Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Complex transcriptional and translational regulation of iPLA 2 c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization David J. Mancuso 1,2 , Christopher M. Jenkins 1,2 , Harold F. Sims 1,2 , Joshua M. Cohen 1,2 , Jingyue Yang 1,2 and Richard W. Gross 1,2,3,4 1 Division of Bioorganic Chemistry and Molecular Pharmacology, and Departments of 2 Medicine, 3 Chemistry and 4 Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, MO, USA Membrane-associated calcium-independent phospholipase A 2 c (iP LA 2 c) contains four potential in-frame methionine start s ites (Mancuso, D.J. Je nkins, C .M. & Gross, R.W. (2000) J. Biol. Chem. 275, 9937–9945), but the mechanisms regulating the types, amount and subcellular localization of iPLA 2 c in cells are i ncompletely understood. We now: (a) demonstrate the dramatic transcriptional repression of mRNA synthesis encoding iPLA 2 c by a nucleotide sequence nested in the coding sequence itself; (b) localize the site of transcriptional repression to the most 5¢ sequence encoding the iPLA 2 c holoprotein; (c) identify the presence of nuclear protein c onstituents w hich bind to the repressor region by gel shift analysis; (d) demonstrate the translational regulation of distinct iPLA 2 c isoforms; (e) identify multiple novel exons, promoters, and alternative splice variants o f human iPLA 2 c; (f) document the presence of dual-competing subcellular localization s ignals in discrete isoforms of iPLA 2 c;and (g) demonstrate t he functional integrity of an N-terminal mitochondrial localization signal by fluorescen ce imagi ng and the presence of iPLA 2 c in the mitochondrial compart- ment of rat myocardium. The intricacy of the r egulatory mechanisms of iPLA 2 c biosynthesis in rat myocardium is underscored by the identification of seven distinct protein products that utilize multiple mechanisms (transcription, translation and proteolysis) to produce discrete iPLA 2 c polypeptides containing either single or dual subcellular localization s ignals. T his unanticipated complex i nterplay between peroxisomes and mitochondria mediated by com- petition for uptake of the nascent iPLA 2 c polypeptide identifies a new level of phospholipase-mediated m etabolic regulation. Because uncoupling protein function is regulated by free fatty acids in mitochondria, these results suggest that iPLA 2 c processing contributes to integrating respiration a nd thermogenesis in mitochondria. Keywords: phospholipase; mitochondria; p eroxisomes; tran- scription; translation. Phospholipases A 2 (PLA 2 s) play critical roles in cellular growth, lipid homeostasis and lipid second messenger generation by catalyzing the esterolytic cleavage of the sn-2 fatty acid o f glycerophospholipids [1–5]. The resultant fatty acids and lysolipids are potent lipid mediators of signal transduction and a lter the biophysical properties o f the membrane bilayer, collectively contributing t o the critic al roles that phospholipases play in cellular adaptation, proliferation and signaling. PLA 2 s constitute a d iverse family of enzymes, which include the intracellular phos- pholipase families, cytosolic PLA 2 s(cPLA 2 ) and calcium- independent PLA 2 s(iPLA 2 ) as well as the secretory PLA 2 s (sPLA 2 ). More than a decade ago, we identified multiple types of kinetically distinguishable iPLA 2 activities in the cytosolic, microsomal and mitochondrial fractions from multiple species of mammalian m yocardium [6–10]. Utilizing the synergistic power of HPLC in conjunction with MS of intact phospholipids, initial insights into b oth the canine and human mitochondrial lipidomes were made [8,11]. Both human and canine cardiac mitochondria possess a high plasmalogen content, and plasmalogens are readily