Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle Anna Penelova1, Larry Richman1, Barbara Neupert1, Viesturs Simanis2 and Lukas C Kuhn1 ă Genetics Unit, Swiss Institute for Experimental Cancer Research (ISREC), Epalinges, Switzerland Cell Cycle Control Laboratory, Swiss Institute for Experimental Cancer Research (ISREC), Epalinges, Switzerland Keywords cell cycle; cyclin; elutriation; fluorescence activated cell sorter; mRNA stability Correspondence L C Kuhn, Swiss Institute for Experimental ă Cancer Research, Genetics Unit, Chemin des Boveresses 155, CH-1066 Epalinges, Switzerland Fax: +4121 652 69 33 Tel: +4121 692 58 36 E-mail: lukas.kuehn@isrec.ch (Received 29 June 2005, accepted 16 August 2005) doi:10.1111/j.1742-4658.2005.04918.x Cyclins are the essential regulatory subunits of cyclin-dependent protein kinases They accumulate and disappear periodically at specific phases of the cell cycle Here we investigated whether variations in cyclin mRNA levels in exponentially growing cells can be attributed to changes in mRNA stability Mouse EL4 lymphoma cells and 3T3 fibroblasts were synchronized by elutriation or cell sorting Steady-state levels and degradation of cyclin mRNAs and some other cell cycle related mRNAs were measured at early G1, late G1, S and G2 ⁄ M phases In both cell lines mRNAs of cyclins C, D1 and D3 remained unchanged throughout the cell cycle In contrast, cyclin A2 and B1 mRNAs accumulated 3.1- and 5.7-fold between early G1 and G2 ⁄ M phase, whereas cyclin E1 mRNA decreased 1.7-fold Mouse cyclin A2 and B1 genes, by alternative polyadenylation, gave rise to more than one transcript In both cases, the longer transcripts were the minor species but accumulated more strongly in G2 ⁄ M phase All mRNAs were rather stable with half-lives of 1.5–2 h for cyclin E1 mRNA and 3–4 h for the others Changes in mRNA stability accounted for the accumulation in G2 ⁄ M phase of the short cyclin A2 and B1 mRNAs, but contributed only partially to changes in levels of the other mRNAs Introduction Cyclin-dependent kinases (cdks) are central to the progression and control of the mammalian cell cycle [1–3] Their activity is regulated positively by interaction with cyclins and negatively by cdk-inhibitors that bind to cdk-cyclin complexes Cyclin-dependent kinases are also regulated by phosphorylation The protein levels of cdk activators and inhibitors are tightly controlled by the rate of their synthesis and by specific phosphorylation events that initiate ubiquitination and degradation by proteasomes, thus limiting expression to a specific cell cycle phase D-type cyclins (D1, D2 and D3) are highest in early G1 phase, when they activate cdk4 and cdk6 E-type cyclins (E1 and E2) peak in late G1 and associate with cdk2 to complete G1 and initiate S phase Cyclin A2 accumulates during S phase with highest levels in late S and G2 It associates with cdk2 during S phase and subsequently with cdk1 (cdc2) to pass the S ⁄ G2 boundary Finally, progression through G2 and mitosis require cyclins B1 and B2 that associate with cdk1 Because the expression of cyclins plays a large part in controlling cell cycle progression, it is important to understand the transcriptional and post-transcriptional mechanisms that influence cyclin levels Indeed, recent microarray data demonstrate significant variations of cyclin mRNA levels in human fibroblasts after release from serum starvation (G0 phase) [4] or a double thymidine block (late G1 phase) [5] Transcription of Abbreviations cdk, cyclin dependent kinase; DMEM, Dulbecco’s modified Eagle medium; DRB, 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole; FACS, fluorescence activated cell sorter; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; UTR, untranslated region FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS 5217 Cell cycle regulation of mouse cyclin mRNAs D-type cyclin mRNA is certainly induced by mitogenic signals that trigger G0 ⁄ G1 transition [6], whereas transcription of cyclin E1 starts in late G1 [7] Likewise, A- and B-type cyclin mRNA were reported to be induced in S and G2 ⁄ M phase as a consequence of events in G1 phase [4,8–10] In addition, several studies concluded that cyclin, cdk and cdk-inhibitor mRNA stability can vary throughout the cell cycle [11–15] Certain transacting proteins such as HuR were proposed as regulators of changes in mRNA stability during the cell cycle [15] In this context it is of interest that during vertebrate evolution many of the cyclin mRNAs show a rather high phylogenetic conservation of their 3¢ untranslated regions (3¢UTR) suggesting that specific elements in the 3¢UTR might contribute to control RNA half-life [16] On the other hand a recent study with human MOLT-4 cells showed no change in cyclin mRNA half-lives throughout the cell cycle [17] While most studies on cyclin mRNA stability in the cell cycle have been carried out with human cells, essential regulatory steps are likely to be conserved in evolution and thus amenable to genetic analysis in the mouse We therefore examined mRNA expression and stability in synchronized mouse lymphoma EL4 cells and 3T3 fibroblasts We analyzed the mRNA steadystate level and half-life of mouse cyclins and a selection of other cell cycle related genes for which important cell cycle-related changes were reported in microarray studies [4,5] We show that mRNAs for cks2, cyclin A2, B1 and E1 vary in the cell cycle but that mRNA half-life changes contribute only partially to these variations Results Steady-state levels of cyclin mRNA in the cell cycle In a first series of experiments we determined whether mRNA steady-state levels of cyclins and several cell cycle-related mRNAs change at different positions in the cell cycle To achieve this, about · 108 logarithmically dividing mouse EL4 lymphoma cells were separated by elutriation into 12–15 fractions EL4 cells are particularly well suited for this separation method as they are not adherent and grow to high density An aliquot of each fraction was analysed on a fluorescence activated cell sorter (FACS) for the profile of DNA content after propidium iodide staining Pooled fractions of cells highly enriched in early G1, late G1, S and G2 ⁄ M phase were selected for further analysis (Fig 1A) Steady-state mRNA levels were analysed by real-time PCR By taking the early G1 cells as a refer5218 A Penelova et al ence, mRNA levels of cyclins C, D1 and D3, as well as c-myc, RanGTPase and RanBP1 were unchanged (Fig 1B) Cyclin D2 was not expressed in EL4 cells Cyclin E1 mRNA increased slightly in late G1 and then diminished about 2-fold in G2 ⁄ M phase The clearest induction in G2 ⁄ M compared to early G1 cells was observed for cyclin A2 mRNA (3.1-fold) and cyclin B1 mRNA (5.7-fold) Cks2 mRNA was threefold higher in S phase and 2.4-fold higher in G2 ⁄ M and very similarly the control histone H4 mRNA showed a threefold increase in S phase Thus, changes in mRNA occur parallel to changes in protein expression [18,19], but cannot account for strong differences of cyclin protein levels that are modulated post-translationally [20,21] Overall we observed smaller differences in RNA steady-state levels than those reported by others for human cells [11,12,15] The relatively small changes in mRNA levels made us wonder whether there was any problem with the separation procedure To verify this, we separated EL4 cells in logarithmic growth by the FACS according to cellular DNA content revealed by Hoechst 33342 (Fig 1C) This method gave highly enriched cell populations with sufficient amount of mRNA for real-time PCR measurements, but could not distinguish early and late G1 cells The results were qualitatively very similar to the measurements obtained with elutriated cells, although somewhat less pronounced because we took the average G1 cells as a reference We found again that mRNA levels for cyclins C, D1 and D3 as well as for c-myc, RanGTPase and RanBP1 showed no changes in the cell cycle (Fig 1D) Cyclin E1 mRNA decreased from G1 to G2 ⁄ M by a factor of 1.7-fold, whereas the mRNA of cyclin A2, cyclin B1 and cks2 increased 1.9-, 3.2- and 2.4-fold, respectively We found similar results with mouse 3T3 cells that were either sorted by the FACS or synchronized by a double thymidine block They showed no change in steady-state levels for most mRNAs, with the exception of a two- to 2.5-fold increase between G1 and G2 ⁄ M for mRNAs of cks2, cyclins A2 and B1 (data not shown) Next we wanted to be sure that cells were fully viable after elutriation To test this, elutriated cell fractions were brought back into cell culture for 2–8 h, at which time their DNA content was analysed by the FACScan (Fig 2) EL4 cells advanced synchronously in the cell cycle without significant delay (Fig 2) The first fractions of cells harvested in the elutriation protocol behaved like early G1 cells They enter S phase only after about h of culturing, whereas later fractions comprise G1 cells that resumed S phase almost immediately and that we considered therefore as late FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS A Penelova et al Cell cycle regulation of mouse cyclin mRNAs A B C D Fig Steady-state levels of cyclin mRNAs in enriched cell cycle fractions of mouse EL4 cells Cells were separated either by elutriation or by cell sorting into G1, S and G2 ⁄ M phase fractions (A) Cells were separated by elutriation into about 15 fractions The DNA content was measured after Hoechst staining by the FACS Representative fractions showed a strong enrichment for cells in early G1 (a), late G1 (b), S (c) or G2 ⁄ M phase (d) (B) The mRNA content of these fractions was quantified by real-time PCR and normalized to mARP0 mRNA Values in early G1 cells were set as Results are the average of at least four experiments ± SD (C) Typical FACS profile of the DNA content of logarithmically growing EL4 cells stained by Hoechst 33342 Cells were separated by FACS sorting into three fractions as indicated (D) In each fraction, mRNAs were quantified by real-time PCR Values are normalized to mARP0 mRNA The amount of each mRNA in G1 phase cells is set as Results are the average of two experiments G1 cells The FACS profiles allowed us to estimate the total cycle to about 13 h of which about h correspond to G1 phase, about 3.5 h to S phase and another 3.5 h to G2 phase and mitosis This correlated well with the estimated doubling time of EL4 cells in logarithmic growth No major variation in the mRNA half-life of cyclin mRNAs in the cell cycle In order to test whether changes in mRNA steadystate levels correlate with any changes in mRNA stability, we carried out half-life measurements on the different elutriated cell fractions Transcription was inhibited with 5,6-dichloro-1-b-d-ribofuranosylbenzimidazole (DRB) and mRNA measured at 0, 30, 60, 120 and 180 by real-time PCR (Fig 3) Half-life FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS measurements showed no strong