specific co transfection experiments were done in different cell lines such as cho cos 7 and lncap the hormone used for induction was mb at doses of 1nm fig 8 with cho cells a 3 fold induction was achieved after hormomal exposure
Trinucleotide (CAG) repeat polymorphism of the androgen receptor gene in human disease
... parameters were assessed according to standard criteria and were calculated by taking the mean of at least two analyses done months apart Azoospermia was defined as the absence of any spermatozoa ... receptor coactivator (SCR) family such as the human SRC-1 (Li et al., 19 97) The Type II coactivators modulate the appropriate folding of the AR and its ligand, and facilitate the AR NH2/COOH-terminal ... 174 bp, and the GGC repeats stretch at position 13 47 bp 10 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA G (CAG)n (GGC)n No of bp 174 13 47 1611 11 Conservation of segments of...
- 256
- 456
- 0
Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx
... pellet the debris, and the supernatant was used for immunoprecipitation and kinase assays The human renal carcinoma 293T cells were also transfected using OPTIMEM and Lipofectamine, cells were ... OX-44 antigen ligation with the mAb MRC OX-44 [6, 37 ] The signal generated appeared to implicate PKC in the IR 938 F cell line [ 37 ] , and in normal rat macrophages also there was generation of diacylglycerol ... and was normalized with respect to the amount of the HA epitope present in the HA-JNK immunoprecipitate used for the kinase assay The magnitude of the increase in activity was fourfold in all cases,...
- 10
- 517
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
... GenBank accession number AB000450) based on human VRK2 [7] VRK 2A: 5¢CCCGGATCCATGCCACCAAAAAGAAATGAAAAAT ACAAACTTCC -3 (nucleotides 130 –165), this primer has the initiation codon and a BamH1 cloning ... be associated with membranes Cos1 cells were transfected with each of the constructs and the location of the transfected protein was determined with an anti-HA serum Isoform VRK 2A was localized ... acetylation-precipitation buffer with TSA, and p 53 was immunoprecipitated with a mix of DO1 and Pab240 antibodies The acetylation of p 53 in residues Lys 37 3 and Lys 38 2 was determined with a specific...
- 18
- 333
- 0
báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx
... to the inserted cDNA fragment the “canonical adaptor region” (5’TTGTAAAACGACGGCCAGTGAATTGTAATACG ACTCACTATAGGGCGAATTGGGTACCGGG CCCCCCCTCGAGGTATAAGCTTGATATCGAAT TCCGTTGCTGTCG -3 ), “2variant39” ... TAGTGAGGGTTAATTTCGA GCTTGGCGTAATCATGGTCATAGCTGTTTCC -3 ) and the variant (5’-GATCAGCGGCCGCCACCGCGG TGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGG GTTAATTTCGA GCTTGGCGTAATCATGGTCATAGCTGTTTCC -3 ) sequences were added ... cgi?ORG=Vvi&LID=22 274 [85 ] Datasets used, clustering analysis and annotation All available V vinifera sequences (including ESTs, expressed transcripts as well as other available DNA sequences in the NCBI database)...
- 23
- 403
- 0
Báo cáo y học: " Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology" pptx
... Evidence of off-target effects associated with long dsRNAs in Drosophila melanogaster cell- based assays Nat Methods 2006, 3 : 83 3 - 83 8 Ma Y, Creanga A, Lum L, Beachy PA: Prevalence of off-target effects ... hit rate was similar to that determined in a related screen [14], but varied considerably across lines (Figure 2a; Additional data file 3) Much of the variation in hit rates across cell lines ... Drosophila kinase RNAi library and to estimate false positive and false negative rates in the screen (Additional data file 1); estimates of screen false positive and negative rates (Additional data file...
- 9
- 251
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... normalized luciferase activity obtained with pGL3Basic; the normalized luciferase activity used was that in cells treated with siGAPDH in (A) and that in cells untreated with hemin in (B) The data ... siRNA: sense, 5¢-AGGACUUCUUGAAAGGCAA CAUUAAAG -3 , antisense, 3 -UAUCCUGAAGAACUU UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense, 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG -3 , antisense, 3 -UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢ ... levels in human cell lines HeLa cells (A and B) and HepG2 cells (C and D) were left untreated or treated with SA (5 mM) for the indicated time and harvested The upper panels in (A) and (C) show the...
- 14
- 487
- 0
Báo cáo khoa học: Internalization of cystatin C in human cell lines docx
... capacity in cell lysates was determined by measuring the inhibition of papain as well as cathepsin B To measure the capacity of the cell lysate to inhibit papain, 88 lL buffer mix as above, containing ... determine the concentration of active papain used in the assay, a fixed amount of enzyme was incubated with various concentrations of E-64 A titration curve was drawn and the amount of active papain calculated ... substantially as the concentration of the unlabelled inhibitor increased (Fig 7A) , indicating an active and specific pathway for cystatin C internalization C Internalization of cystatin C variants...
- 12
- 389
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... in the negative control (none) without stimulation (Fig 7A) In RAW264 .7 cells, the activation was clearly observed at and h after LPS stimulation but no more clearly at h, and the activation after ... 0. 18 M H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay ... Production of IFN-c and IL-12p70 (active form) was determined as the amount in the culture supernatant obtained 24 h after stimulation The concentration of each cytokine was measured using a specific sandwich...
- 10
- 395
- 0
Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx
... (Matsunami, Osaka, Japan) After incubation, PMA was added to a final concentration of 100 ngÆmL)1 After 15 at 37 °C, the mixture in each dish was gently aspirated, and mL of 3 .7% formaldehyde in NaCl ⁄ ... concentration of the oxidant in the samples was calculated using the standard curve, which was made by adding known concentrations of the authentic H2O2 instead of the samples Visualization of p47phox ... be applicable as an anti -in ammatory drug for the treatment of various in ammatory diseases [24– 28] It is possible that other organic selenium compounds may also become candidates as anti -in ammatory...
- 9
- 331
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... regression For radiotracer assays, protein was measured by the bicinchoninic acid assay [25] with bovine serum albumin as standard The protein content of MS samples was estimated from the response ratio ... were used for uptake experiments at a confluence of at least 70 % Uptake was measured at 37 °C After preincubation for at least 20 in mL of uptake buffer (in mmolÆL)1: 125 NaCl, 25 Hepes–NaOH pH 7. 4, ... fluorescence intensity However, with OCT1h (Fig 3B) and OCT2h (not shown) we obtained inadequate ratios; for our assays, we aim for at least a 10 : ratio It was reasoned that with some cDNAs, even the...
- 8
- 331
- 0
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx
... to attach and then incubated at 37 C with dasatinib at varying concentrations for 24 hours Cells were stained with crystal violet and the number of invading/migrating cells was estimated by counting ... alone and in combination with dasatinib, migration/invasion assays and cell cycle assays P < 0.05 was considered statistically significant ANOVA one way analysis was performed to compare dasatinib ... Effect of imatinib on proliferation) Dasatinib in combination with chemotherapy The effect of dasatinib in combination with chemotherapy was examined in the three dasatinib responsive cell lines, ...
- 11
- 476
- 0
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... percentage of cells in S phase and G2/M phase decreased (Table 2) In addition, there was also an increase in apoptosis after SU11 274 treatment These data indicated that SU11 274 could induce G1 cell ... monolayer was scratched with a pipette tip and washed with phosphate buffered saline (PBS) to remove floating cells The scrape was monitored and photographed after 24 h incubation Trans-well assay ... from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), (moderate) and (intense) The positive rate score was (0-10%), (10 -30 %),...
- 10
- 402
- 0
Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf
... the combination of vemurafenib and metformin in a subset of melanoma cell lines independent of the BRAF mutational status After evaluating the response of the differentially mutated melanoma cells ... to each drug alone, both drugs were combined in constant ratios to each other Among the 11 BRAFV600E mutant cell lines, in cell lines the combination was antagonistic and in cell lines it was ... shown The black line represents the data obtained with vemurafenib treatment, the blue line with metformin, and the red line with combination treatment b) Combination index for the combination of...
- 13
- 518
- 0
Báo cáo hóa học: " Expression of frog virus 3 genes is impaired in mammalian cell lines" pot
... (Invitrogen), 0.1 mM dNTPs, 0.2 mM of FV 37 5 L-forward (5'-AAGCTTATTA AAGATGGACGACAAG3') and FV3 -75 L-reverse (5'CTCGAGCTACAGATCTTCTTCAGAAATAAGTTTTTGTTCTAAAATTTTGTA CACAAACAC -3' ), and 2.5 U of Taq ... infected with FV3 at a multiplicity of infection (MOI) of FV3 was obtained from the American Type Culture Collection (ATCC; Manassas, VA) and was propagated on FHM cells (ATCC) grown in modified Eagle's ... at 37 C with 5% CO2 Once infected with FV3, all cells were incubated at 30 °C At various time points post-infection, cells were fixed in 3 .7% paraformaldehyde in phosphate buffer saline (PBS) for...
- 7
- 308
- 0
báo cáo hóa học:" Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... percentage of cells in S phase and G2/M phase decreased (Table 2) In addition, there was also an increase in apoptosis after SU11 274 treatment These data indicated that SU11 274 could induce G1 cell ... monolayer was scratched with a pipette tip and washed with phosphate buffered saline (PBS) to remove floating cells The scrape was monitored and photographed after 24 h incubation Trans-well assay ... from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), (moderate) and (intense) The positive rate score was (0-10%), (10 -30 %),...
- 10
- 373
- 0
Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt
... Methylation data were obtained using the Illumina HumanMethylation 27 DNA Analysis BeadChip assay Methylation estimates were assayed using two technical replicates per individual and methylation ... point was the location of the methylation probe Each annotation category that we examined was included in the model while accounting for distance effects Genome annotations Genome annotation data ... association of genetic variants with disease Materials and methods Methylation data DNA was extracted from lymphoblastoid cell lines from 77 individuals from the Yoruba (YRI) population from the International...
- 13
- 396
- 0
báo cáo khoa học: "Effect of arginase II on L-arginine depletion and cell growth in murine cell lines of renal cell carcinoma" pptx
... amplification was done using primers for mouse arginase I, arginase II, and β-actin as follow: Arginase I forward 5'CAG AAG AAT GGA AGA GTC AG -3' , reverse 5'-CAG ATA TGC AGG GAG TCA CC -3' , Arginase ... participated in performing arginase activity assays, western blots, amino acid assays and data collection; DHA was involved in the analysis and interpretation of data and critically revised the manuscript; ... activity assays; YAC participate in the analysis of HPLC data and design and conducted functional assays; TM participated in tissue culture and preparation of cell lysates and RNA extractions; JRP participated...
- 10
- 388
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
... predicts a resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies ... [ 87 ] 53 3.14 The efficiency in data and simulation (left) and their ratio (right) for the MV1 b-tagging algorithm in its 70 % efficiency working point, calculated using ATLAS 2011 data and the prel ... in the final state, using data of proton-proton collisions in ATLAS at a center -of- mass energy of TeV The observed data is corrected for the detector effects in an “unfolding” procedure and a comparison...
- 251
- 712
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu