state of stress at a point plane stress
Mechanics of material
... Mechanics of Materials Second Edition Andrew Pytel The Pennsylvania State University Jaan Kiusalaas The Pennsylvania State University Australia • Brazil • Japan • Korea • Mexico • Singapore • Spain ... 293 a Reference planes 293 b State of stress at a point 294 c Sign convention and subscript notation 294 8.5 Transformation of Plane Stress 295 a Transformation equations 295 b Principal stresses ... Properties of Mohr’s circle 307 c Verification of Mohr’s circle 308 8.7 Absolute Maximum Shear Stress 314 a Plane state of stress 315 b General state of stress 316 8.8 Applications of Stress Transformation...
- 576
- 2,572
- 0
Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot
... the polyadenylated tail) Characteristic features of other C reinhardtii cDNA clones, e.g a high average G/C content (62.1%) and a putative polyadenylation signal (TGTAA, 727-bp downstream of the ... them showed an increased signal under anaerobic conditions (data not shown) Database comparisons (using GenBank/EBI DataBank) confirmed that eight of these cDNA fragments are similar to genes ... Automated Edman degradation was performed with an Applied Biosystem model 477 A sequencer with online analysator model 120 A RNA blot hybridization Total nucleic acids were isolated from algae...
- 11
- 469
- 0
báo cáo hóa học:" Research Article On a Perturbed Dirichlet Problem for a Nonlocal Differential Equation of Kirchhoff Type" docx
... & Mathematics with Applications, vol 49, no 1, pp 85–93, 2005 A Bensedik and M Bouchekif, “On an elliptic equation of Kirchhoff-type with a potential asymptotically linear at infinity,” Mathematical ... Analysis: Theory, Methods & Applications, vol 7, no 8, pp 827–850, 1983 11 B Ricceri, A general variational principle and some of its applications,” Journal of Computational and Applied Mathematics, ... Boundary Value Problems Y Yang and J Zhang, “Positive and negative solutions of a class of nonlocal problems,” Nonlinear Analysis: Theory, Methods & Applications, vol 122, no 1, pp 25–30, 2010 A Ambrosetti,...
- 10
- 361
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, ... functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach spaces,”...
- 7
- 257
- 0
Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc
... AGG CAG T CAT GCT AAG AAT TGA GTT AAT AAT AGG CTC GGT TCC CTT CC Ang-2 CGC TCG AAT ACG ATG ACT CG TGC AGA GGC TGC AAG TGC TGG AGA A CCA CTG AGT GTT GTT TTC CAT GAT Tie1 GCC ACG TTC TGG CTG GAT ... interaction between these two pathways Ang-1 modulates VEGF-stimulated reorganization of endothelial cells and promotes vascular network maturation [9,20] Additionally, both Ang-1 and VEGF are ... Burlingame, CA, USA) and diaminobenzidine (Kirkegaard and Perry, Gaitherburg, MD, USA) as a chromogen [11,12] The polyclonal antibodies, goat antihuman Ang-1 and Ang-2, and rabbit antihuman Tie1 and...
- 9
- 424
- 0
Báo cáo y học: "Differential expression of the FAK family kinases in rheumatoid arthritis and osteoarthritis synovial tissues" doc
... zone, activated by ligation of alpha(v)beta3 integrin, and phosphorylated by src kinase J Clin Invest 1998, 102:881-892 20 Nakagawa M, Kaneda T, Arakawa T, Morita S, Sato T, Yomada T, Hanada K, ... citation purposes) Arthritis Research & Therapy Vol No Shahrara et al 36 Tanaka S, Takahashi N, Udagawa N, Murakami H, Nakamura I, Kurokawa T, Suda T: Possible involvement of focal adhesion kinase, ... normal ST lining (arrow) and subsynovial macrophages (arrowhead) (d) The quantification of data obtained from a, b and c Bars represent the mean and SEM Inflam, inflammatory score; Vasc, vascularity...