hydo- lyzed by heart mitochondrial phospholipases [7,8]. Both cytosolic and membrane-associated iPLA 2 activities are inhibited by the nucleophilic serine-reactive mechanism- based inhibitor (E)-6-(bromome thylene)-3-(1 -naphthale- nyl)-2H-tetrahydropyran-2-one (BEL) [12–14]. Recent studies have shown that BEL has potent effects on mitochondrial bioenergetics [15] and that fatty acids are a Correspondence t o R. W. Gross, Washington University School of Medicine, D ivision of Bioorganic Chemistry and Molecu lar Phar- macology, 660 South Euclid Avenue, Campus Box 8020, St. Louis, MO 63110, USA. Fax: +1 314 362 1402; Tel: +1 314 362 2690; E-mail: rgros s@wustl.edu Abbreviations: BEL, (E)-6-(bromomethylene)-3-(1-naphthalenyl)- 2H-tetrahydropyran-2-one; cPLA 2 , cytosolic phospholipase A 2 ;ECL, enhanced chemoluminescence; EMSA, electrophoretic mobility shift analyses; EST, expressed sequ ence tag; GAPD H, glyceraldehye- 3-phosphate dehydrogenase; iPLA 2 , calcium-independent phosphol- ipase A 2 ; iPLA 2 c, membrane a ssociated calcium-independent phos- pholipase A 2 (AF263613); MOI, multiplicity o f infection; PLA 2 , phospholipase A 2 ; Sf9, Spodoptera frugiperda cells; sPLA 2 , secretory phospholipase A 2 ; T AMRA, 6-carboxytetramethylrhodamine; UCP, uncoupling protein. (Received 25 August 2004, revised 10 October 2004, accepted 13 October 2004) Eur. J. Biochem. 271, 4709–4724 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04435.x rate-determining factor in uncoupling protein (UCP) activ- ity [16]. Thus, t he role of mitochondrial i PLA 2 activities in regulating mitochondrial function is just now beginning to be understood. Mor eover, both fatty acids and lys olipids alter the physical properties of cell membranes, interact with specific receptors, and modulate the electrophysiologic function of m any transmembrane ion channels including K + and Ca 2+ channels in many cells and subcellular contexts [17–20]. In early studies, we purified canine myocardial cytosolic iPLA 2 activity (iPLA 2 b) t o homogeneity [21] identifying a high specific activity, proteolytically activated form of the gene whose identity w as substantiated by i ts covalent radiolabeling w ith (E)-6-( 3 H)(bromomethylene)-3-(1-napht- halenyl)-2H-tetrahydropyran-2-one (radiolabeled BEL) [12]. However, despite our intense efforts at solubilization and purification, the membrane-associated iPLA 2 activities we identified in multip le membrane c ompartments were resistant to our attempts at their purification. In the postgenome e ra it became apparent that multiple different gene products contributed to the many kinetically diverse activities of membrane-associated iPLA 2 sinmyocardium possessing distinct molecular masses and substrate selecti- vities that resided in multiple discrete s ubcellular loci [22–27]. Recently, w e charac terized the genomic organization and mRNA sequence of a novel iPLA 2 (now termed iPLA 2 c, GenBank accession number AF263613) located on the long arm of c hromosome 7 at 118 c M [26]. Like other me mbers of the i PLA 2 family–iPLA 2 a (patatin, found in potato tubers) [28] and iPLA 2 b [23] – iPLA 2 c contains a consensus site for nucleotide binding and a lipase consensus motif in its C-terminal half [26]. Although the intracellular localization and activity of iPLA 2 b is complex and dynamically regulated by multiple d ifferent cellular perturbations inclu- ding ATP concentration [7], calcium-activated calmodulin [29,30], a nd proteolysis [ 31,32], the biochemical mechanisms regulating iPLA 2 c in intact tissues are not known with certainty. For examp le, iPLA 2 c is not activated, stabilized or bound to ATP under any conditions we have examined, nor does it associate with calmodulin or possess a discern- able calmodulin-binding consensus