steady state output of a system
Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx
... per-formance of the GAL system. As KlGal1p plays a dualrole, as both inducer and galactokinase, our analysisindicates that only 10% of total KlGal1p translocatesinto the nucleus to act as inducer, ... used a steady- state modeling approach to quan-tify the underlying molecular mechanism for the GAL system of K. lactis and to obtain a systems’ levelunderstanding of its behavior. The steady- state ... GAL system of K. lactis was validated experi-mentally by obtaining steady- state protein expressionlevels in a wild-type strain and in a mutant strain lack-ing gene KlGAL80. The steady- state...
- 16
- 371
- 0
Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc
... (M1), a microphone pre-amplifier (Amp. B) andan analog-to-digital converter (A/ D) of the input /output card.The recorded digital data were stored in a file on a hard disk that could be read by ... been of interest withregard to the fact that practical systems have a limiteddynamic range. However, the synthesis of test signalsthat allow enforcing a signal feature like modulation hasonly ... based on digital signal processing and thusassume that test stimuli and the output signal of the system under test are available as digital waveforms, asshowninFigure2whereonedigitalwaveformx entersthe...
- 20
- 415
- 0
Tài liệu Steady State Operation of DC Machines pptx
... RVkIRkITIVRVkIRkITaaafaaaafaefafaf a af a fefn fn fanfn a fne=+ = +ị=== ===()()22If both voltages have rated values then(13)Speed-torque characteristic, with rated voltages applied ... can be neglected and armature voltage is constant and equalto rated. Calculate rated torque and rated power of the machine whose data are given.If the motor now drives a load such that the armature ... the two calculated points.Solution:Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
- 12
- 527
- 1
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt
... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically. The ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Kitts and Nevis, St. Lucia, St....
- 35
- 481
- 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... obtainedfor the glutaminase reaction in the presence of 0.1 mMeach of UTP and ATP-cS (data not shown). Apparently, thevalue of K a , kcat,1and kcat,2were similar regardless of theactive ... glutaminase activity of L. lactis CTP synthase. (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing substrateconcentrations measured as ... hydrolyze glutamine at a steady- state rate similar to the rate of GTP-activatedCTP synthesis, if the enzyme was incubated in thepresence of GTP, UTP and the nonhydrolyzable ATPanalog ADPNP [8]....
- 8
- 698
- 0
Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx
... Treebank, produce syntacticparse trees with bare phrase labels, such as NP, PP,S, although the training corpora are usually muchricher and often contain additional grammatical andsemantic ... is desirable to have parsers produce gram-matically and semantically rich output. Second, tofacilitate dependency-based comparison and evalu-ation of different parsers, their outputs may need ... given an occur-rence of a pattern and the features of all the nodesinvolved. We trained a separate classifier for eachpattern.For evaluation purposes we extracted all occur-rences of the patterns...
- 8
- 379
- 0
Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot
... larger capacity andlabor saving requirement of a paper making machine follows a continuous beating machine, that is a rifiner. The types of a refiner are a conical type, a drum type and a disc ... when a great amount of this high-temperature exhaustgas is cooled by the heat exchanger. At the same time, the heat contained in the gas can berecovered as hot water. Scales and pulps are attached ... is decreased by increasing the differential pressure of theexhaust gas.Pulps are attached to the jet condenser which absorbs a great amount of gasand the thermal accumulator. Pulps also enter...
- 45
- 1,421
- 0
Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx
... must all agree in their output. A careful analysis also shows that Church's allophonic parser, in his actual implementation using matrix operations to simulate bottom up chart parsing, can ... assimilation) are seen as variants of an elementary unification operation over feature tapes (linear unification phonology, LUP). The phenomena analysed are tone terracing with tone-spreading ... languages and suitable formal models for it. The languages investigated are Tern (Gur/Voltaic family, Togo) and Baule (Akan fami- ly, C6te d'Ivoire). Tone languages of other types, in particular...
- 7
- 333
- 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc
... TGAGGAGGGACAAAACCTTGAA 700Reverse TCGGTCACTGCCAGCATTC 700Probe CCAACCACTATATTACACCAATGATGGAGCTGAA 100RanGTPaseS83456 Forward CAACAAAGTGGATATTAAAGACAGGAAAG 300Reverse TGGCAGAAATGTCATAGTACTGAAGATT ... CTCTATGTCGCACCACTGATAACCTGAGACCTT 150Cks2NM_025415 Forward CCGAAGAGGAGTGGAGGAGACT 700Reverse ATATGCGGTTCTGGCTCATGA 700Probe CATGTAATGAACCCATCCTAGACTCTGTTGGACA 150RanBP1NM_011239 Forward TGAGGAGGGACAAAACCTTGAA ... TCCTCACAGACCTCCAGCATCCAGGT 100Cyclin D2NM_009829 Forward CGTACATGCGCAGGATGGT 700Reverse AATTCATGGCCAGAGGAAAGAC 300Probe TTTGTTCCTCACAGACCTCTAGCATCCAGGT 100Cyclin D3NM_007632 Forward AAAGGAGATCAAGCCGCACAT...
- 13
- 338
- 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
... structures andinteractions of feedback loops, and consists of variablesfor cause and effect, and causal links. A causal link con-nects a cause variable with an effect variable by a linkwith a positive ... 2000.16. Mable A, Marriott J: Steady State. Finding a Sustainable Balance PointInternational Review of Health Workforce Planning Health Human ResourcesStrategies Division. Health Canada; 2001.17. ... num-ber of simulation steps along the time axis. System Dynamics makes extensive use of diagrams,especially of two types: causal loop, and stock and flow.Causal loop A causal-loop diagram identifies...
- 9
- 543
- 1
Simulation of a Multiple Input Multiple Output (MIMO) wireless system
... contains all of the data about rays propagating from a base station to a field point. Each field point has a ray list associated with it. A ray list is defined by the class ‘ray_list.hh’ and ... originally developed for applications in radar and sonar systems. Using multiple antennas introduces spatial diversity into the system. These antennas are also known as ‘smart antennas’. Spatial ... it is passed a particular base station, an image and its order, and also the field point. As seen earlier a ray is made up of nodes, two of these nodes are always the base station and the field...
- 73
- 459
- 1
Reliability analysis of a power system based on the multi state system theory
... power system and the batteries are binary, but they are all multi -state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. ... than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached. ... Reliability Analysis of a Power System Based on the Multi -State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha,...
- 4
- 407
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... of galactose signal transduction (Eur. J. Biochem. 271) 4073 A steady- state modeling approach to validate anin vivomechanism of the GAL regulatory network inSaccharomyces cerevisiaeMalkhey ... detail ed mechanisms include thetryptophan and arabinose systems of Escherichia coli andthe phage lambda switch in bacteriophage.The GAL regulatory network in Saccharomyces cerevis-iae is a ... mechanism was based on comparingthe input (galactose concentration) output (fractional pro-tein expression) steady- state responses for the candidatemodels with experimental data reported and...
- 11
- 490
- 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... orcan result in cleavage of the inhibitor and release of activeenzyme. A decreased overall inhibition rate can thus be theresult of a shift of the rate constants of the branched part of mechanism, ... rate at which TPdisappears in time at steady state after the rapid initialincrease. The pronounced biphasic character of the inhibi-tion profiles in Fig. 1A C is explained by the presteady state and ... of this interaction is an inactivation of the PAI-1 pool in thevascular wall by thrombin, making it no longer availablefor interaction with u-PA and VN, which can explain part of the effect of thrombin...
- 10
- 483
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose