0

steady state gain of a system

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Báo cáo khoa học

... per-formance of the GAL system. As KlGal1p plays a dualrole, as both inducer and galactokinase, our analysisindicates that only 10% of total KlGal1p translocatesinto the nucleus to act as inducer, ... used a steady- state modeling approach to quan-tify the underlying molecular mechanism for the GAL system of K. lactis and to obtain a systems’ levelunderstanding of its behavior. The steady- state ... GAL system of K. lactis was validated experi-mentally by obtaining steady- state protein expressionlevels in a wild-type strain and in a mutant strain lack-ing gene KlGAL80. The steady- state...
  • 16
  • 371
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Hóa học - Dầu khí

... been of interest withregard to the fact that practical systems have a limiteddynamic range. However, the synthesis of test signalsthat allow enforcing a signal feature like modulation hasonly ... via a digital-to-analog and an ana-log-to-digital converter. This is omitted for simplici ty inFigure 2.NLMS-based measurement As an improvement of theleast mean squares (LMS) algorithm that ... can also verify that theenvelope of the signal in the bottom subfigure is attenu-ated compared to cases with an inactive noise reductionsubsystem. The additional amount of attenuation shallbe...
  • 20
  • 415
  • 0
Báo cáo y học:

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Y học thưởng thức

... Publisher. All rights reserved Research Paper Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer ... 1N-HCl and again water. The organic layer was dried over Na2SO4 and evaporated. The resulting residue was chromatographed on silicagel by elution with chloroform/ethanol (9 : 1) and further ... the series of images T1 relaxation times were calculated by a non-linear fit (Leven-berg-Marquardt algorithm) of the signal amplitudes using the exponential saturation recovery relation-ship....
  • 11
  • 655
  • 0
Tài liệu Steady State Operation of DC Machines pptx

Tài liệu Steady State Operation of DC Machines pptx

Điện - Điện tử

... RVkIRkITIVRVkIRkITaaafaaaafaefafaf a af a fefn fn fanfn a fne=+ = +ị=== ===()()22If both voltages have rated values then(13)Speed-torque characteristic, with rated voltages applied ... can be neglected and armature voltage is constant and equalto rated. Calculate rated torque and rated power of the machine whose data are given.If the motor now drives a load such that the armature ... the two calculated points.Solution:Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
  • 12
  • 527
  • 1
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngân hàng - Tín dụng

... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically. The ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Kitts and Nevis, St. Lucia, St....
  • 35
  • 481
  • 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Báo cáo khoa học

... obtainedfor the glutaminase reaction in the presence of 0.1 mMeach of UTP and ATP-cS (data not shown). Apparently, thevalue of K a , kcat,1and kcat,2were similar regardless of theactive ... glutaminase activity of L. lactis CTP synthase. (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing substrateconcentrations measured as ... hydrolyze glutamine at a steady- state rate similar to the rate of GTP-activatedCTP synthesis, if the enzyme was incubated in thepresence of GTP, UTP and the nonhydrolyzable ATPanalog ADPNP [8]....
  • 8
  • 698
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx

Báo cáo khoa học

... assimilation and neu- tralization may be compared, is in terms of a class of operations related to unification. The situation in autosegmental phonology is simpler than in syn- tax, in that each feature ... assimilation) are seen as variants of an elementary unification operation over feature tapes (linear unification phonology, LUP). The phenomena analysed are tone terracing with tone-spreading ... languages and suitable formal models for it. The languages investigated are Tern (Gur/Voltaic family, Togo) and Baule (Akan fami- ly, C6te d'Ivoire). Tone languages of other types, in particular...
  • 7
  • 333
  • 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Báo cáo khoa học

... TGAGGAGGGACAAAACCTTGAA 700Reverse TCGGTCACTGCCAGCATTC 700Probe CCAACCACTATATTACACCAATGATGGAGCTGAA 100RanGTPaseS83456 Forward CAACAAAGTGGATATTAAAGACAGGAAAG 300Reverse TGGCAGAAATGTCATAGTACTGAAGATT ... CTCTATGTCGCACCACTGATAACCTGAGACCTT 150Cks2NM_025415 Forward CCGAAGAGGAGTGGAGGAGACT 700Reverse ATATGCGGTTCTGGCTCATGA 700Probe CATGTAATGAACCCATCCTAGACTCTGTTGGACA 150RanBP1NM_011239 Forward TGAGGAGGGACAAAACCTTGAA ... TCCTCACAGACCTCCAGCATCCAGGT 100Cyclin D2NM_009829 Forward CGTACATGCGCAGGATGGT 700Reverse AATTCATGGCCAGAGGAAAGAC 300Probe TTTGTTCCTCACAGACCTCTAGCATCCAGGT 100Cyclin D3NM_007632 Forward AAAGGAGATCAAGCCGCACAT...
  • 13
  • 338
  • 0
báo cáo sinh học:

báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx

Điện - Điện tử

... structures andinteractions of feedback loops, and consists of variablesfor cause and effect, and causal links. A causal link con-nects a cause variable with an effect variable by a linkwith a positive ... 2000.16. Mable A, Marriott J: Steady State. Finding a Sustainable Balance PointInternational Review of Health Workforce Planning Health Human ResourcesStrategies Division. Health Canada; 2001.17. ... num-ber of simulation steps along the time axis. System Dynamics makes extensive use of diagrams,especially of two types: causal loop, and stock and flow.Causal loop A causal-loop diagram identifies...
  • 9
  • 543
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx

Hóa học - Dầu khí

... of multilateral voluntary agreements between landowners of a region.Landscape planningTaking Germany as a case landscape planning is aimedat (1) describing the present state and uses of naturalareas ... uses of naturalareas and landscapes, (2) defining objectives of natureprotection and landscape preservation, (3) evaluate thefactual situation and (4) elaborate measures in view of the defined ... theagricultural planning;2. because the non-GMO farmer must tolerate a cer-tain amount of contamination by GMO pollen, bearsthe burden of proof with regard to economicaldamages through a GMO farmer and...
  • 6
  • 269
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Tài liệu khác

... power system and the batteries are binary, but they are all multi -state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. ... The research on multi -state systems began in the 1970s [4, 5], and gained a lot of researchers’ attention. Many papers have been devoted to estimating the reliability of the multi- state system ... than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached....
  • 4
  • 407
  • 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học

... of galactose signal transduction (Eur. J. Biochem. 271) 4073 A steady- state modeling approach to validate anin vivomechanism of the GAL regulatory network inSaccharomyces cerevisiaeMalkhey ... detail ed mechanisms include thetryptophan and arabinose systems of Escherichia coli andthe phage lambda switch in bacteriophage.The GAL regulatory network in Saccharomyces cerevis-iae is a ... performance of the network. A similar experimentalevaluation of the roles of individual elementary mechanismsin vivo is very difficult and tedious to obtain.Among modeling strategies, steady- state...
  • 11
  • 490
  • 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Báo cáo khoa học

... orcan result in cleavage of the inhibitor and release of activeenzyme. A decreased overall inhibition rate can thus be theresult of a shift of the rate constants of the branched part of mechanism, ... rate at which TPdisappears in time at steady state after the rapid initialincrease. The pronounced biphasic character of the inhibi-tion profiles in Fig. 1A C is explained by the presteady state and ... of this interaction is an inactivation of the PAI-1 pool in thevascular wall by thrombin, making it no longer availablefor interaction with u-PA and VN, which can explain part of the effect of thrombin...
  • 10
  • 483
  • 0

Xem thêm