standardization of the measurement of c and d
Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx
... Total content of C (Qc) comprised old C (Qc, old, incorporated before day 0) and new C (Qc, new, incorporated after day 0) contents [4]: Qc = Qc, old + Qc, new where Qc, old = Xc × Qc with at day ... – AC , unlabelled% ) × 100 Isotopic abundance for C (AC%) of each seedling component between the end of the labelling period (day 0) and the last day of the chase period (day 41) depended on ... affected neither the Ci/Ca ratio nor Ψwp (Figs 2B and 2D) but decreased both A and g (Figs 2A and 2C) 3.2 Changes in total C and N after transplanting Lifting caused significant changes in C concentration...
- 11
- 399
- 0
C++?? A Critique of C++ and Programming and Language pot
... A class definition contains all knowledge of accessed classes and their dependencies (inheritance and client) in the class text Dependency analysis is derivable from the class text, and much of ... knows exactly whether the object is expanded or referenced, and thus the dot accessor is used for both, so uniform access is provided, and the access mechanism is hidden This makes the program ... trivialities which the compiler should handle; and they avoid many of the flaws and inanities of C/ C++ The language events which have made an update desirable are the introduction of Java, the wider availability...
- 63
- 511
- 0
Đo kiểm đánh giá can nhiễu mạng truyền hình cáp The Measurement and Analysis of the effect of interference in Television Cable network
... ROHDE & SCHWARZ - SOUND and TV BROADCASTING – CCIR and FFC tv standards – Printed in the federal republic of Germany 18 3GPP2 C. S0011 -C, version 2.0 – Recommended Minimum Performance Standards ... (DVB); Second generation framing structure, channel coding and modulation systems for Broadcasting, Interactive Services, News Gathering and other broadband satellite applications (DVB – S2) 14 ... thiểu 0.5m) Bƣ c 2: Đo khoảng c ch h1, h2 tính khoảng c ch d1 sau đo khoảng c ch d2 thƣ c d y Bƣ c 3: Triển khai thiết bị đo điểm c ch chân c t đặt thiết bị c n đo khoảng c ch d2 , anten thu đo...
- 10
- 853
- 2
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... conserved cysteines in PDGFA and -B, PDGF -C contains four and PDGF -D two additional cysteines These extra cysteines and the lack of solved PDGF -C and -D 3D structures makes identification of the cysteines ... this debate, but our published 3D model of the PDGF -C growth factor domain indicates the disulfide bridges in PDGF -C to consist of Cys250 and 294, Cys280 and 335, and Cys287 and 337, and the intermonomeric ... induced by bleomycin, no change in the mRNA expressions of the classical PDGF -C and -D, structure and function PDGFs were detected, while PDGF -C and -D mRNA levels changed dramatically [84] Concomitantly,...
- 19
- 557
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the ... sequence retrieved from the GenBank database under accession number L04347, and NcoI or BamHI sites (underlined) and the initiation codon (bolded) were introduced into the sequences The cDNA subcloned ... 5¢-RACE [37] from the striated adductor muscle As a result, two cDNA clones encoding isoforms, namely 52K-TnI and 19K-TnI [27], were obtained The deduced amino acid sequence of 19K-TnI was identical...
- 12
- 514
- 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ ... 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation of the 1.6 ... 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs were transfected into T2 cells by electroporation using a Bio-Rad gene pulser...
- 16
- 407
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under ... re-exposed to normoxic conditions for an additional period of h Collection of cells and fractionation At the end of the culture period, the cells were rapidly chilled on ice and were rinsed twice with ... aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme deficient conditions [11] The coexpression of speci c subunit V and cytochrome c isoforms...
- 9
- 554
- 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx
... All other compounds of Scheme were synthesized following described procedures, with modifications as specified in Materials and Methods All compounds were characterized by 1H-NMR and 1 3C- NMR spectroscopy ... epoxide 3a, the C- 6 isothiocyanate 1e and the C- 1 isothiocyanate 3d, and then the residual uptake activity was determined (see Table 4) The C- 6 bromoacetyl compounds 1a and 1c completely blocked uptake ... In the presence of Glc, the rates of EIIGlc inactivation by 1a and 1c increased 18-fold and 27-fold, respectively This effect of Glc is speci c for Fig Glucose-sensitized inactivation of [1 4C] sugar...
- 12
- 720
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... sequence of the human B2wt starting with the third encoded methionine [9], the sequence of the human B1wt, truncations and chimeras of both were cloned into the BamHI and the XhoI sites of the pcDNA5 ... tyrosine of this sequence is identified as Y7.53 Construction of mutated B1wt, B2wt and of the B1 ⁄ B2 receptor chimera Standard PCR techniques using either receptor-speci c or chimeric primers with the ... TP & Hofmann KP (2000) Mutation of the fourth cytoplasmic loop of rhodopsin affects binding of transducin and peptides derived from the carboxyl-terminal sequences of transducin alpha and gamma...
- 12
- 595
- 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt
... (domain closure), and intradomain and side-chain conformational changes, occur upon binding of ATP and nucleic acid to ensure ATPase activity Analysis of the mode of binding of ATP in the HCV ... forward, 5¢-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased from Sigma), and the pKK plasmid as a template [32] The resulting fragment was cloned into ... level of enzyme activity, as determined with the DNA substrate under conditions described above Effect of preincubation of compounds with enzyme on unwinding and hydrolysis efficacy The selected enzyme...
- 9
- 659
- 0
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx
... designed: 5¢-TGAGATGTGCCAGCTGAGGTTCA-3¢ for I282Q (forward), 5¢-CAACGCCCAGCATACCCAGCAGT-3¢ for Q404H (forward), 5¢-CAACGCCCAGGCAACCCAG CAGT-3¢ for Q404A (forward), 5¢-TGAACCTCAGCT GGCACATCTA-3¢ for I282Q ... 5¢-TCGAGCTGTGTATACTGAGATTCA-3¢ for Q285I, 5¢-TCAATGCTCAGCAGACCCAGCGGC-3¢ for H407Q, 5¢-TCAATGCTCAGGCCACCCAGCG GC-3¢ for H407A The selection restriction site mutation was created by primer 5¢-GTAGCTGACTGGAGCATG ... mechanism of ligand binding and activation of PXR by modeling and site-directed mutation of the PXR ligand binding domain (LBD) In particular, we wanted to identify residues responsible for the...
- 9
- 552
- 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... [33] was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) ... PPi At the end of each reaction, lgặmL)1 gramicidin D was added to stop the uorescence quenching of acridine orange (C) Topological model of V-PPase Cylinders 116 indicate membrane-spanning domains ... translocation Truncation of the C- terminus induces a dramatic decline in V-PPase enzymatic activity, proton translocation, and coupling efciency [9] In addition, deletion of the C- terminus of V-PPase...
- 14
- 332
- 0
Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc
... lm MccJ25 markedly increased the oxidation of NADPH compared with a control in the absence of the peptide EDTA, RR and ascorbic acid completely inhibited the effect of MccJ25 Surprisingly, CsA, ... swelling induced by MccJ25 The inhibition of swelling induced by ascorbic acid will be discussed later As a positive control, the swelling and calcein release induced by calcium, and the inhibitory ... energized mitochondria The addition of 20 lm MccJ25 induced the swelling of energized mitochondria (Fig 2) The kinetics of swelling during a period of h had a linear pattern characteristic of MTP induction,...
- 9
- 286
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... suggested that production of the b-aryl ether cleavage enzyme might be induced under speci c conditions Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU ... wood chips as the sole carbon source In addition, 2BW-1 also grew in the lignin-related compounds, p-hydroxybenzoic acid, gallic acid and vanillic acid, as a sole source of carbon Cell growth and ... linkage The enzymatic activity was not detected until cultures were 6-days-old In 7-day-old cultures, we detected weak activity The activity increased for more days and then decreased (data not shown)...
- 10
- 670
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
... synthase D1 D3 455 D2 289 316 D3 344 D3 405 D3 535 D2 495 D2 + + + + + + + + + + 1025 CD CD + D1 23 CD CD + D2 3 CD CD + D3 CD CD + D2 CD CD + D1 CD CD + St2.1 CD CD + St2.2 CD CD + St2.3 CD CD + St3.3 ... St3.3 CD CD + St3.2 W366A D1 x D2 D3 CD CD -D1 23W366A D3 CD CD -D1 23Y394A D3 CD CD -D1 23W366AY394A Y394A D1 D2 x W366A Y394A D1 x x D2 W366A D1 x D3 D2 + CD CD + D1 23W366A D3 + CD CD + D1 23Y394A D3 ... the pull-down technique to demonstrate the direct interaction of D1 23 with CD SBD SSIII-CD 22 1025 D1 D2 D3 405 CD -D1 23 CD CD-St2.1 D3 344 CD D3 316 CD CD-St2.2 D3 CD 22 CD-St2.3 575 576 D1 D2 ...
- 13
- 457
- 0
![Báo cáo khoa học: Investigation of the interaction between the atypical agonist c[YpwFG] and MOR docx](https://media.store123doc.com/images/document/14/rc/ht/small_57MlXT7HZ5.jpg)
Báo cáo khoa học: Investigation of the interaction between the atypical agonist c[YpwFG] and MOR docx
... stereochemistry array The structure of compounds (lddll or lddld), (lddld), and (lddll) can be tentatively compared to that of lddll or lddld cyclopentaalanine models [27] Therefore, compounds 3, and ... description of the binding mode and the electronic and steric properties of the c[ YpwFG] ligand Results Synthesis and pharmacological characterization of the cyclopeptides c[ YpwFXaa] We synthesized compound ... a receptor upon ligand binding, a more detailed description of the binding mode of the ligand, and, in the case of QM methods, a complete description of reaction mechanisms and electronic properties...
- 23
- 308
- 0
Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx
... prepared and expressed in the baculovirus system The mutants were incubated with [1-1 4C] arachidonic acid in the presence of SnCl2 and the products were analysed by TLC (Figs and 3, and Table ... that the other 16 residues lie outside of the active site and mostly on the surface of the catalytic globular domain of the COX protein Protein expression and product analysis The cDNA was cloned ... sequenced entirely All clones had an ORF of 1776 nucleotides corresponding to 592 amino acids The deduced amino acid sequence of novel COX is 97% identical with the COX sequence from the same coral...
- 6
- 414
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... nonspeci c DNA is added, it will compete for the speci c factor of interest and the level of the speci c complex will decrease Binding reactions were performed using 100 lg RNE -d and ng labelled ... physiological conditions and may vary between cell types All of the studies to understand c- jun transcriptional regulation have been conducted in cultured cells which not mimic in vivo conditions The ... Council of Scienti c and Industrial Research (CSIR), India to A .D CSIR, India is duly acknowledged for the Senior Research Fellowships to D. S and S.O The technical assistance of S Singh is sincerely...
- 9
- 449
- 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... species including the completely sequenced model organisms We obtained a human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative ... 505 and 525 nm for fluorescence detection as described previously [9] The genomic DNA sequences of the canine and murine NICN1 genes were determined from genomic BAC or PAC clones and submitted ... (5¢-CAT CACCACTGTGGCTGTC-3¢) and NICN1_R555 (5¢-CTCTGTCAGTGCCCACATC-3¢) and an annealing temperature of 60 C This experiment was performed two times independently In control experiments glyceraldehyde3-phosphate...
- 6
- 450
- 0
Báo cáo khoa học: Regulation of the muscle-specific AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx
... dependence of the R225Q variants of c3 would lead to the increased glycogen content described in the skeletal muscle of the carriers of this mutation [25,30] Also, we did not detect any difference ... Goldstein EG, Edelman AM, Carling D & Hardie DG (1995) 5¢-AMP activates the AMP-activated protein kinase cascade, and Ca2+ ⁄ calmodulin activates the calmodulin-dependent protein kinase I cascade, ... expressed relative to the activity of the wild-type AMPK complexes measured in the absence of AMP (the activity of the wild-type complex without AMP is set to 1) (C) The activity of the wild-type and...
- 10
- 553
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25