sequence [26]. Like iPLA 2 b,iPLA 2 c is completely inhibited by low micromolar concentrations (1–5 l M ) of the mechanism-based inhibitor BEL [26]. Previously, we demonstrated th at iPLA 2 c is synthesized from a 3 .5 kb mRNA containing a putative 2.4 kb co ding region which was most prominent in heart tissue. The 5¢-region of the 2.4 k b coding sequence of iPLA 2 c contains four in-frame ATG start sites which can potentially encode 88, 77, 74 and 63 k Da polypeptides [ 26]. However, in i nitial studies in baculoviral and in vitro rabbit reticulocyte l ysate systems, we unexpectedly observed that constructs contain- ing the full-length 2.4 kb sequence encoding the predicted 88 kDa polypeptide resulted instead in the expression of only t wo protein bands of 77 and 63 kDa [26]. M oreover, the initial characterization of iPLA 2 c in nonrecombinant cells demonstrated that hepatic iPLA 2 c was most highly enriched in the peroxisomal compartment as a 63 kDa polypeptide [27]. These results raised the intriguing possibility that iPLA 2 c biosynthesis was transcriptionally and/or translationally regulated b y as y et unidentified mechanisms. To begin to iden tify t he potential modes o f t he regulation of iPLA 2 c synthesis at the transcriptional and post- transcriptional levels, an d to i dentify specific mechanisms modulating iPLA 2 c expression and processing in different cell types, we examined multiple iPLA 2 c constructs in different cellular contexts and in intact rat myocardium. Herein, we demonstrate that iPLA 2 c synthesis is transcrip- tionally regulated by a transcriptional repressor domain nested in the 5¢-coding region and translationally regulated through the differential usage o f downstream A UG start sites. Moreover, this study identifies an N-terminal mito- chondrial localization signal a nd demonstrates its functional integrity by fluorescence colocalization assays. Importantly, the presence of multiple high molecular m ass iPLA 2 c isoforms in mitochondria from wild-type rat myocardium was d emonstrated. T his c omplex interplay o f t ranscrip- tional and translational, as well as proteolytic, sculpting o f iPLA 2 c results in a diverse repertoire of biologic products , which likely provides the chemical foundations necessary for iPLA 2 c to fulfill i ts multiple d istinct functional r oles in mammalian tissues. Experimental procedures Materials [ 32 P]dCTP[aP] (6000 C iÆmmol )1 ) and enhanced chemolu- minescence (ECL) detection reagents were purchased from Amersham Pharmacia Biotech (Piscataway, NJ, USA). A human heart cDNA library was purchased from Stratagene (La Jolla, CA, USA). For PCR, a Perkin-Elmer Thermo- cycler was employed, and all PCR reagents were purchased from Applied Biosystems (Foster City, CA, USA). The Luciferase Assay system and TnT Quick coupled Tran- scription/Translation system were obtained f rom P romega (Madison, WI, USA). CV1 cells were generously provided by D. Kelly (Washington University Medical School). Vectors pcDNA1.1, pEF1/myc-His and pcDNA 3.1/myc- His/lacZ were purchased from Invitrogen (Carlsbad, CA, USA). Vectors pEGFP-N3 and pDsRed-mito were pur- chased from BD-Biosciences (Palo Alto, CA, USA). Culture media, CellFECTIN and LipofectAMINE reagents for transfection, baculovirus vectors and competent DH110Bac Escherichia coli were purchased from Invitrogen and used according to the manufacturer’s protocol. QIAfilter plasmid kits and QIAquick Gel Extraction kits were obtained from Qiagen (Valencia, C A, USA). Keyhole limpet hemocyanin was obtained from Pierce (Rockford, IL, USA). BEL was obtained from Calbiochem (San Diego, CA, USA). Most other r eagents w ere obtained from Sigma (St. Louis, MO, USA). Expression of truncated iPLA 2 c Constructs encoding the 74- and 63 kDa polypeptides were prepared as previously described for construction of the f ull- length iPLA 2 c construct encoding the 88 kDa polypeptide used for baculoviral expression. In brief, the 74 kDa sense primer M533 (5¢-TCAAGTCGACATGATTTCACGTTT AGC-3¢) and the 63 kDa sense primer M530 (5¢-GT AAGTCGACAATGTCTCAACAAAA GG-3¢)wereeach paired with reverse primer M458 (5¢-GCATAGCATGCT 4710 D. J. Mancuso et al. (Eur. J. Biochem. 