steatosis fibrosis and cirrhosis in hepatitis c virus infected patients using unidimensional transient elastography fibroscan®
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG...
- 15
- 597
- 0
Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx
... chronic hepatitis C patients infected with genotype and can clear the virus infection, while only 50% in patients infected with genotype [17,18] show a sustained virological response This clinical ... twice in PBS Radioactivity (cpm) of each cell pellet was measured The amount of interferon specifically bound was determined by subtracting non-specific binding from total binding Specific binding ... contribution in the mechanism of IFN-resistance, HCV replication was eliminated from each cell line by treatment with Cyclosporine-A The success of Cyclosporine-A treatment and absence of HCV RNA in these...
- 13
- 305
- 0
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx
... B A HCVcc in culture medium HCVcc in culture medium RT 37° C Log 10 FFU/ml Log 10 FFU/ml 4 3 1 0 16 24 32 40 48 10 12 14 16 Days Hours D C HCVcc in culture medium HCVcc in human serum 4 C RT ... on HCVcc infectivity * 0 10 15 20 25 30 35 40 Minutes HCVcc in culture medium B 65 C Log 10FFU/ml 60 C 0 Minutes C HCVcc in human serum Log 10 FFU/ml 56 C 0 10 20 Minutes 30 40 D HCVcc in human ... respectively, could reduce HCVcc infectivity from 4.1 × 104 FFU/ml to undetectable levels (Table 1) At these concentrations both aldehydes were also effective in inactivating HCVcc in the presence...
- 12
- 411
- 0
Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot
... forward primer (5Â-TCCCGTGTGTCAAGACGCTCTTGAAT-3Â) or H528S forward primer (5Â-TCCCGTGTGTCAAGACTCTCTTG AAT-3Â) and reverse primer (5Â-AGTCCCGGGGTGTT CATGTATGCTC-3Â) Each PCR vial contained 50 ng of ... Healthcare) PCR Mutations in the helicase domain of the previously used gene construct for full-length HCV NS3 [9] were introduced by PCR using Q526A forward primer (5Â-TCCCGTGTGT GCAGACCATCTTGAAT-3Â), ... Network of Excellence References De Francesco R & Migliaccio G (2005) Challenges and successes in developing new therapies for hepatitis C Nature 436, 953960 Frick DN (2007) The hepatitis C virus NS3...
- 8
- 308
- 0
Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot
... gtc ttc acg cag cac tcg caa cca ccc tat cag act gtc ttc acg cag aag cgt cta gcc at cga gac ctc ccg ggg cac tcg caa gca ccc acg cag aaa gcg tct agc cat ggc gtt agt tcc cgg ggc act cgc aag cac cct ... HCV 10.2 HCV HCV HCV HCV HutLA2 positive positive positive positive negative negative negative negative positive gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act ... CIMM-HIV cell culture supernatants from different cell lines (HCV infected B-cells, HCV infected human neuronal precursor T and M cells), or commercial antigens (NS4 and Core antigen), or uninfected...
- 17
- 479
- 0
Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf
... M1LE HCV-N MD1-0 274933RU HCV-S1 HCV-TR1 HCV-A HCV-AD78 HCV-AD78P1 NC1 HCR6 HCV-S AY587016 N589 HC -C2 JT J33 HPCPP HCV-K1-R1 HCV-K1-R2 HCV-K1-R3 HCV-K1-S1 HCV-K1-S3 HCV-K1-S2 HCV-JS D89815 HCV-J ... identified in Saint Petersburg (Russia) [29,30] Phylogenetic analyses of HCV strains circulating in Peru, demonstrated the existence of natural intra-genotypic HCV recombinant strains (1a/1b) circulating ... type and in nature Virology 1990, 174:479-493 Becher P, Orlich M, Thiel H-J: RNA recombination between persisting pestivirus and a vaccine strain: generation of cytopathogenic virus and induction...
- 8
- 247
- 0
Báo cáo khoa học: "Evidence of recombination in Hepatitis C Virus populations infecting a hemophiliac patient" pdf
... presence of a natural intragenotypic HCV recombinant strain circulating in a Uruguayan hemophiliac patient Results To gain insight into the genetic variability of HCV strains circulating in Uruguayan ... existence of at least six major genetic groups and an increasing number of subtypes [1,6-8] Since hemophiliacs were infected by clotting factors concentrates manufactured from many thousands of ... role of recombination in shaping the HCV evolution in hemophiliac patients, we have performed a phylogenetic analysis of HCV strains circulating in Uruguayan patients with clinical diagnosis...
- 9
- 171
- 0
Báo cáo sinh học: " Serum levels of preS antigen (HBpreSAg) in chronic hepatitis B virus infected patients" potx
... mammalian cell-derived recombinant hepatitis B vaccine containing pre-S1 and pre-S2 antigens as compared with conventional yeast-derived vaccines Vaccine 1994, 12(15):1453-1459 Shouval D: Hepatitis ... and high DNA copies (>104-105 copies/ml) hepatitis B is increasing, especially in Asia and Southern Europe[7], and many cases of these patients relapsed and caused liver cirrhosis and hepatocellular ... exhibited a sharp increase of HBpreSAg binding to polyclonal anti-preS (black circle) before HBsAg could bring any interference based on the absorbance measurements using recombinant S protein Thus when...
- 11
- 540
- 0
Báo cáo y học: "Formulation preference, tolerability and quality of life assessment following a switch from lopinavir/ritonavir soft gel capsule to tablet in human immunodeficiency virus-infected patients" pot
... activity against wild-type and resistant HIVstrains [4,5] In clinical practice, it is extensively used in treatment naïve and treatment experienced patients, and it is a recommended first-line ... baseline, demographic and clinical laboratory data including fasting lipid profile, plasma HIV-1 RNA level, and CD4+ T-cell counts were obtained QoL was assessed by MOS HIV Health Survey, and ... the scale has a minimum of (best BHS outcome) and a maximum of (worst BHS outcome) Subjects' change in stool consistency, volume, presence of blood, and frequency was compared Analytic approach...
- 7
- 272
- 0
Báo cáo y học: " An overview of treatment response rates to various anti-viral drugs in Pakistani Hepatitis B Virus infected patients" doc
... HBV and HDV co-infection using lamivudine J Ayub Med Coll Abbottabad 2009, 21:1-3 20 Zuberi BF, Afsar S, Quraishy MS: Triple Hepatitis: Frequency and Treatment Outcome of co/super-Infection of Hepatitis ... to fully describe the treatment response and the risk factors of the currently recommended therapies against HBV infection especially combination therapy of interferon and lamivudine in Pakistani ... asymptomatic carrier residents and their clinical characteristics during long-term follow-up: the relevance to changes in the HBeAg/anti-HBe system Hepatol Res 2002, 24:1 Westland C, Delaney...
- 4
- 342
- 0
Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"
... non-alcoholic steatohepatitis and certainly in our patients with HCV and metabolic steatosis HCV-Induced Steatosis The presence of steatosis on liver biopsy in patients with hepatitis C is more ... metabolic steatosis and both of their effects on fibrosis progression in patients with HCV Int J Med Sci 2006, Conclusion All in all, there is a clinically significant relationship between HCV infection ... cryptogenic cirrhosis JAMA 2003;289(22):3000-4 Scheen AJ, Luyckx FH Nonalcoholic steatohepatitis and insulin resistance: interface between gastroenterologists and endocrinologists Acta Clin Belg...
- 4
- 438
- 0
Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot
... two infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis epidemics in Africa and Influence of maternal (HIV) co-infection ... prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the statistical analysis and procedures, MAE participated in the analysis, IA coordinated ... http://www.virologyj.com/content/4/1/104 mangers and health planners, so as to initiate the relevant vaccine and screening packages in the antenatal care clinics While, much data exist about the...
- 3
- 399
- 0
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx
... act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc ... Reference HCV HCV HCV HCV HIV HIV HIV HHV-6 HHV-6 HCV 9.1 HCV 9.2 HCV 10.1 HCV 10.2 Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act ... the commonly observed cytopathic effects in triply -infected CEM cells Large cells are seen with increasing frequency in infected cultures The triply infected CEM cells were observed by light microscopy...
- 8
- 410
- 0
Báo cáo hóa học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" doc
... two infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis epidemics in Africa and Influence of maternal (HIV) co-infection ... prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the statistical analysis and procedures, MAE participated in the analysis, IA coordinated ... http://www.virologyj.com/content/4/1/104 mangers and health planners, so as to initiate the relevant vaccine and screening packages in the antenatal care clinics While, much data exist about the...
- 3
- 353
- 0
Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx
... act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc ... Reference HCV HCV HCV HCV HIV HIV HIV HHV-6 HHV-6 HCV 9.1 HCV 9.2 HCV 10.1 HCV 10.2 Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act ... the commonly observed cytopathic effects in triply -infected CEM cells Large cells are seen with increasing frequency in infected cultures The triply infected CEM cells were observed by light microscopy...
- 8
- 446
- 0
Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx
... infectious and replicating HCV The variety of HCV RNA in patients could result from changes induced in the plasma/sera, including the production of noninfectious viruses We have drawn these conclusions ... such as cirrhosis and hepatocellular carcinoma, but this may be due to proteins produced in situ in the liver or by cells circulating in the blood Recently developing information suggests HCV ... of cells that produce HCV found in circulation and may, in turn, infect other cell types We have previously reported that other cell types also get infected and produce HCV to varying levels and...
- 15
- 340
- 0
Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI pdf
... vitamin D metabolites and their binding protein in patients with liver cirrhosis J Clin Endocrinol Metab 1984, 59:86-89 26 Lee WM, Galbraith RM: The extracellular actin-scavenger system and actin ... Moreover removing albumin protein would remove albumin-binding proteins in the same time and influence the reproducibility After the protein matching and statistics calculation with DeCyder 6.5 software, ... reducing plasmin and kallikrein In inflammatory or injured liver, the increase of A2M inhibit catabolism of matrix proteins and thus cause liver fibrosis [17-20] Gangadharan B et al indicated...
- 7
- 253
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25