trace of a second order tensor

... Mathematics and Mechanics-Azerbaijan National Academy of Science, 9, F. Agayev Street, Baku AZ1141, Azerbaijan Full list of author information is available at the end of the article Abstract The ... distribution and trace formula of a second order operator- differential equation Nigar Mahar Aslanova 1,2 Correspondence: nigar. aslanova@yahoo.com 1 Department of Differential Equation, Institute of Mathematics and ... equations. Nauk Dumka, Kiev, 284 (1984) (Russian). 31. Yakubov, S, Yakubov, Ya: Differential-Operator Equations Ordinary and Partial Differential Equations. Chapman and Hall/ CRC, Boca Raton, 568...

Ngày tải lên: 21/06/2014, 02:20

Ngày tải lên: 22/06/2014, 19:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 22/06/2014, 22:20

... HepG 2 cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaIsiteandBack 6I ... 00 Fetuin NeuAca2-3Galb1-3GalNAca1-O-Ser/Thr c 0 1.4 NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thr c NeuAca2-6(3)Galb1-4GlcNAc-R c Asialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83 Galb1-4GlcNAc-R Arylglycosides ... the annealing of the two following synthetic oligonucleotides For EGT 5¢- GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCG TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG CCAACATAAGATGGTCATGGTGGCG-3¢....

Ngày tải lên: 08/03/2014, 08:20

... initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18]. It encoded a predicted product of 255 amino acids with a molecular mass of 28.5 kDa, and ... detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ). Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle. Polyclonal antiserum to the peptide was raised ... proliferating cell nuclear antigen 2 (DmPCNA2) and DmPCNA1 in response to DNA-damaging agents. (A) Immunofluorescent analysis of the localization of V5-tagged DmPCNA2 and Flag-tagged DmPCNA1. DmPCNA2...

Ngày tải lên: 23/03/2014, 10:20

... repetition of the proof of Lemma 3.2, we omit the details of its proof. With the aid of above preparations, now we will give the proof of Theorem 1.2. Proof of Theorem 1.2 By(1.8), (2.1), (3.1), and ... Long College of Mathematics and Information Sciences, Guangzhou University, Guangzhou 510006, P. R. China Email address: longyuhua214@163.com Abstract In this article, we discuss how to use a standard ... in various fields such as optimal control, filtering theory, and discrete variational theory and many authors have extensively studied its disconjugacy, disfocality, boundary value problem oscillation,...

Ngày tải lên: 18/06/2014, 22:20

... application of the variational methods in the boundary problem of discrete Hamiltonian systems. Dissertation for doctor degree. College of Mathematics and Econometrics, Changsha, 2006 [17] Ma, ... study of second- order linear differential equations. So, (1.3) arises with high frequency in various fields such as optimal control, filtering theory, and discrete variational theory and many authors ... repetition of the proof of Lemma 3.2, we omit the details of its proof. With the aid of above preparations, now we will give the proof of Theorem 1.2. Proof of Theorem 1.2 By(1.8), (2.1), (3.1), and...

Ngày tải lên: 20/06/2014, 04:20

... 3. 2. Variational structure and preliminary results In this section, we are going to establish suitable variational structure of (1.1) and giv e some lemmas which will be fundamental importance ... repetition of the proof of Lemma 3.2, we omit the details of its proof. With the aid of above preparations, now we will give the proof of Theorem 1.2. Proof of Theorem 1.2 By(1.8), (2.1), (3.1), and ... 12 15. Agarwal, RP: Difference Equations and Inequalities, Theory, Methods, and Applications. Dekker, New York, 2 (2000) 16. Bin, HH: The application of the variational methods in the boundary problem...

Ngày tải lên: 20/06/2014, 21:20

... 2009. 9 Q. Meng and J. Yan, “Bounded oscillation for second- order nonlinear neutral difference equations in critical and non-critical states,” Journal of Computational and Applied Mathematics, vol. ... nonoscillatory solutions of higher -order nonlinear neutral difference equations,” Journal of Mathematical Analysis and Applications, vol. 280, no. 1, pp. 63–76, 2003. 17 Y. Zhou and B. G. Zhang, ... Methods, and Application, vol. 228 of Monographs and Textbooks in Pure and Applied Mathematics, Marcel Dekker, New York, NY, USA, 2nd edition, 2000. 2 R. P. Agarwal, S. R. Grace, and D. O’Regan,...

Ngày tải lên: 21/06/2014, 11:20

... solutions of parameterized nonlinear operator equations, which is essentially a consequence of Dancer 12, Theorem 2. Suppose that E is a real Banach space with norm ·.LetK be a cone in E. A nonlinear mapping ... Problems, Article ID 410986, 26 pages, 2010. 17 A. Cabada and J. A. Cid, “On the sign of the Green’s function associated to Hill’s equation with an indefinite potential,” Applied Mathematics and Computation, ... resonance case, Problem 1.1, 1.2 has no Green’s function any more. Remark 3.10. It is worth remarking that Cabada and Cid 17, and Cabada et al. 18 have improved the L p -criteria in Torres...

Ngày tải lên: 21/06/2014, 11:20

... Differential Equations Irena Rach ˚ unkov ´ a, 1 Svatoslav Stan ˇ ek, 1 Ewa Weinm ¨ uller, 2 and Michael Zenz 2 1 Department of Mathematical Analysis, Faculty of Science, Palack ´ y University, Tomkova ... numerical calculations on a MATLAB software package bvpsuite designed to solve boundary value problems in ordinary differential equations. The solver is based on a collocation method with Gaussian ... In particular, Theorem 5.6 gives a characterization of a class of nonlinear periodic problems 5. 1a and 5.1b which have only one solution. We begin the investigation of problem 5. 1a and...

Ngày tải lên: 21/06/2014, 20:20

Ngày tải lên: 22/06/2014, 19:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 23/06/2014, 00:20

Ngày tải lên: 28/06/2014, 19:20

... University of South China, Hengyang, Hunan 421001, People’s Republic of China Full list of author information is available at the end of the article Abstract In this paper, we consider the rule of trajectory ... RESEARCH Open Access On a class of second- order nonlinear difference equation Li Dongsheng 1* , Zou Shuliang 1 and Liao Maoxin 2 * Correspondence: lds1010@sina. com 1 School of Economics and Management, ... 2 + ,1 - ,2 + ,1 - , Proof. By Lemma 2.3, one can see that the lengt h of a negative semicycle is at most 3, and a positive semicycle is at most 2. On the basis of the strictly oscillatory charac- ter of the...

Ngày tải lên: 20/06/2014, 22:20

... pages doi:10.1155/2011/845413 Research Article Lagrangian Stability of a Class of Second- Order Periodic Systems Shunjun Jiang, Junxiang Xu, and Fubao Zhang Department of Mathematics, Southeast University, Nanjing 210096, ... <l<p−2, and α, ω > 0 ar e constants. We want to generalize the result in 6 to a class of p-Laplacian-type differential equations of the form 1.9.Themain idea is similar to that in 6. ... The idea is also to change the original problem to Hamiltonian system and then use a twist theorem of area-preserving mapping to the Pioncar ´ emap. The above differential equation essentially possess...

Ngày tải lên: 21/06/2014, 07:20

... S. G. Hristova and D. D. Ba ˘ ınov, “Existence of periodic solutions of nonlinear systems of differential equations with impulse effect,” Journal of Mathematical Analysis and Applications, vol. ... theorems are well known cone theoretic fixed point theorems. See Lakshmikantham 8 for proofs and details. Theorem 2.6. Let X be a Banach space and K a cone in X. Assume that Ω 1 and Ω 2 are bounded ... Research Grant. References 1 S. C. Hu and V. Lakshmikantham, “Periodic boundary value problems for second order impulsive differential systems,” Nonlinear Analysis: Theory, Methods & Applications,...

Ngày tải lên: 21/06/2014, 11:20