271) Ó FEBS 2004 CACAATTTTGAAAAGAATGGAAGTCC-3¢)forPCR of  2.0 and 1.7 kb products, r espectively, from the full- length iPLA 2 c pFASTBac1 construct for cloning via SalI/ SphI sites in to vector pFASTBac1 (Invitrogen). Subsequent preparation of bacmids, CellFECTIN-mediated transfec- tion of Spodoptera frugiperda (Sf9) cells to produce virus, and the Neutral Red agar overlay method for viral plaque titering were performed utilizing the Bac-to-Bac Baculovirus Expression System (Invitrogen) according t o the manufac- turer’s instructions. Sf9 cells were grown and infected for preparation of recombinant protein extracts as previously described [26]. In brief, Sf9 cells were cultured in 100-mL flasks equipped with a magnetic spinner containing supple- mented Grace’s m edia [26]. S f9 cells at a concentration o f 1 · 10 6 cellsÆmL )1 were prepared in 50 mL of growth med ia and incubated at 27 °C for 1 h prior to infection with either wild-type v irus or recombinant virus containing human iPLA 2 c cDNA. After 48 h, cells were pelleted by centrifu- gation, resuspended in ice-cold NaCl/P i and repelleted. The supernatant was decanted and the cell pellet was resus- pended in 5 mL of ice-cold homogenization buffer (25 m M imidazole, pH 8.0, 1 m M EGTA, 1 m M dithiothreitol, 0.34 M sucrose, 20 l M trans-epoxysuccinyl- L -leucylamido- (4-guanidino) butane and 2 lgÆmL )1 leupeptin). Cells were lysed by s onication (20 · 1 s bursts utilizing a Vibra-cell sonicator at 30% output) and centrifuged at 100 000 g for 1hat4°C. The supernatant was saved (cytosol) and the membrane pellet was washed by resuspending with a Teflon homogenizer in 5 mL of homogenization buffer followed by a brief sonication step (10 · 1 s bursts) before recentrifu- gation at 100 000 g for 1 h at 4 °C. A fter removal of the supernatant, the m embrane pellet was resuspended in 1 mL of homogenization buffer u sing a Teflon homogenizer and then sonicated (5 · 1 s bursts) to prepare a membrane fraction. PLA 2 enzymatic assay and immunoblot analysis Calcium-independent PLA 2 activity was measured by quantitating the release of r adiolabeled f atty ac id from various radiolabeled phospholipid substrates in the presence of membrane fractions from Sf9 c ells infected with wild-type or recombinant human iPLA 2 c baculovirus a s previously described [26]. Protein from baculoviral or reticulocyte lysate samples was separated by SDS/PAGE [33], trans- ferred to Immobilon-P membranes by electroelution, probed with anti-iPLA 2 c Ig and visualized using ECL as described previously [26]. Northern blot analysis Total RNA from Sf9 cells was isolated according to the protocol for RNeasy (Qiagen). In brief, sample was placed in tissue lysis buffer containing guanine isothiocarbonate and disrupted by 20–40 s of pulse homogenation with a rotor stator homogenizer. Total RNA was then recovered from a c leared lysate after several washes on an RNeasy mini spin co lumn and elution with RNase-free water. Recovery of RNA was determined spectrophotometrically at 260 n m. RNA (2 lg) was fractionated on a 1.25% agarose Latitude RNA midi gel (BioWhittaker, Walkers- ville, ME, USA), blotted onto a nylon membrane, cross-linked b y e xposure to a UV light source for 1 .5 min and then baked at 85 °C f or 60 min. After prehybridization in ExpressHyb hybridizatio n buffer (BD Biosciences) for 30 min, the b lot