steady state gain of a second order system

... the GAL systems of K lactis and S cerevisiae are as follows: (a) the autoregulation of transcriptional activator KlGal4p; (b) the dual role of KlGal1p as a metabolizing enzyme as well as a galactose-sensing ... 100 KlGal4pt (μM) 101 Fig (A) Time course of fractional b-galactosidase expression in a mutant strain lacking KlGAL80 A typical fed-batch operation aimed at maintaining an average steady- state glucose ... FEBS V R Pannala et al were tabulated as the steady- state fractional protein expressed at different average steady- state glucose ⁄ galactose concentrations Substrate and enzyme activity measurements...

Ngày tải lên: 29/03/2014, 09:20

Ngày tải lên: 21/06/2014, 02:20

Ngày tải lên: 22/06/2014, 22:20

... namely doubly asymptotic solutions, play an important role in the study of various models of continuous dynamical systems and frequently have tremendous effects on the dynamics of nonlinear systems ... existence of non-trivial periodic solutions for asymptotically superquadratic and subquadratic system (1.1) when A = Ma and Guo [17, 18] gave results on existence of homoclinic solutions for similar system ... proofs of our Theorems 1.1 and 1.2 in Section Variational structure and preliminary results In this section, we are going to establish suitable variational structure of (1.1) and give some lemmas...

Ngày tải lên: 18/06/2014, 22:20

Ngày tải lên: 20/06/2014, 04:20

Ngày tải lên: 20/06/2014, 21:20

Ngày tải lên: 20/06/2014, 22:20

Ngày tải lên: 22/06/2014, 19:20

Ngày tải lên: 22/06/2014, 19:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 22/06/2014, 22:20

... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager is ... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt...

Ngày tải lên: 12/09/2012, 15:05

... use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... evaluation of Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents ... relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[51] Additionally, preclinical data suggest...

Ngày tải lên: 26/10/2012, 09:07

... of a DC motor Standard data that are given for a DC motor on its nameplate are so-called rated values of output power, armature voltage and current, excitation voltage and current, and speed of ... and equal to rated Mechanical losses and iron core losses can be neglected and armature voltage is constant and equal to rated Calculate rated torque and rated power of the machine whose data ... the two calculated points Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...

Ngày tải lên: 17/12/2013, 14:15

... the values of kcat,1 and kcat,2, the maximal GTP activation of uncoupled glutamine hydrolysis was about 14-fold (Table 2) At UTP and ATP concentrations of mM each, a 49-fold increase in kcat was ... data from the activation of CTP synthesis or glutaminase activity by GTP as measured spectrophotometrically was analysed using v ẳ kcat;1 ẵE ỵ kcat;2 ẵE A KA ỵ A 6ị where kcat,1 and kcat,2 are ... in Table 1, and those obtained for the glutaminase reaction in the presence of 0.1 mM each of UTP and ATP-cS (data not shown) Apparently, the value of Ka, kcat,1 and kcat,2 were similar regardless...

Ngày tải lên: 21/02/2014, 15:20

... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr ... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc...

Ngày tải lên: 08/03/2014, 08:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference on Very Large Databases(VWB), ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query...

Ngày tải lên: 16/03/2014, 16:20

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the ... infinitival phrases in place of deverbal nominal constructions Apart from this difference, the major textual characteristics carry over from source to target sublanguage thereby facilitating mechanical...

Ngày tải lên: 17/03/2014, 19:21