steady state characteristics of a system

Ngày tải lên: 22/06/2014, 22:20

... per- formance of the GAL system. As KlGal1p plays a dual role, as both inducer and galactokinase, our analysis indicates that only 10% of total KlGal1p translocates into the nucleus to act as inducer, ... used a steady- state modeling approach to quan- tify the underlying molecular mechanism for the GAL system of K. lactis and to obtain a systems’ level understanding of its behavior. The steady- state ... GAL system of K. lactis was validated experi- mentally by obtaining steady- state protein expression levels in a wild-type strain and in a mutant strain lack- ing gene KlGAL80. The steady- state...

Ngày tải lên: 29/03/2014, 09:20

... been of interest with regard to the fact that practical systems have a limited dynamic range. However, the synthesis of test signals that allow enforcing a signal feature like modulation has only ... via a digital-to-analog and an ana- log-to-digital converter. This is omitted for simplici ty in Figure 2. NLMS-based measurement As an improvement of the least mean squares (LMS) algorithm that ... can also verify that the envelope of the signal in the bottom subfigure is attenu- ated compared to cases with an inactive noise reduction subsystem. The additional amount of attenuation shall be...

Ngày tải lên: 20/06/2014, 22:20

Ngày tải lên: 05/09/2013, 15:28

... R V kI R kI T IVR V kI R kI T aaafaaaafa efafaf a a f a f e fn fn f an fn a fn e =+ = + ị = == = = = () () 2 2 If both voltages have rated values then (13) Speed-torque characteristic, with rated voltages applied ... can be neglected and armature voltage is constant and equal to rated. Calculate rated torque and rated power of the machine whose data are given. If the motor now drives a load such that the armature ... the two calculated points. Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...

Ngày tải lên: 17/12/2013, 14:15

... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically. The ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Kitts and Nevis, St. Lucia, St....

Ngày tải lên: 16/02/2014, 06:20

... obtained for the glutaminase reaction in the presence of 0.1 m M each of UTP and ATP-cS (data not shown). Apparently, the value of K a , k cat,1 and k cat,2 were similar regardless of the active ... glutaminase activity of L. lactis CTP synthase. (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing substrate concentrations measured as ... hydrolyze glutamine at a steady- state rate similar to the rate of GTP-activated CTP synthesis, if the enzyme was incubated in the presence of GTP, UTP and the nonhydrolyzable ATP analog ADPNP [8]....

Ngày tải lên: 21/02/2014, 15:20

... assimilation and neu- tralization may be compared, is in terms of a class of operations related to unification. The situation in autosegmental phonology is simpler than in syn- tax, in that each feature ... assimilation) are seen as variants of an elementary unification operation over feature tapes (linear unification phonology, LUP). The phenomena analysed are tone terracing with tone-spreading ... languages and suitable formal models for it. The languages investigated are Tern (Gur/Voltaic family, Togo) and Baule (Akan fami- ly, C6te d'Ivoire). Tone languages of other types, in particular...

Ngày tải lên: 18/03/2014, 02:20

... Escherichia; Hafnia alvei; diarrhea; neuraminic acid. Hafnia alvei is a Gram negative bacterium and a member of the family Enterobacteriaceae. There are reports of associ- ation of H. alvei with diarrhoea ... of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia Reine Eserstam 1 , Thushari P. Rajaguru 1,2 , Per-Erik Jansson 1 , Andrej ... and it was therefore concluded that the same polysaccharide was present. A hydrolysate of the upper phase, analyzed as alditol acetates, revealed as D -glucose, D -galactose, D -galactosamine, L -glycero- D -manno-heptose, and D -glucosamine...

Ngày tải lên: 24/03/2014, 04:21

... TGAGGAGGGACAAAACCTTGAA 700 Reverse TCGGTCACTGCCAGCATTC 700 Probe CCAACCACTATATTACACCAATGATGGAGCTGAA 100 RanGTPase S83456 Forward CAACAAAGTGGATATTAAAGACAGGAAAG 300 Reverse TGGCAGAAATGTCATAGTACTGAAGATT ... CTCTATGTCGCACCACTGATAACCTGAGACCTT 150 Cks2 NM_025415 Forward CCGAAGAGGAGTGGAGGAGACT 700 Reverse ATATGCGGTTCTGGCTCATGA 700 Probe CATGTAATGAACCCATCCTAGACTCTGTTGGACA 150 RanBP1 NM_011239 Forward TGAGGAGGGACAAAACCTTGAA ... TCCTCACAGACCTCCAGCATCCAGGT 100 Cyclin D2 NM_009829 Forward CGTACATGCGCAGGATGGT 700 Reverse AATTCATGGCCAGAGGAAAGAC 300 Probe TTTGTTCCTCACAGACCTCTAGCATCCAGGT 100 Cyclin D3 NM_007632 Forward AAAGGAGATCAAGCCGCACAT...

