spatial diversity for wireless communications
![godara, lal chand - crc handbook of antennas in wireless communications [2002]](https://media.store123doc.com/images/document/14/ri/si/small_cL3g7P9GyO.jpg)
godara, lal chand - crc handbook of antennas in wireless communications [2002]
... characterization and presents beamforming strategies for transmit arrays including beamforming algorithms and robust beamforming methods Chapter 19, Spatial Diversity for Wireless Communications, treats ... Sensors with Beamforming Applications Arye Nehorai, Kwok-Chiang Ho, and B T G Tan 18 Optimum and Suboptimum Transmit Beamforming and Bjửrn Ottersten 19 Spatial Diversity for Wireless Communications ... Hall and James Llinas Handbook of Antennas in Wireless Communications Lal Chand Godara Forthcoming Titles Propagation Data Handbook for Wireless Communications Robert Crane The Digital Color...
- 888
- 536
- 0
Báo cáo khao học: "High-resolution analysis of radial growth and wood density in Eucalyptus nitens, grown under different irrigation regimes" potx
... density was scanned for the wood formed during this period Figure a–c presents timemapped wood density for each treatment plotted along with soil-water deficits Lower wood density was formed during ... North Forest Products, Triabunna The senior author was supported through the APART program of the Austrian Academy of Science Thanks to Dale Worledge, CSIRO Forestry and Forest Products for site ... pinning method for marking xylem growth in hardwood species, For Sci 30 (1984) 548–554 [21] Larson P.R., Wood formation and its concept of wood quality, Yale University, School of Forestry, Bulletin...
- 6
- 341
- 0
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx
... had the potential for providing substrate for mitochondrial fatty acid oxidation by lipid hydrolysis [7], for generating lipid second messengers (eicosanoids and lysolipids), for modulating ion ... cross-linked by exposure to a UV light source for 1.5 and then baked at 85 °C for 60 After prehybridization in ExpressHyb hybridization buffer (BD Biosciences) for 30 min, the blot was hybridized h at ... enzyme assay system (Promega) for normalization of results Background measurements were uniformly low and cell survival was indistinguishable in all transfections performed The cells were harvested...
- 16
- 438
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... about the mechanism responsible for apoptotic signaling elicited by active ERK, and this process therefore needs to be investigated The mechanism responsible for ERK activation by ROS is well ... (Invitrogen) and visualized ChIP assay The cells were fixed in 1% formaldehyde for 10 at room temperature, and immunoprecipitation was performed with antibodies against c-Fos and c-Jun (Santa Cruz), ... Fos and Jun proteins [26] Fos and Jun form a dimer, which in turn binds to AP-1 regulatory elements and enhancer regions of numerous mammalian genes Jun forms homodimers and heterodimers with...
- 9
- 556
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... for rapid B2wt sequestration [17] To determine the C-terminal sequence(s) of the B2wt minimally required for internalization we created two new B2wt truncations, I347* and N338* (Fig 1) The former ... expressing B2wt, B1YB2, B1KB2, or B1CB2 were labeled for 10 h with [32P]orthophosphate before stimulation with lM BK and lM DAK, respectively, for Cells were lysed and proteins were solubilized, ... the tray in a water bath at 37 °C for 30 It was stopped by exchanging the buffer with 0.75 mL of ice-cold 20 mm formic acid and by transferring the tray onto ice for additional 30 As a baseline...
- 12
- 595
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... BSA (2 mgÆmL)1) for 30 A wash in NaCl ⁄ Pi for at room temperature was performed to remove any additional stain, followed by another wash in a similar buffer, separately prepared, for 30 s The chip ... temperature for in 0.1· SSC, 0.1% SDS, followed by another wash in 0.05· SSC, 0.1% SDS at 43 °C Finally, the chip was rinsed in 0.05· SSC before drying by low-speed centrifugation For staining, ... fragmented at 94 °C for 15 and hybridized onto a ConPathÔ chip (DNA Chip Research Inc., GEO ID GPL5437) in the presence of formamide (final concentration 10% v ⁄ v) at 37 °C for 16 h The chip was...
- 14
- 597
- 0
Báo cáo khoa học: Acute activation of Erk1/Erk2 and protein kinase B/akt proceed by independent pathways in multiple cell types ppt
... concentrations for 10 The cells were then stimulated with synthetic IL-3 (10 lgÆmL)1 for FDC-P1 and BAF-3 cells) or recombinant GM-CSF (10 ngÆmL)1; murine GM-CSF for FDC-P1 cells and human GM-CSF for TF-1 ... the indicated concentrations for 10 Cells were then stimulated with IL-3 (10 lgÆmL)1) for Cell lysates were fractionated using 9% SDS ⁄ PAGE and immunoblotted as for Fig the level of Erk phosphorylation ... at the indicated concentrations for 10 Cells were then stimulated with GM-CSF (10% CGM1) for Cell lysates were fractionated using 9% SDS ⁄ PAGE and immunoblotted for anti(phospho-Ser473-PKB) or...
- 13
- 365
- 0
handbook of computer vision and applications volume 2 signal processing and pattern recognition - - bernd jahne
... Spatial and Fourier Domain B Jähne 3.1 Vector spaces and unitary transforms 3.2 Continuous Fourier transform (FT) 3.3 The discrete Fourier transform (DFT) 3.4 Fast Fourier transform ... Adobe Acrobat portable document file format (PDF) This format can be read on all major platforms Free Acrobat reader version 3.01 for all major computing platforms is included on the CDs The texts ... 9.1 Introduction 9.2 Forward and inverse mapping 9.3 Basic geometric transforms 9.4 Fast algorithms for geometric transforms 9.5 References ...
- 967
- 2,414
- 0
báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf
... and Training5 workforce flow for the optometry sector of eye care personnel Training and workforce flow for the optometry sector of eye care personnel Page of (page number not for citation purposes) ... Ey e Ca r e W/F Figure for Options3 graduates of Stage1 training Options for graduates of Stage1 training Page of (page number not for citation purposes) Human Resources for Health 2009, 7:42 ... L e a v e Ey e Ca r e W/F Figure and Training6 workforce flow for the non-physician sector of eye care personnel Training and workforce flow for the non-physician sector of eye care personnel...
- 6
- 442
- 0
Báo cáo hóa học: " Decoding subtle forearm flexions using fractal features of surface electromyogram from single and multiple sensors" docx
... suitable for amputees who may not have a large area of the forearm available for multi-channel sEMG recording Such a system can be used for controlling the individual fingers of a prosthetic hand for ... table for all four Channels combined for different features RMS MAV Average F-value 50.56 80.25 SD 0.01 VAR FD MFL • Two channels (selected using MANOVA) for each of the features • Four channels for ... samples, this provided segments for each flexion The data of all segments and for all the 12 repetitions for each flexion (total number of flexions = 4) was considered for statistical analysis The...
- 10
- 382
- 0
báo cáo hóa học: " Production of IL-16 correlates with CD4+ Th1 inflammation and phosphorylation of axonal cytoskeleton in multiple sclerosis lesions" pptx
... that seen for IL16 (Fig 1) The antibody specific for IL-16 that we used for both immunostaining and western blot binds to the C-terminal portion of both pro- and secreted IL-16 and therefore does ... of 13 (page number not for citation purposes) Journal of Neuroinflammation 2006, 3:13 http://www.jneuroinflammation.com/content/3/1/13 Table 2: Primary antibodies used for immunostaining and ... antibodies for 30 minutes The following secondary antibodies were used: anti-goat, anti-rabbit and anti-mouse IgG-HRP con- jugated at 1:10,000, (Santa Cruz Biotechology, CA) Nuclear staining was performed...
- 13
- 425
- 0
báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc
... Immunostaining was performed against AQP4, ED1 and Iba1 (for macrophages and microglia), IgG (for serum protein accumulation secondary to BBB alteration) and GFAP (for astrocytes) Immunostaining For immunohistochemistry, ... AQP4 Isoform 1: NM_012825.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 213 pb 98.2% 90 pb 102.0% 778 to 796 Isoform Isoform 2: NM_001142366.1 Revs: GGTCAATGTCGATCACATGC 963 to 982 Isoform NM_017009.2 ... MR scans conducted just before sacrifice (n = 25) By introducing the repetitive MR scans that were performed before sacrifice (two to three scans per animal except for dpi, total = 49) and by...
- 16
- 393
- 0
Báo cáo hóa học: " Adaptive selection of antenna grouping and beamforming for MIMO systems" ppt
... grouping and beamforming for MIMO systems EURASIP Journal on Wireless Communications and Networking 2011 2011:154 Endnote a In this article, the beamforming mode refers to the transmit beamforming mode ... through beamforming, and multiplexing gain through spatial multiplexing We assume that SVD is performed at the receiver instead of the transmitter, so that we need to feedback beamforming vector(s) ... instead of full CSI Feedback information in antenna grouping is a beamforming vector (Nt×1 vector) plus additional antenna grouping information while required feedback information in eigenmode transmission...
- 8
- 466
- 0
Báo cáo hóa học: " Research Article Orthogonal DF Cooperative Relay Networks with Multiple-SNR Thresholds and Multiple Hard-Decision Detections" potx
... SNR thresholds for all values of ET First, we observe the diversity performance for different numbers of relays Figure plots the BER performance with and without SNR thresholds for R = 2, 4, Here ... conclusion holds when M = K + For a relay link with K + hops, since the BER for the first K hops (before the last hop to be completed) equals EURASIP Journal on Wireless Communications and Networking ... Transactions on Wireless Communications, vol 3, no 5, pp 1416–1421, 2004 [5] I.-H Lee and D Kim, “BER analysis for decode-and-forward relaying in dissimilar Rayleigh fading channels,” IEEE Communications...
- 11
- 395
- 0
báo cáo hóa học:" Research Article Progressive Refinement of Beamforming Vectors for High-Resolution Limited Feedback" potx
... commercial wireless systems including IEEE 802.16e wireless system [17], 3GPP LTE systems [18, 19], and 3GPP2 UMB systems [20] In this paper we assume that a good uniform base codebook is given For ... following form: ⎡ wk = ⎣ ⎤ − γ0 ⎦ γ0 wk , (9) where wk is a Nt − × unit norm vector We now summarize some general principles for constructing a ring codebook 5.1.1 Uniform Phase Ring for Nt = ... Zero forcing capacity Phase bits Phase bits Phase bits Kerdock Reduced Kerdock Figure 3: Sum rate performance of multiuser MIMO with Nt = U = at SNR = 20 dB for different ring codebooks For comparison...
- 13
- 252
- 0
Báo cáo hóa học: " Research Article The Nonzero Solutions and Multiple Solutions for a Class of Bilinear Variational Inequalities Jianhua Huang" pptx
... continuous bounded mapping and for each t ∈ [0,1], H(t, ·) be a k-set-contractive mapping Suppose that H(t,x) is uniformly continuous with respect to t for all x ∈ U and for all (t,x) ∈ [0,1] × ∂UK ... First, for r > 0, let H : [0,1] × K → K and H(t,u) = Ka (tg(u)) Obviously, H(t, ·) is strictly set-contractive for fixed t ∈ [0,1] and H(t,u) is uniformly continuous with respect to t for all ... Clearly, for any fixed t ∈ [0,1], H(t, ·) is strictly set-contractive and H(t,u) is uniformly continuous with respect to t for all u ∈ K r We now show that there exists R0 > r0 such that u = H(t,u) for...
- 9
- 235
- 0
Báo cáo hóa học: " Research Article Classification of Single and Multiple Disturbances in Electric Signals" ppt
... classification technique for each voltage level has to take into account the information and characteristics of these networks to attain a high classification performance For instance, the sets ... classification performance In fact, the transients at the output of the notch filter shows a typical parttern for each disturbance, then a neglible loss of performance has been verified for disturbance ... length could be valuable for HOS parameters estimation That is one of the reasons for the improved performance achieved by the proposed technique in Section The use of (35)–(37) for improved disturbance...
- 18
- 353
- 0
Báo cáo hóa học: " The Cramer-Rao Bound and DMT Signal Optimisation for the Identification of a Wiener-Type Model" pptx
... 1) (23) (24) (25) which, for Σ = σ I, gives the familiar result [1, page 86] F−1 = σ UT U −1 (26) for the Cramer-Rao bound for linear FIR filters PARAMETER ESTIMATION For parameter estimation, ... result (24) for the Fisher information matrix of the Wiener-type model is verified by simulation examples For this purpose, a Wiener-type system is defined and will serve as a reference system for the ... tones for the estimation of an M = FIR filter 0.8 (40) ˜ with p ≡ [1 − pk , p0 , , pNc −1 ]T The key observation that allows this elegant formulation is that the Fisher information matrix for...
- 14
- 294
- 0
Báo cáo hóa học: "Vesa Valimaki Laboratory of Acoustics and Audio Signal Processing," doc
... package is given for real-time synthesis In the third paper, Trautmann and Rabenstein present a multirate implementation of a vibrating string model that is based on the functional transformation method ... incorporate a plucked-string model into an audio coder for audio compression and instrument synthesis The guest editors would like to thank all the authors for their contributions We would also like to ... California at Berkeley, where he spent two years doing research on nonlinear system control and on motion planning of nonholonomic systems In 1993 he joined the Dipartimento di Elettronica e Informazione...
- 3
- 123
- 0
Báo cáo khoa học: " Interactions between Scots pine, Ips acuminatus (Gyll.) and Ophiostoma brunneo-ciliatum (Math.): estimation of the critical thresholds of attack and inoculation densities and effects on hydraulic properties in the stem" pdf
... surface tension of xylem sap, and therefore increase the vulnerability to cavitation This hypothesis was put forward for the pine wilt nematode [15] and for bark-beetles [12], but is far from ... authors are grateful to “Office National des For ts” for providing the Scots pine stand in the forest of Rambouillet, and to P Romary and J Garcia for their technical help Helpful comments by ... Such epidemic gradations, even if they are rather unfrequent, are nevertheless disastrous for forests For instance, 300 000 m3 pines had to be cut down between 1983 and 1986 after attacks by Tomicus...
- 10
- 448
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25