema inline, the solution loads the Orders table into a DataSet The MappingType is set so that the column values are written ... Cursor.Current = Cursors.Default; return; } try { // Load the ADO recordset into a DataTable OleDbDataAdapter oleDa = new OleDbDataAdapter( ); DataTable dt = new DataTable("Orders"); oleDa.Fill(dt,...
  • 15
  • 390
  • 0
Tài liệu Connecting to an ODBC Data Source ppt

Tài liệu Connecting to an ODBC Data Source ppt

Kỹ thuật lập trình

... to establish the connection to the data source The connection string format closely matches the ODBC connection string format Additionally, you can specify an ODBC data source name (DSN) or file ... Reference within MSDN Library Visual Studio also supports creating ODBC data source connections visually: • • Create a data connection in Server Explorer and drag it onto a form or design surface Configure ... the OdbcConnection object that appears in the component tray Drag an OdbcConnection from the Data tab of the Toolbox onto a form or design surface Configure the ConnectionString property in the...
  • 3
  • 495
  • 0
Tài liệu Connecting to an Oracle Database docx

Tài liệu Connecting to an Oracle Database docx

Kỹ thuật lập trình

... because they are built specifically for the database and because they remove a layer of indirection from the application to the database OLE DB You can use the OLE DB NET data provider with the ... TNSNAMES.ORA to locate the Oracle database and determine how to connect to it based on the Data Source or Database attribute in the connection string An example of an entry in the TNSNAMES.ORA ... Oracle8 Release 8.0 or later and requires the Oracle9i Client Release (9.2) or later Here are desciptions of available managed providers: • Oracle has released a NET data provider It is available...
  • 5
  • 418
  • 0
Tài liệu Edit Data and Update Changes That Are Made to an ADO.NET pdf

Tài liệu Edit Data and Update Changes That Are Made to an ADO.NET pdf

Cơ sở dữ liệu

... command for the DataAdapter object The DataAdapter Update method is called to update the dataset with the data changed and then the AcceptChanges of the DataSet object This accepts all the changes ... Caption Contact Label Caption Contact Title Button Label Caption Address Label Caption City Label Caption Region Label Caption Country Label Caption Phone Label Caption Fax TextBox Name txtCustomerID ... Create the LoadList routine by entering the following code into the form you created for this How -To This code creates and fills a data table using a data adapter The string that the data adapter...
  • 10
  • 400
  • 0
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

Kỹ thuật lập trình

... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... two-dimensional array This solution presents an ADO.NET method, which is also called GetRows( ), that duplicates the functionality of the ADO GetRows( ) method The prototype for the ADO.NET method ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...
  • 5
  • 309
  • 0
Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc

Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc

Báo cáo khoa học

... preparations are not equal, and shows that the differences between them might be large enough to be clinically relevant The possibility that nonspecific aggregation of IgG on surface-adsorbed antigens ... structure, and in the acquisition of enhanced antigen recognition behavior and new biological activities Our data show that the changes fall short of denaturation of the immunoglobulin molecules The main ... using the mouse monoclonal Z2 antibody, which behaves in its native form as a typical monoreactive antibody, as it interacts only with mouse IgG 2a [14] The interaction of the native Z2 antibody with...
  • 12
  • 620
  • 0
Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Báo cáo khoa học

... active site and rearrangement of the main chain and side chains in the active site appear as key players in a slow transformation from an inactive to an active enzyme dTTP inhibition may then be achieved ... as also expected from the crystallographic analysis of the wild -type: dTTP described Therefore, the lack of activity of H12 1A and the structural similarity between the H12 1A: dCTP and the E13 8A: dTTP ... reasonable to expect these two events to be associated but the structural change that mediates the communication between the two regions appears to be very subtle Based on the observations described above,...
  • 11
  • 577
  • 0
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

Báo cáo khoa học

... Statistical analysis All data were analyzed using stata 7.0 statistical software (Systat Software Inc., San Jose, CA, USA) The OD of the immunoreactivity is represented as means ± SEM Oneway ANOVA ... Gram-negative bacteria, and its recognition and signal transmission are key events in the host defense reaction towards Gram-negative bacteria Generally, LPS activates monocytes and macrophages to ... al., which showed that phorbol ester and TNF -a induced ICAM-1 expression via activation of the JNK pathway and activator protein-1 [45], the present research suggests that the JNK pathway also...
  • 11
  • 519
  • 0
Wind tunnel and propulsion test facilities supporting analyses to an assessment of nasa docx

Wind tunnel and propulsion test facilities supporting analyses to an assessment of nasa docx

Khoa học xã hội

... by the nation, identifying the primary NASA facility (when available) for each type of needed facility and NASA facilities considered backups to these primary facilities Note that some capabilities ... important to note that the $125–130 million annual operating budgets for all NASA WT/PT facilities under study pale in significance to the national aerospace capabilities that they partially enable, ... advisers and consultants to help analyze the data received and to augment the information based on their own expertise with various national and international facilities In addition, the analysis...
  • 164
  • 425
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

Báo cáo khoa học

... performance However, in the character tagging formulation, word-based features are non-local To incorporate these non-local features and make the search tractable, various efforts have been made ... as character tagging Considering the ambiguity problem that a Chinese character may appear in any relative position in a word and the out-of-vocabulary (OOV) problem that it is impossible to observe ... from to 1, the tagger (beam=1) is times faster but tagging accuracy is badly hurt In contrast, when searching in a constrained space rather than the raw space, the constrained tagger (beam=5)...
  • 9
  • 425
  • 0
Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot

Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot

Báo cáo khoa học

... [17] An additional purification step of hydroxylapatite column chromatography was performed essentially as described by Bernardi [18] The preparations, at °C, were loaded on to a hydroxylapatite ... increase the activity of the Leu178 mutant carboxypeptidase Y toward substrates with the basic P1 side chains [21] It was assumed that the lack of a side chain at position 341 would make the S1 ... endonucleases and T4 polynucleotide kinase were purchased from Toyobo, Osaka, Japan The TransformerTM sitedirected mutagenesis kit was purchased from Clontech, Palo Alto, CA, USA The Taq dyedeoxyTM...
  • 6
  • 459
  • 0
Wind Tunnel and Propulsion Test Facilities - Supporting Analyses to an Assessment of NASA pot

Wind Tunnel and Propulsion Test Facilities - Supporting Analyses to an Assessment of NASA pot

Khoa học xã hội

... by the nation, identifying the primary NASA facility (when available) for each type of needed facility and NASA facilities considered backups to these primary facilities Note that some capabilities ... important to note that the $125–130 million annual operating budgets for all NASA WT/PT facilities under study pale in significance to the national aerospace capabilities that they partially enable, ... advisers and consultants to help analyze the data received and to augment the information based on their own expertise with various national and international facilities In addition, the analysis...
  • 164
  • 425
  • 0
One Year to an Organized Life doc

One Year to an Organized Life doc

Tâm lý - Nghệ thuật sống

... January’s habit, therefore, is to make your bed every day An unmade bed signals that there is no end to your day; you are dragging the activities, emotions, and energy of one day into the next without ... and your personality That s the key to success with any calendar system All paper calendar companies have holders for the pages and whatever other inserts you purchase (A calendar insert is a ... need to take now to see this goal as part of the reality of your life rather than a dream? What stands in your way? Have you done anything yet to make this a reality? Nope It has stayed in the...
  • 303
  • 248
  • 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học

... desA-5 desA-3 desD-5 desD-3 Pf GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG ... found for the mutant with aac(3)IV fragment (935 bp) as probe, as expected Hybridization and PCR analysis results indicate that the desA gene has been deleted and replaced by the apramycin resistance ... DdesA mutant is apramycin resistant, the kanamycin resistance marker was cloned into an XbaI site of the new construct (pSKdesA) A 5723-bp XhoI + NotI fragment containing the desA gene and kanamycin...
  • 13
  • 456
  • 0
Báo cáo khoa học: The retinoid-X receptor ortholog, ultraspiracle, binds with nanomolar affinity to an endogenous morphogenetic ligand pptx

Báo cáo khoa học: The retinoid-X receptor ortholog, ultraspiracle, binds with nanomolar affinity to an endogenous morphogenetic ligand pptx

Báo cáo khoa học

... the receptor for the synthetic ligand compared with the natural ligand For example, in an effort to identify ligands that would distinguish between RARa and RARc, it was noted that the methionine ... III that both moves its USP-binding activity back toward that of JH III and confers on it a biological activity similar to that of JH III That is, JH I also possesses the same conversion of the ... pathway, this study analyzed both natural and synthetic variations of the farnesoid scaffold We report the identification of a natural farnesoid product of the ring gland with affinity for USP comparable...
  • 14
  • 199
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008