Ngày tải lên: 30/03/2014, 20:20

... m M ,2lLdNTPs(10m M each), 0.5 lLeach primer 50 l M . CM-AAT1 was amplied by using RSB-5Â: 5Â-CAAAGAGCACCCTCATTCCAGCC-3Â,andFSD-3Â: 5Â-AGGAGGCAAGCATAGACTTAACG-3Â; CM-AAT2 was amplied with RSB-5Â and FSA-3Â:5Â-GATAATT CCACACCCTCCAATTA-3Â; ... CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates. CM-AAT1 has the same enzyme activity as a strawberry SAAT characterized ... FSA-3Â:5Â-GATAATT CCACACCCTCCAATTA-3Â; the internal standard was amplied with act.5Â:5Â-gcactgaagagcatccggtacttc-3Â and act3Â:5Â-TGGGCACGGAATCTCAGC(TC)-3Â. The PCR programme was one cycle of 2 min at 95...

Ngày tải lên: 31/03/2014, 21:21

... because of the very lean mixture of gaseous-fuel and air at part load, and the associated poor fuel utilization efficiency. In such a case, large portion of natural gas escapes ... n m a n Combustion and emission characteristics of a natural gas-fueled diesel engine with EGR M.M. Abdelaal, A. H. Hegab ⇑ Department of Mechanical Engineering, Al-Azhar University, ... because at low loads, a small amount of natural gas is being utilized, and as the diesel pilot amount is quantifie d as a percentage of its rated value at conventional diesel operation,...

Ngày tải lên: 15/06/2014, 09:26

... structures and interactions of feedback loops, and consists of variables for cause and effect, and causal links. A causal link con- nects a cause variable with an effect variable by a link with a positive ... 2000. 16. Mable A, Marriott J: Steady State. Finding a Sustainable Balance Point International Review of Health Workforce Planning Health Human Resources Strategies Division. Health Canada; 2001. 17. ... num- ber of simulation steps along the time axis. System Dynamics makes extensive use of diagrams, especially of two types: causal loop, and stock and flow. Causal loop A causal-loop diagram identifies...

Ngày tải lên: 18/06/2014, 17:20

... Barcleona, Spain; Michael Herdman, Lola Sanz, Josep-Mar a Manresa, Insight Consulting & Research, Barcelona, Spain; Mar a José Rosales, Medical Affairs, Schering-Plough, Madrid, Spain; Vanesa González, ... Hospital Vall de Hebrón, Barcelona, Spain; Ramona Soler, Allergology Department, Hospital Son Dureta, Palma de Mallor ca, Spain; Mê Teresa Audicana, Allergy Service, Hospital de Santiago, Vitoria, Spain; ... Fundación Jiménez Díaz, Madrid, Spain; Pablo Amat, Alfonso Malet, Allergology Unit, Al.lergocentre, Barcelona, Spain; Ignacio Antépara, Ignacio Jauregui, Allergology Department, Hospital de Basurto,...

Ngày tải lên: 20/06/2014, 15:20

... resistivity and the stronger adhe- sion of the printed Ag nanopaste. Additional material Additional file 1: The parameters of scratch test. A table listing the detailed scratch parameters. Abbreviations DSC: ... South Korea) was composed of Ag nanoparticles with a mean size of 24 nm, which were dispersed in a- terpineol matrix at a solid loading of 73% by weight. The shape of the Ag nanoparticles was examined ... Ag nanopaste drastically changed from discrete and spherical Ag nanoparticles to continuous and con- solidated ones. Figure 5 plots the variation in the apparent density of the Ag nanopaste as...

Ngày tải lên: 20/06/2014, 23:20

... of multilateral voluntary agreements between landowners of a region. Landscape planning Taking Germany as a case landscape planning is aimed at (1) describing the present state and uses of natural areas ... uses of natural areas and landscapes, (2) defining objectives of nature protection and landscape preservation, (3) evaluate the factual situation and (4) elaborate measures in view of the defined ... the agricultural planning; 2. because the non-GMO farmer must tolerate a cer- tain amount of contamination by GMO pollen, bears the burden of proof with regard to economical damages through a GMO farmer and...

Ngày tải lên: 21/06/2014, 01:20

Ngày tải lên: 21/06/2014, 17:20

Ngày tải lên: 21/06/2014, 17:20

Ngày tải lên: 22/06/2014, 23:20