differences in mRNA degradation rates in the different cell cycle phases Only mRNA of cyclins A2 and B1 showed at most a 1.6-fold higher stability in S and G2 ⁄ M phases As a positive control, we found as expected a rapid degradation with a half-life of less than h for the unstable c-myc mRNA, indicating that the transcription block by DRB was effective Similar data were also obtained with actinomycin D or with EL4 cells enriched in specific cell cycle phases by the FACS (data not shown) Northern blot analysis of mRNA from fractions of elutriated EL4 cells We needed to confirm the real-time PCR data by northern blots of RNA from elutriated cells The cell cycle distribution of the cell fractions is shown in Fig 5219 Cell cycle regulation of mouse cyclin mRNAs A Penelova et al Fig Cell cultures of mouse EL4 cell fractions after elutriation Immediately after elutriation selected cell fractions enriched in a given cell cycle phase (as indicated) were put back into culture for 2, 4, or h The cell cycle progression was analysed by FACS profiles of the DNA content of propidium iodide stained aliquots of cells Northern blot hybridizations were carried out for genes that had shown differences of steady-state levels in the cell cycle (cyclin A2, B1 and E1) The invariant mRNAs of cyclin D3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were analysed as controls (Fig 4A) These blots revealed that there is more than one transcript from mouse cyclin A2 and B1 genes In the case of mouse cyclin A2, besides the more abundant mRNA of 1.8 kb, there is a minor species of 3.0 kb For mouse cyclin B1 we see in addition to the most abundant 1.7 kb mRNA, a 2.5 kb mRNA and a very minor 2.1 kb mRNA Based on EST database searches taking into account all 5¢ and 3¢ ends of identified cDNAs, we concluded that these mRNA heterogeneities arise from alternative polyadenylation This was confirmed by control hybridizations with 3¢UTR probes downstream of the first polyadenylation site that consistently revealed only the longer transcripts 5220 (Fig 5) Longer transcripts of cyclins A2 and B1 were also visible in mouse 3T3 cells and in mouse thymus and spleen, but were less clearly detectable in tissues with fewer proliferating cells (data not shown) In testes two cyclin A2 transcripts and only the shorter cyclin B1 transcript were visible, in agreement with previous reports [22,23] The hybridizations with a coding region probe, after normalization to GAPDH expression, showed that the 1.8 kb cyclin A2 mRNA accumulated about 1.8-fold in S and G2 ⁄ M phase compared to early G1 phase, while the 1.7 kb cyclin B1 mRNA increased at most threefold (Fig 4B) More strikingly, the longer mRNA variants of both cyclins accumulated much more than the short ones and reached 35–45% of the total amount in late S and G2 ⁄ M cells The 2.5 kb mRNA of cyclin B1 showed reproducibly a strong, up to 10-fold increase, while the magnitude of the 3.0 kb cyclin A2 mRNA increase FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS A Penelova et al A B Cell cycle regulation of mouse cyclin mRNAs showed some variation between experiments (Fig and Fig 6A) The reason for this is unclear At the same time cyclin E1 declined 2.2-fold Based on northern blot analysis, as already determined by real-time PCR, changes in steady-state levels were not associated with strong modifications in the mRNA half-life in different cell cycle phases (Fig 6B) Half-lives were about h for cyclin E1 mRNA and 3– 4.5 h for the other transcripts in most cell cycle phases These values are close to those obtained by real-time PCR Only in the case of the short cyclin A2 and B1 mRNAs were the half-lives significantly prolonged in G2 ⁄ M phase This change fully accounts for the accumulation of these transcripts in G2 ⁄ M phase For the long cyclin A2 and B1 mRNAs we found also a minor stability change that cannot account for their strong accumulation in G2 ⁄ M phase Given the clear accumulation of cyclin A2 and B1 mRNAs in G2 ⁄ M compared to early G1 and the reports on human cells that demonstrated a strong difference in mRNA stability in these phases [11,12,15], it seemed important to verify carefully mRNA half-lives at the transition between G2 ⁄ M and early G1 phase For this, EL4 cells were arrested in mitosis by nocodazole and then released for 0, 30, 60, 90, 120 or 180 At least 75% of the arrested cells completed mitosis and divided within h (Fig 7A) mRNA halflives were measured at each time-point (Fig 7B) The results indicated no significant changes in mRNA halflife for most transcripts except the long transcript of cyclin B1 which appeared to decay quite rapidly at the time of the release Notably with the nocodazole arrested cells we did not find the prolonged half-life seen before for cyclin A2 and B1 mRNAs in enriched G2 ⁄ M fractions Based on these data it seems unlikely that changes in steady-state levels can be attributed to transient changes in half-life Discussion Fig Half-life of cyclin mRNAs in EL4 cell fractions enriched by elutriation Cell fractions were put back into cell culture for about 30 and incubated for 0, 30, 60, 120 or 180 with DRB prior to the isolation of total mRNA Remaining mRNA was measured by real-time PCR and normalized to mARP0 mRNA The short-lived c-myc mRNA served as a control (A) The mRNA half-life was calculated from linear regression on semi-logarithmic plots Results are the average of three to four experiments ± SD (B) Alternatively, data of decay of mRNAs showing the strongest changes in steadystate levels (Fig 1) were plotted on a semi-logarithmic scale and a single regression line calculated The intercept of the regression line at log10 of 50% ¼ 1.699, corresponds to the half-life The lower and upper 95% confidence limits were at 0.75 and 1.5 times the half-life FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS The purpose of the present study was to analyse the contribution of post-transcriptional mechanisms in the cell cycle regulation of cyclin mRNAs Previous studies on HeLa cells [11,12] and colorectal carcinoma RKO cells [15] had found strong mRNA stability changes We reasoned that such a feature, if it was physiologically important, should be conserved between human and mouse We therefore analysed the steady-state levels and mRNA stability at different points in the cell cycle of mouse 3T3 and EL4 cell lines The general conclusion of our analysis is that, in contrast to these earlier studies, but in agreement with a recent publication on human MOLT cells [17], most cyclin 5221 Cell cycle regulation of mouse cyclin mRNAs A A Penelova et al Fig Northern blot analysis of cyclin mRNAs in all fractions of a typical elutriation experiment (A) The content of G1, S and G2 ⁄ M cells (in percentage on top panel) was determined for 12 consecutive fractions by propidium iodide staining and FACS mRNA of cyclins A2, B1, E1 and D3 along with the control GAPDH mRNA were quantified by northern blot hybridization with probes of the coding regions Numbers on the right indicate sizes of transcripts (B) Cyclin mRNA expression in different fractions was normalized to GAPDH mRNA and is reported relative to the first cell fraction (arbitrarily set as 1) B Fig Alternative polyadenylation in mouse cyclin A2 and B1 mRNA mRNA of nonsynchronized EL4 cells was isolated at different times indicated after transcription inhibition by DRB and analysed by northern blot hybridization The blot shown was sequentially hybridized with probes of the cyclin A2 coding region, cyclin B1 coding region, cyclin A2 3¢UTR, cyclin B1 3¢UTR and finally the GAPDH coding region probe The experiment shown is representative for three experiments with similar results mRNAs show relatively small changes in steady-state levels and their degradation rates not vary more than twofold during the cell cycle The moderate regulation cannot be attributed to a lack of cell synchronization or cell viability (Fig 2) Two independent methods, elutriation and cell sorting gave excellent separation between G1, S and G2 ⁄ M cells and indicate overall very similar changes in mRNA steady-state levels (Fig 1) We found similar results for mouse EL4 lymphoma cells and 3T3 cells derived from different tissue types, suggesting that EL4 cells in spite of being tumour-derived with an exceptionally rapid cell cycle show the same basic features in terms of cyclin mRNA regulation as immortalized 3T3 fibroblasts Several transcripts did not vary throughout the cell cycle This was the case for mRNAs of cyclins C, D1 and D3 which had a constant half-life at all stages of the cell cycle of about h, as well as c-myc, RanBP1 and RanGTPase mRNAs This is consistent with 5222 FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS A Penelova et al Cell cycle regulation of mouse cyclin mRNAs A C B Fig Half-life measurements of cyclin mRNAs by northern blot hybridizations (A) Cell fractions of elutriated EL4 cells (see cell cycle distribution on top) were incubated in the presence of the transcription inhibitor DRB for various lengths of time Total mRNA was isolated and analysed by northern blot hybridization (B) The signal intensity was quantified by a phosphorimager and normalized to GAPDH mRNA The half-life of each mRNA in different cycle phases is reported Results are the average of two independent experiments (for cyclin A2 measured each twice) ± SD (C) Alternatively, results of long and short cyclin A2 and B1 mRNAs were plotted on semi-logarithmic graphs and a single regression line calculated The intercept of the regression line at log10 of 50% ¼ 1.699, corresponds to the half-life The lower and upper 95% confidence limits were at 0.75 and 1.5 times the half-life previous studies [24,25] cks2 mRNA showed an increase in late S and G2 ⁄ M phase confirming previous observations [26,27], but no cell cycle-dependent change in stability The cyclin E1 mRNA was increased in the G1 phase of the cell cycle, but this was not accompanied by changes in mRNA half-life This result is similar to the one reported by others who released cells from serum starvation [12] or synchronized them by harvesting freshly divided cells [17] We saw a reproducible increase for mRNAs of cyclins A2 and B1 as cells moved from G1 to G2 ⁄ M phase (Figs and 4) However, northern blot hybridizations revealed a more complex situation than in human cells, with FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS alternative transcripts produced by differences in polyadenylation sites (Figs and 5) The 1.8-kb transcript of cyclin A2 that corresponds to 60–90% of the total cyclin A2 mRNA increased only about twofold, whereas the 3.0 kb cyclin A2 mRNA was 2.5- to 7-fold more expressed in G2 ⁄ M (Figs and 6) This was accompanied by about a twofold increased half-life in G2 ⁄ M phase for both mRNAs (Fig 6B) Similarly, the 1.7-kb cyclin B1 mRNA showed only a two- to threefold accumulation in G2 ⁄ M, whereas the 2.5-kb cyclin B1 mRNA was increased about 10-fold in G2 ⁄ M (Figs and 6) The two mRNAs decayed with a halflife that was similar and at most twofold prolonged in 5223 Cell cycle regulation of mouse cyclin mRNAs A Penelova et al A B C G2 ⁄ M phase We conclude that the changes in mRNA half-life may explain almost fully the accumulation of the short A2 and B1 transcripts as well as partially the 3.0-kb A2 transcript In contrast, the greater increase of the 2.5-kb cyclin B1 transcript cannot be explained by half-life changes It is possible that the majority of the regulation of these transcripts may reside in the choice of polyadenylation site The lack of changes in mRNA stability for mRNAs, which have quite long half-lives, raises the question of how their levels decrease at the end of M-phase We have to assume a prolonged period of transcription inhibition to explain the decay of an mRNA that fluctuates 10-fold in the cycle At present it is unclear what triggers the decrease in the level of the 2.5-kb cyclin B1 mRNA at the M ⁄ G1 transition Mitotic arrest and release experiments showed no systematic 5224 Fig Analysis of mRNA half-lives at the transition between M and G1 phase Cells were blocked with nocodazole in mitosis and released for 0, 30, 60, 90, 120 and 180 (A) The cell cycle distribution of each cell population was determined by flow cytometry (B) At different times of release cells were incubated with DRB and mRNA decay was determined by northern blot hybridization (C) The mRNA half-life is reported for the various mRNAs at different time-points of the nocodazole release The results are the average of three experiments ± SD acceleration in mRNA degradation near mitosis or shortly after (Fig 7) We found similar results with recultured cells after elutriation (data not shown) The relatively modest twofold changes for the halflives of mouse cyclin A2 and B1 mRNAs observed here contrast with the large changes observed in earlier analyses on human HeLa and colorectal carcinoma RKO cells [11,12,15] When HeLa cells were synchronized after release from a thymidine ⁄ amphidicolin block, the half-life of cyclin B1 mRNA measured after actinomycin D addition increased from 1.2 h in early G1 to 12 h in G2 ⁄ M phase [11] With the same method the cyclin A mRNA half-life was reported to change from 1.6 h in early G1 to 12 h in late G1 and h in S and G2 ⁄ M phase [12] Similarly, cyclin A and B1 mRNA half-lives increased in RKO cells from about 2.5 h in G1 to 18 h in S phase after release from serum FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS A Penelova et al starvation [15] However, no full return to the initial rapid mRNA degradation rates in G1 was observed when cells were cultured for a full cell cycle [15] The overall conclusion from our study of no major changes in cyclin mRNA degradation throughout the cell cycle is consistent with a recent report on cyclin mRNA half-lives in human MOLT-4 cells [17] Introducing a novel synchronization procedure of gently harvesting freshly divided cells, which should be unperturbed in their logarithmic growth, the authors reported that cyclin A2 and B1 mRNA accumulated about 8-fold in G2 ⁄ M compared to early G1 phase, whereas mRNA half-lives fluctuated between 1.5 and 2.5 h [17] In this study the small variations of stability did not account for the relatively strong fluctuations of cyclin A2 and B1 mRNA, while here we propose that 2-fold changes in mRNA levels for the major, short cyclin A2 and B1 mRNAs can be accounted for by stability changes The discrepancies between the different studies may be due to differences in cell lines or the techniques used to synchronize them It is noteworthy that both EL4 and MOLT-4 cells are derived from T-cell lymphomas, whereas HeLa and RKO cells are epithelial carcinomas, and 3T3 cells are of fibroblast origin As is has been proposed that cyclin mRNA stabilization depends on specific mRNA-binding proteins interacting with AU-rich regions, notably HuR [15], it is conceivable that different cell lines express these proteins differently Alternatively, HuR might be induced only under certain conditions of stimulation after a cell growth arrest, but not in the case of separation of cells during logarithmic growth Concerning the techniques alone we found for EL4 cells, that elutriation was less perturbing than other methods, including release after double thymidine block or nocodazole arrest where usually a large fraction of cells (sometimes up to 30%) were unable to resume growth It was reassuring that cell sorting gave results similar to elutriation, as transcription inhibitor is added to unperturbed logarithmically growing cells and RNA isolated immediately after sorting eliminating artefacts of cell culture The similarity of our conclusions concerning mRNA half-life to those reached by others with MOLT-4 cells [17] seems to exclude fundamental differences in cyclin mRNA decay between species However, there are differences in the relative accumulation of cyclin A2 and B1 mRNA, and the detection of multiple mRNA species in the mouse was a surprise given previous observations in human cells Others have reported heterogeneity of A2 and B1 transcripts in rodent species [28,29] Human cyclin A mRNA shows mainly one band [19] corresponding to the 2.7-kb mRNA in the FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS Cell cycle regulation of mouse cyclin mRNAs mouse, and human cyclin B1 mRNA is also a single species [18] corresponding to the 1.7-kb transcript in the mouse We show that mouse transcripts differ only in their 3¢UTR, but not the coding regions Therefore, the significance of 3¢UTR differences is unclear They may perhaps play a role in localizing the mRNA or regulate its translation Future studies will address this In conclusion, our study shows that post-transcriptional regulation contributes 2-fold to the short versions of cyclin A2 and B1 mRNA, whereas minor fluctuations of mRNA levels in the other genes are possibly transcriptionally controlled The cyclic accumulation of the longer mouse cyclin A2 and B1 mRNAs may result from a combination of changes in alternative polyadenylation, transcription and minor mRNA stabilization in G2 ⁄ M phase Experimental procedures Cell culture Mouse 3T3 fibroblasts kindly provided by A Trumpp (ISREC, Switzerland) were grown in Dulbecco’s modified Eagle medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% (v ⁄ v) heat-inactivated fetal bovine serum (FBS; Sigma, St Louis, MO, USA) Mouse EL4 lymphoma cells were grown in DMEM ⁄ 5% (v ⁄ v) FBS Media were supplemented with 1% (w ⁄ v) penicillin-streptomycin (Invitrogen) Cells were grown at 37 °C in a humidified atmosphere of 5% (v ⁄ v) CO2 Cell synchronization protocols Cell sorting Mouse 3T3 fibroblasts or EL4 lymphoma cells were grown in logarithmic cell cultures for days For mRNA steadystate measurements, cells were stained with lgỈmL)1 Hoechst 33342 (Sigma, Franklin Lakes, NJ, USA) for 30 min, and separated into G1, S and G2 ⁄ M phase cells by FACS (FACStar Plus Pulse Processor; Becton-Dickinson, xxxx, xxxx) Alternatively, for mRNA half-life measurements, cells were incubated with lgỈmL)1 actinomycin D (Sigma) or 20 lgỈmL)1 DRB (Sigma) for 0, 30, 60 or 120 min, then stained with lgỈmL)1 Hoechst 33342 for 30 min, and separated into G1, S and G2 ⁄ M phase cells by FACS Fractionated cells were collected in RLT buffer (Qiagen, Valencia, CA, USA) and stored at )70 °C until RNA extraction Centrifugal elutriation Centrifugal elutriation was performed in a Beckman JE 5.0 centrifuge and a JE-5S rotor equipped with the standard 5225 Cell cycle regulation of mouse cyclin mRNAs separation chamber Logarithmically growing EL4 cells (3 · 108)6 · 108) were introduced into the separation chamber Cells were elutriated at °C in NaCl ⁄ Pi containing 2% (v ⁄ v) FBS Elutriation was executed at a constant rotor speed of 2800 r.p.m (755 g) The fractionation of cells into cell cycle subpopulations was accomplished by increasing the pump speed stepwise from the initial flow rate of 20 mLỈmin)1 to a maximum of 55 mLỈmin)1 Cell fractions of 100 mL were harvested The cell cycle distribution was determined on propidium iodide-stained aliquots of cells Enriched cell populations were cultured in fresh DMEM ⁄ 5% (v ⁄ v) FBS for 2, 4, or h and aliquots reanalysed for the cell cycle distribution Nocodazole block Mouse EL4 cells (3 · 105) were grown in 75-cm2 flasks for day Then they were incubated with 40 ngỈmL)1 nocodazole (Sigma) for 14 h and released from the block for 30, 60, 90, 120 or 180 To each fraction 20 lgỈmL)1 DRB (Sigma) was added for 0, 30, 60, 120 and 180 Onetenth of each fraction was stained with propidium iodide (Sigma) and analysed by FACS The rest of the cells were stored at )70 °C in RLT buffer (Qiagen) until RNA extraction Propidium iodide staining To test the cell cycle distribution of cells, an aliquot of cells was fixed with ethanol, stained with 50 lgỈmL)1 propidium iodide (Sigma) and 200 lgỈmL)1 RNase A (Sigma), and analysed by a Becton-Dickinson FACScan flow cytometer RNA extraction, RNA half-life measurements and northern blot hybridization Total cellular RNA was extracted with RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol For RNA half-life measurements, lgỈmL)1 actinomycin D or 20 lgỈmL)1 DRB was added 0, 30, 60, 120 and 180 before RNA extraction Total RNA (10 lgỈsample)1) was separated on a 1.2% agarose formaldehyde gel RNA was transferred by capillarity onto ImmobilonTM-Ny+ membrane (Millipore, Billerica, MA, USA) and UV-crosslinked in a Stratalinker (Stratagene, La Jolla, CA, USA) at 1.2 · 105 lJ The mouse cyclin A2, B1, D3, E1 and cks2 cDNA probes were generated by PCR amplification of their coding sequences The GAPDH probe template was the EcoRIHindIII fragment of the coding region [30] To detect long transcripts of cyclins A2 and B1, we amplified by PCR the 3¢UTR of cyclin A2 at nucleotides 2129–2779 (GenBank accession no NM_009828) and of cyclin B1 at nucleotides 2011–2311 (GenBank accession no NM_172301) 5226 A Penelova et al Fifty nanograms of DNA template was labelled by random priming for h at 37 °C in a 30-lL reaction volume containing 50 mm Tris ⁄ HCl pH 8, 200 mm Hepes, 0.1 mgỈmL)1 BSA, mm MgCl2, 100 lm 2-mercaptoethanol, 20 lm dATP, 20 lm dGTP, 20 lm dTTP and 50 lCi [32P]dCTP (3000 CiỈmmol)1), U Klenow (Roche, Basel, Switzerland) and 27 A260 units hexanucleotide (Pharmacia, Peapack, NJ, USA) for priming Membranes were prehybridized for at least h at 42 °C in hybridization buffer (50% formamide, 1% SDS, 4.8 · NaCl ⁄ Cit, 10% dextran sulfate) with 100 lgỈmL)1 salmon sperm DNA Denatured probe was added to the hybridization solution and allowed to hybridize to the membrane at 42 °C overnight Membranes were rinsed with · NaCl ⁄ Cit, 0.1% SDS, washed twice for 30 at 65 °C in 0.2 · NaCl ⁄ Cit, 0.1% SDS and then visualized by Imaging Plate BAS-MP 2040S (Fuji Photo Film, Tokyo, Japan) and Kodak BiomaxTM films (Rochester, NY, USA) Images were quantified using a Bio-imaging analyser BAS1000 (Fuji) and advanced image data analyzer (aida 2.0) software For additional hybridizations, the membranes were stripped twice for 15 in 250 mL of boiling 0.1 · NaCl ⁄ Cit, 0.5% SDS Reverse transcription and real-time PCR To avoid amplification of residual genomic DNA, firstly this was removed from total RNA on the RNeasy Mini Kit column by treating with RNase-free DNase I Set (Qiagen) according to the manufacturer’s protocol We then used a specific fluorogenic probe labelled with 5¢ 6-carboxy-fluorsecein (FAM) and 3¢ 6-carboxy-tetraethyl-rhodamine (TAMRA) for Taqman quantification Almost all fluorogenic probes were chosen such as to hybridize to an exon– exon junction (Table 1), except in the case of cks2 mRNA where the reverse primer is at the intron–exon junction and histone mRNA that has no intron To avoid cross-amplification of pseudogenes, we verified that primer sequences did not appear elsewhere in the EST database When choosing a new primer set for real-time PCR we always verified that there was no significant amplification product in the absence of reverse transcriptase First-strand cDNA was synthesized using lg RNA in a 20-lL reverse transcriptase reaction mixture, containing · RT buffer, 0.01 m dithiothreitol, 0.5 mm of each dNTP, lg random hexamer pd(N)6 (Pharmacia), U RNasin (Amersham Biosciences, Piscataway, NJ, USA) and 200 U M-MLV reverse transcriptase (Invitrogen) The reverse transcriptase reaction was carried out at 42 °C for 90 and then inactivated for at 95 °C The cDNA was diluted at least 20-fold prior to PCR amplification The PCR was performed in the GeneAmpÒ5700 sequence detection system (Applied Biosystems, Foster City, CA, USA) Taqman PCR reactions were performed in a 25-lL volume contain- FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS A Penelova et al Cell cycle regulation of mouse cyclin mRNAs Table Primers and fluorogenic probes used for real-time PCR Gene ⁄ accession number ARP0 X15267 Cyclin A2 NM_009828 Cyclin B1 NM_172301 Cyclin C NM_016746 Cyclin D1 NM_007631 Cyclin D2 NM_009829 Cyclin D3 NM_007632 Cyclin E1 NM_007633 Cks2 NM_025415 RanBP1 NM_011239 RanGTPase S83456 c-myc NM_010849 Histone NM_175652 Orientation 5¢fi3¢ sequence Concentration [nM] Forward Reverse Probe CTTTGGGCATCACCACGAA GCTGGCTCCCACCTTGTCT ATCAGCTGCACATCACTCAGAATTTCAATGGT 300 300 100 Forward Reverse Probe CCTTCCACTTGGCTCTCTACACA GACTCTCCAGGGTATATCCAGTCTGT TGCCAATGACTCAGGCCAGCTCTGT 700 500 150 Forward Reverse Probe AGATGGAGATGAAGATTCTCAGAGTTCT GACGTCAACCTCTCCGACTTTAG CCTCTGCCTCTGCACTTCCTCCGTAGA 500 500 150 Forward Reverse Probe GGACGGATCTCTGTCTGCTGTA ACTGTCTAGCATCTTTCTGTTGTACGA TCCGTTCATGATCGCTTTAGCTTGCCTAC 300 500 150 Forward Reverse Probe GTGCGTGCAGAAGGAGATTGT CAGCGGGAAGACCTCCTCTT TCCTCACAGACCTCCAGCATCCAGGT 500 700 100 Forward Reverse Probe CGTACATGCGCAGGATGGT AATTCATGGCCAGAGGAAAGAC TTTGTTCCTCACAGACCTCTAGCATCCAGGT 700 300 100 Forward Reverse Probe AAAGGAGATCAAGCCGCACAT GTTCATAGCCAGAGGGAAGACATC CTCCTCACACACCTCCAGCATCCAGTATG 300 500 100 Forward Reverse Probe TCTCCTCACTGGAGTTGATGCA AACGGAACCATCCATTTGACA CTCTATGTCGCACCACTGATAACCTGAGACCTT 300 500 150 Forward Reverse Probe CCGAAGAGGAGTGGAGGAGACT ATATGCGGTTCTGGCTCATGA CATGTAATGAACCCATCCTAGACTCTGTTGGACA 700 700 150 Forward Reverse Probe TGAGGAGGGACAAAACCTTGAA TCGGTCACTGCCAGCATTC CCAACCACTATATTACACCAATGATGGAGCTGAA 700 700 100 Forward Reverse Probe CAACAAAGTGGATATTAAAGACAGGAAAG TGGCAGAAATGTCATAGTACTGAAGATT AAGGCAAAATCTATTGTCTTCCACCGGAAGAA 300 700 200 Forward Reverse Probe CTGGATTTCCTTTGGGCGTT TGGTGAAGTTCACGTTGAGGG AAACCCCGCAGACAGCCACGAC 200 200 200 Forward Reverse Probe GCATCTCCGGCCTCATCTAC CGGATGACGTTCTCCAGGAA ACCTTCAGCACACCACGGGTCTCCT 300 500 150 ing 10 lL cDNA, · qPCRTM Core Kit (Eurogentec, Seraing, Belgium), 0.25 U of uracil N-glycosylase (Eurogentec), forward and reverse primers, and fluorogenic probe The FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS reactions were performed in 96-well optical plates (Applied Biosystems) The reactions were incubated for at 50 °C to activate the uracil N-glycosylase, then for 10 5227 Cell cycle regulation of mouse cyclin mRNAs at 95 °C to inactivate the uracil N-glycosylase and activate the HotStartTaq DNA polymerase, followed by 40 cycles of 15 s at 95 °C, at 60 °C The generated data were analysed with the GeneAmpÒ5700 system software The foldchange or half-life of tested mRNAs relative to the mouse acidic ribosomal phosphoprotein P0 (mARP0) [31] were determined for both cell lines by using a standard curve method Calculation of mRNA half-lives was carried out by plotting data on a semilogarithmic graph and calculating the first order decay slope using linear regression Values of independent experiments were used to calculate the average half-lives ± SD Alternatively, data of several experiments were plotted on a single graph to calculate the linear regression slope and 95% confidence limits Acknowledgements A Penelova et al 11 12 13 14 15 This work was supported by grants of the Swiss National Science Foundation and the Swiss Cancer League 16 References Morgan DO (1997) Cyclin-dependent kinases: engines, clocks and microprocessors Annu Rev Cell Dev Biol 13, 261–291 Johnson D & Walker C (1999) Cyclins and cell cycle checkpoints Annu Rev Pharmacol Toxicol 39, 195–312 Malumbres M & Barbacid M (2001) To cycle or not to cycle: a critical decision in cancer Nature Rev Cancer 1, 222–231 Iyer VR, Eisen MB, Ross DT, Schuler G, Moore T, Lee JCF, Trent JM, Staudt LM, Hudson J Jr, Boguski MS et al (1999) The transcriptional program in the response of human fibroblasts to serum Science 283, 83–87 Cho RJ, Huang M, Campbell MJ, Dong H, Steinmetz L, Sapinoso L, Hampton G, Elledge SJ, Davis RW & Lockhart DJ (2001) Transcriptional regulation and function during the human cell cycle Nature Genet 27, 48–54 Coqueret O (2002) Linking cyclins to transcriptional control Gene 299, 35–55 Moroy T & Geisen C (2004) Cyclin E Int J Biochem ă ă Cell Biol 36, 14241439 Henglein B, Chenivesse X, Wang J, Eick D & Brechot C (1994) Structure and cell cycle-regulated transcription of the human cyclin A gene Proc Natl Acad Sci USA 91, 5490–5494 Hwang A, Maity A, McKenna WG & Muschel RJ (1995) Cell cycle-dependent regulation of the cyclin B1 promoter J Biol Chem 270, 28419–28424 10 Hwang A, McKenna WG & Muschel RJ (1998) Cell cycle-dependent usage of transcription start sites A 5228 17 18 19 20 21 22 23 24 25 novel mechanism of regulation of cyclin B1 J Biol Chem 273, 31505–31509 Maity A, McKenna WG & Muschel RJ (1995) Evidence for post-transcriptional regulation of cyclin B1 mRNA in the cell cycle and following irradiation in HeLa cells EMBO J 14, 603–609 Maity A, McKenna WG & Muschel RJ (1997) Cyclin A message stability varies with the cell cycle Cell Growth Diff 8, 311–318 Oda S, Nishida J, Nakabeppu Y & Sekiguchi M (1995) Stabilization of cyclin E and cdk2 mRNAs at G1 ⁄ S transition in Rat-1A cells emerging from the G0 state Oncogene 10, 1343–1351 Wang W, Furneaux H, Cheng H, Caldwell MC, Hutter D, Liu Y, Holbrook N & Gorospe M (2000) HuR regulates p21 mRNA stabilization by UV light Mol Cell Biol 20, 760–769 Wang W, Caldwell MC, Lin S, Furneaux H & Gorospe M (2000) HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation EMBO J 19, 2340– 2350 Duret L, Dorkeld F & Gautier C (1993) Strong conservation of non-coding sequences during vertebrates evolution: potential involvement in post-transcriptional regulation of gene expression Nucleic Acids Res 21, 2315–2322 Eward KL, Van Ert MN, Thornton M & Helmstetter CE (2004) Cyclin mRNA stability does not vary during the cell cycle Cell Cycle 3, 1057–1061 Pines J & Hunter T (1989) Isolation of a human cyclin cDNA: evidence for cyclin mRNA and protein regulation in the cell cycle and for interaction with p34cdc2 Cell 58, 833–846 Pines J & Hunter T (1990) Human cyclin A is adenovirus E1A-associated protein p60 and behaves differently from cyclin B Nature 346, 760–763 King RW, Deshaies RJ, Peters JM & Kirschner MW (1996) How proteolysis drives the cell cycle Science 274, 1652–1659 Koepp DM, Harper JW & Elledge SJ (1999) How the cyclin became a cyclin: regulated proteolysis in the cell cycle Cell 97, 431–434 Trembley JH, Kren BT & Steer CJ (1994) Posttranscriptional regulation of cyclin B messenger RNA expression in the regenerating liver Cell Growth Differ 5, 99–108 Ravnik SE & Wolgemuth DJ (1996) The developmentally restricted pattern of expression in the male germ line of a murine cyclin A, cyclin A2, suggests roles in both mitotic and meiotic cell cycles Dev Biol 173, 69–78 Thompson CB, Challoner PB, Neiman PE & Groudine M (1985) Levels of c-myc oncogene mRNA are invariant throughout the cell cycle Nature 314, 363–366 Whitfield ML, Sherlock G, Saldanha AJ, Murray JI, Ball CA, Alexander KE, Matese JC, Perou CM, Hurt FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS A Penelova et al MM, Brown PO & Botstein D (2002) Identification of genes periodically expressed in the human cell cycle and their expression in tumors Mol Biol Cell 13, 1977–2000 26 Richardson HE, Stueland CS, Thomas J, Russell P & Reed SI (1990) Human cDNAs encoding homologs of the small p34Cdc28 ⁄ Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces pombe Genes Dev 4, 1332–1344 27 Urbanowicz-Kachnowicz I, Baghdassarian N, Nakache C, Gracia D, Mekki Y, Bryon PA & Ffrench M (1999) ckshs expression is linked to cell proliferation in normal and malignant human lymphoid cells Int J Cancer 82, 98–104 28 Hanley-Hyde J, Mushinski JF, Sadofsky M, Huppi K, Krall M, Kozak CA & Mock B (1992) Expression of FEBS Journal 272 (2005) 5217–5229 ª 2005 FEBS Cell cycle regulation of mouse cyclin mRNAs murine cyclin B1 mRNAs and genetic mapping related genomic sequences Genomics 13, 1018–1030 29 Maity A, McKenna WG, Markiewicz DA, Kunig A & Muschel RJ (1994) Alternate polyadenylation in rodent cells results in two differentially expressed cyclin B1 mRNAs Biochem Biophys Res Com 202, 908–914 30 Sabath DE, Broome HE & Prystowsky MB (1990) Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte Gene 91, 185–191 31 Krowczynska AM, Coutts M, Makrides S & Brawerman G (1989) The mouse homologue of the human acidic ribosomal phosphoprotein PO: a highly conserved polypeptide that is under translational control Nucleic Acids Res 17, 6408 5229 ... Results Steady-state levels of cyclin mRNA in the cell cycle In a first series of experiments we determined whether mRNA steady-state levels of cyclins and several cell cycle- related mRNAs change at... the cell cycle [11–15] Certain transacting proteins such as HuR were proposed as regulators of changes in mRNA stability during the cell cycle [15] In this context it is of interest that during... major variation in the mRNA half-life of cyclin mRNAs in the cell cycle In order to test whether changes in mRNA steadystate levels correlate with any changes in mRNA stability, we carried out