steady state response of a system

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Ngày tải lên : 29/03/2014, 09:20
... per- formance of the GAL system. As KlGal1p plays a dual role, as both inducer and galactokinase, our analysis indicates that only 10% of total KlGal1p translocates into the nucleus to act as inducer, ... used a steady- state modeling approach to quan- tify the underlying molecular mechanism for the GAL system of K. lactis and to obtain a systems’ level understanding of its behavior. The steady- state ... GAL system of K. lactis was validated experi- mentally by obtaining steady- state protein expression levels in a wild-type strain and in a mutant strain lack- ing gene KlGAL80. The steady- state...
  • 16
  • 371
  • 0
Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Ngày tải lên : 20/06/2014, 22:20
... been of interest with regard to the fact that practical systems have a limited dynamic range. However, the synthesis of test signals that allow enforcing a signal feature like modulation has only ... via a digital-to-analog and an ana- log-to-digital converter. This is omitted for simplici ty in Figure 2. NLMS-based measurement As an improvement of the least mean squares (LMS) algorithm that ... can also verify that the envelope of the signal in the bottom subfigure is attenu- ated compared to cases with an inactive noise reduction subsystem. The additional amount of attenuation shall be...
  • 20
  • 415
  • 0
Tài liệu Steady State Operation of DC Machines pptx

Tài liệu Steady State Operation of DC Machines pptx

Ngày tải lên : 17/12/2013, 14:15
... R V kI R kI T IVR V kI R kI T aaafaaaafa efafaf a a f a f e fn fn f an fn a fn e =+ = + ị = == = = = () () 2 2 If both voltages have rated values then (13) Speed-torque characteristic, with rated voltages applied ... can be neglected and armature voltage is constant and equal to rated. Calculate rated torque and rated power of the machine whose data are given. If the motor now drives a load such that the armature ... the two calculated points. Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
  • 12
  • 527
  • 1
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20
... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically. The ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Kitts and Nevis, St. Lucia, St....
  • 35
  • 481
  • 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Ngày tải lên : 21/02/2014, 15:20
... obtained for the glutaminase reaction in the presence of 0.1 m M each of UTP and ATP-cS (data not shown). Apparently, the value of K a , k cat,1 and k cat,2 were similar regardless of the active ... glutaminase activity of L. lactis CTP synthase. (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing substrate concentrations measured as ... hydrolyze glutamine at a steady- state rate similar to the rate of GTP-activated CTP synthesis, if the enzyme was incubated in the presence of GTP, UTP and the nonhydrolyzable ATP analog ADPNP [8]....
  • 8
  • 698
  • 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Ngày tải lên : 06/03/2014, 09:22
... Ile-Glu-Ala-Arg-p-nitro- anilide (IEARpNA) [31]. ProHP8 Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase activity increased significantly above that of factor Xa alone, which could also ... Kansas State University, Manhattan, KS, USA 2 Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, OK, USA Keywords antimicrobial peptides; innate immunity; Manduca ... b-1,3-glucan (a component of fungal cell walls), but no significant change was observed after injection of a Gram-negative bacterium. Microarray analysis in D. melanogaster has shown increased Spa ă tzle...
  • 15
  • 540
  • 0
Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx

Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx

Ngày tải lên : 18/03/2014, 02:20
... assimilation and neu- tralization may be compared, is in terms of a class of operations related to unification. The situation in autosegmental phonology is simpler than in syn- tax, in that each feature ... assimilation) are seen as variants of an elementary unification operation over feature tapes (linear unification phonology, LUP). The phenomena analysed are tone terracing with tone-spreading ... languages and suitable formal models for it. The languages investigated are Tern (Gur/Voltaic family, Togo) and Baule (Akan fami- ly, C6te d'Ivoire). Tone languages of other types, in particular...
  • 7
  • 333
  • 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Ngày tải lên : 30/03/2014, 20:20
... TGAGGAGGGACAAAACCTTGAA 700 Reverse TCGGTCACTGCCAGCATTC 700 Probe CCAACCACTATATTACACCAATGATGGAGCTGAA 100 RanGTPase S83456 Forward CAACAAAGTGGATATTAAAGACAGGAAAG 300 Reverse TGGCAGAAATGTCATAGTACTGAAGATT ... CTCTATGTCGCACCACTGATAACCTGAGACCTT 150 Cks2 NM_025415 Forward CCGAAGAGGAGTGGAGGAGACT 700 Reverse ATATGCGGTTCTGGCTCATGA 700 Probe CATGTAATGAACCCATCCTAGACTCTGTTGGACA 150 RanBP1 NM_011239 Forward TGAGGAGGGACAAAACCTTGAA ... TCCTCACAGACCTCCAGCATCCAGGT 100 Cyclin D2 NM_009829 Forward CGTACATGCGCAGGATGGT 700 Reverse AATTCATGGCCAGAGGAAAGAC 300 Probe TTTGTTCCTCACAGACCTCTAGCATCCAGGT 100 Cyclin D3 NM_007632 Forward AAAGGAGATCAAGCCGCACAT...
  • 13
  • 338
  • 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx

báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx

Ngày tải lên : 18/06/2014, 17:20
... structures and interactions of feedback loops, and consists of variables for cause and effect, and causal links. A causal link con- nects a cause variable with an effect variable by a link with a positive ... 2000. 16. Mable A, Marriott J: Steady State. Finding a Sustainable Balance Point International Review of Health Workforce Planning Health Human Resources Strategies Division. Health Canada; 2001. 17. ... num- ber of simulation steps along the time axis. System Dynamics makes extensive use of diagrams, especially of two types: causal loop, and stock and flow. Causal loop A causal-loop diagram identifies...
  • 9
  • 543
  • 1
Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx

Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx

Ngày tải lên : 21/06/2014, 01:20
... of multilateral voluntary agreements between landowners of a region. Landscape planning Taking Germany as a case landscape planning is aimed at (1) describing the present state and uses of natural areas ... uses of natural areas and landscapes, (2) defining objectives of nature protection and landscape preservation, (3) evaluate the factual situation and (4) elaborate measures in view of the defined ... the agricultural planning; 2. because the non-GMO farmer must tolerate a cer- tain amount of contamination by GMO pollen, bears the burden of proof with regard to economical damages through a GMO farmer and...
  • 6
  • 269
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38
... power system and the batteries are b inary, but they are all multi -state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. ... than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached. ... Reliability Analysis of a Power System Based on the Multi -State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha,...
  • 4
  • 407
  • 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Ngày tải lên : 07/03/2014, 16:20
... of galactose signal transduction (Eur. J. Biochem. 271) 4073 A steady- state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae Malkhey ... detail ed mechanisms include the tryptophan and arabinose systems of Escherichia coli and the phage lambda switch in bacteriophage. The GAL regulatory network in Saccharomyces cerevis- iae is a ... localization of p rotein in a compartment or shuttling of proteins between compartments. It is evident that a large number of parameters play a role in the response of the GAL system. One may attempt...
  • 11
  • 490
  • 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Ngày tải lên : 23/03/2014, 17:21
... or can result in cleavage of the inhibitor and release of active enzyme. A decreased overall inhibition rate can thus be the result of a shift of the rate constants of the branched part of mechanism, ... rate at which TP disappears in time at steady state after the rapid initial increase. The pronounced biphasic character of the inhibi- tion profiles in Fig. 1A C is explained by the presteady state and ... of this interaction is an inactivation of the PAI-1 pool in the vascular wall by thrombin, making it no longer available for interaction with u-PA and VN, which can explain part of the effect of thrombin...
  • 10
  • 483
  • 0

Xem thêm