- 10
- 393
- 0
Báo cáo y học: ": Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes" doc
... the ASC formed aggregate Distinct ASC isoforms can either activate or inhibit inflammasome-mediated maturation of IL-1β Figure Localization of ASC isoforms Subcellular localization of the myc-tagged ... that caspase itself would cause oligomerization of ASC and caspase activation The proposed mechanism suggests that NTPmediated NLR oligomerization causes aggregation of ASC and clustering of caspase ... Gout-associated uric acid crystals activate the NALP3 inflammasome Nature 2006, 440:237-241 Omi T, Kumada M, Kamesaki T, Okuda H, Munkhtulga L, Yanagisawa Y, Utsumi N, Gotoh T, Hata A, Soma M, et al.: An...
- 13
- 231
- 0
Báo cáo khoa học: "Associations between the time of conception and the shape of the lactation curve in early lactation in Norwegian dairy cattle" pptx
... gives a mean calving to first artificial insemination (AI) time of 86.9 days This database includes 97% of all Norwegian dairy cows [1] The lactation curve in dairy cattle describes the pattern of ... NDHRS, which is a single database containing production data, veterinary diagnoses, information on AI and Page of treatments [1] Daily milk yield and daily amount of concentrates fed are recorded ... magnitude of the negative energy balance (NEB) in early lactation are crucial to conception [25,26] A steep ascending slope of the lactation curve may be indicative of adequate energy Andersen et al Acta...
- 8
- 305
- 0
Báo cáo y học: "usceptibility to glaucoma: differential comparison of the astrocyte transcriptome from glaucomatous African American and Caucasian American donors" pot
... Additional data file Demographic and clinical data for AA donors with glaucoma (AAGs) and CA donors with glaucoma (CAGs) included in the microarray analyses and other assays are detailed in Additional ... migration and the myosin regulatory network in glaucoma astrocytes (a) Cell migration assay shows that AA and AAG astrocytes migrate significantly faster than CA and CAG astrocytes The assay was performed ... standard cAMP assay in normal AA and CA astrocytes and in AAG and CAG astrocytes Under unstimulated conditions, normal AA and CA astrocytes exhibit no difference in basal levels of cAMP, whereas AAG...
- 19
- 298
- 0
Báo cáo hóa học: " Research Article The Existence of Positive Solution to a Nonlinear Fractional Differential Equation with Integral Boundary Conditions" potx
... Applications, vol 302, no 1, pp 56–64, 2005 V Daftardar-Gejji and S Bhalekar, “Boundary value problems for multi-term fractional differential equations,” Journal of Mathematical Analysis and Applications, ... Devi, Theory of Fractional Dynamic Systems, Cambridge Academic, Cambridge, UK, 2009 V Lakshmikantham and A S Vatsala, “Basic theory of fractional differential equations,” Nonlinear Analysis Theory, ... & Applications, vol 69, no 8, pp 2677–2682, 2008 V Daftardar-Gejji, “Positive solutions of a system of non-autonomous fractional differential equations,” Journal of Mathematical Analysis and Applications,...
- 14
- 430
- 0
báo cáo hóa học:" Research Article Biorthogonal Systems Approximating the Solution of the Nonlinear Volterra Integro-Differential Equation" doc
... 287–296, 2009 15 Y Song and C T H Baker, “Qualitative behaviour of numerical approximations to Volterra integrodifferential equations,” Journal of Computational and Applied Mathematics, vol 172, no ... integro-differential equations,” Journal of Computational and Applied Mathematics, vol 15, no 3, pp 301–309, 1986 H Brunner, A survey of recent advances in the numerical treatment of Volterra integral and ... A I Garralda-Guillem, M Ruiz Gal´ n, and M C Serrano P´ rez, a a e “Analytical techniques for a numerical solution of the linear Volterra integral equation of the second kind,” Abstract and Applied...
- 9
- 336
- 0
Numerical Solutions of the Black Scholes Equation
... to the partial differential equation we started with (the heat equation), and not some other equation This may sound rather fanciful, so let us take a closer look at the Dufort and Frankel scheme ... necessary The first reason is simply that it is easier to have an intuitive feel for a calculation if you are dealing with observable quantities rather than with complicated transforms; in any case, ... quickly, and later discover that there is a round-about way of avoiding the whole issue (iii) Stability: Suppose we have set up some discretization scheme to solve the heat equation; we have calculated...
- 18
- 373
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG GATTTAAGTGGAGCGGAATGCTA A1 F A1 R B13R ... forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ... between 60 and 72 °C) Rate constant of thermal inactivation (80 at 70 °C) Urea inactivation (10 at 20 °C) Heat capacity at 25 °C Calorimetric enthalpy of denaturation (scanning rate °CÆmin)1 at pH...
- 11
- 662
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... previously [38] c After SDS/PAGE and transfer onto nitrocellulose paper of chromatophores and known amounts of isolated Rb capsulatus ATP synthase, the unknown amount of ATP synthase was evaluated by detecting ... concentration was evaluated by adding 100–200 nM standard ATP in each cuvette The basic solution was thermostated so that the ATP synthesis reaction took place at 13 °C The pH measured after mixing ... mutant chromatophores (A) ACMA fluorescence quenching as a function of time after addition of ATP The original recorder traces have been digitalized and data points have been fitted with arbitrary...
- 9
- 580
- 0
URBAN AIR POLLUTION: AN ANALYSIS OF THE ENVIRONMENTAL KUZNETS CURVE IN ASIAN CITIES docx
... conversion factor is used The data was sourced from World Bank national accounts data, and OECD National Accounts data files Using this data, the lagged variables were easy to determine (World Bank, ... independent variable on the change in the pollutant A positive coefficient means that an increase in the rate of change of per capita GDP results in a similar increase in the rate of change of pollutant ... decreased at approximately $500 (US) GNI per capita (Peters & Murray, 2006) The study may indicate that for urban air pollution in Asian cities, the typical EKC shape may not be applicable The data...
- 51
- 500
- 0
Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt
... Sci USA 105, 11224–11229 19 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimoto RI & Nagata K (1997) HSF4, a new member of the human heat shock factor family which lacks properties of a transcriptional ... head-to-head and tailto-tail repeats of a conserved bp recognition unit Cell 59, 797–806 30 Hashikawa N, Mizukami Y, Imazu H & Sakurai H (2006) Mutated yeast heat shock transcription factor activates ... 23 Tanabe M, Sasai N, Nagata K, Liu XD, Liu PC, Thiele DJ & Nakai A (1999) The mammalian HSF4 gene generates both an activator and a repressor of heat shock genes by alternative splicing J Biol...
- 13
- 507
- 0
Báo cáo khoa học: Molecular dynamics of the DNA-binding domain of the papillomavirus E2 transcriptional regulator uncover differential properties for DNA target accommodation pdf
... b-strand conformations are indicated by the black and gray squares, respectively translational and rotational movement, and was carried out on the Ca atoms of the proteins Large displacements occurred ... central part, partially lose secondary structure, as indicated by the dssp analysis in the simulation (Fig 3A, B) This feature provides an adaptability to the DNA interaction sites that compensates ... standard pulse schemes [41,42] 15N relaxation data were analyzed in terms of model-free formalism, making use of the program dasha [43] Relaxation experiments were carried out at 30 °C on a Bruker...
- 11
- 398
- 0
- tangent plane to a surface at a point
- advantages of working at a fast food restaurant
- physical state of water at room temperature
- physical state of water at 20 degrees celsius
- physical state of water at 100°c
- physical state of water at 15 degree celsius
- physical state of water at 257 degree celsius
- physical state of water at 25 degree celsius
- 1 2 stress at a point
- figure 1 23 stress at a point
- 1 in your own words describe stress at a point and how it differs from stress on a surface
- 1 stress at a point is a vector like stress on a surface
- general state of stress
- plane state of stress
- state of stress at a point
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25