was hybridized 1 h at 68 °C with radio- labeled iPLA 2 c probe prepared as previously described [26] in hybridization buffer and then washed with 2· NaCl/Cit containing 0.1% (w/v) SDS twice for 30 min each, followed by two washes w ith 0.1· NaCl/Cit containing 0.1% (w/v) SDSfor40mineachat50°C, as described in the manufacturer’s instructions. H ybridized sequences were identified by autoradiography for 16 h. RNA stability assay Spinner flasks (100 mL) were infected with equivalent volumes of each truncated viral iPLA 2 c construct [multi- plicity of infection (MOI) ¼ 1] and 48 h later, actino- mycin D was added to a concentration of 10 lgÆmL )1 .At0, 15, 30, 60, 120 and 2 40 min following actinomycin D addition, 2-mL aliquots were removed, centrifuged to collect pellets and quick-frozen in liquid N 2 .RNAwas then prepared following the RNeasy (Qiagen) protocol. RNA samples (2 lg) were fractionated on a latitude RNA midi-gel for northern analysis as described above. Quantitative PCR RNA was prepared from Sf9 cell pellets following the RNeasy protocol supplemented with on-column RNase- free DNase treatment to remove baculoviral DNA as described b y t he manufacturer. Completeness of removal of baculoviral DNA was monitored by including control samples spiked with p lasmid DNA (either cell pellets from uninfected Sf9 cells or water blanks). Quantitative PCR of DNase-treated control samples routinely did not generate detectable signal. For analysis of actinomycin D -treated test samples,  0.2–1 lg of the tot al RNA was r everse tran- scribed using MultiScribe reverse transcriptase in a TaqMan Gold RT-PCR kit (Applied Biosystems) by incubation for 10 min at 25 °C followed by 30 m in at 48 °C and a final step of 5 m in at 95 °C a nd 20 ng of cDNA was used per reaction in quantitative P CR. Specific iPLA 2 c primer pairs and probe were designed using PRIMER EXPRESS software from PE Bi osystems. Forward and reverse primers, respect- ively (5¢-AGCTCTTTGATTACATTTGTGGTGTAA-3¢ and 5¢-CACATTCATCCAAGGGCATATG-3¢)wereused for amplification of an  100 nu cleotide product fl anking the boundary between exons 5 and 6 o f the iPLA 2 c gene. A 30-mer hybridization probe (5¢-CCCAACATGAAAGC TAATATGGCACCTGTG-3¢) was designed to anneal between the PCR primers, at the exon 5/6 boundary, 5¢-labeled with reporter d ye 6-FAM and 3 ¢-labeled with quenching dye, 6-carboxytetramethylrhodamine (TAMRA). PCRs were carried out using TaqMan PCR reagents (Applied Biosystems) as recommended by the manufacturer. Each PCR amplification was performed in triplicate, using t he following conditions: 2 min at 50 °C and 10 m in at 95 °C, followed by a total of 40 two- temperature cycles (15 s at 95 °C and 1 min at 60 °C). For the generation o f s tandard curves, s erial dilutions of a cDNA sample were used and mRNA levels were compared for various time points after correction using concurrent Ó FEBS 2004 Regulation of iPLA 2 c biosynthesis (Eur. J. Biochem. 271) 4711 glyceraldehye-3-phosphate dehydrogenase (GAPDH) mes- sage amplification with GAPDH primers and probe as an internal standard. Results were plotted as relative mRNA level vs. time (hours) and the slopes of exponential trendlines for each construct were compared. Luciferase assay PCR primers in Table 1 were used to amplify segments containing 124 nucleotides of sequence upstream of the iPLA 2 c 63 kDa start site. All 3 ¢ PCR primers in Table 1 were designed to generate identical Kozak (GCCACC) sequences [34,35] upstream of the ATG start. In each case, the sequence around the ATG start is ÔGCCAX CATGÕ (where ÔXÕ is a ÔCÕ nucleotide in all constructs except 83 which contains an ÔAÕ nucleotide). In each case, PCR products were cloned into HindIII/NcoIrestriction sites within the polylinker region of pGL3-Promoter vector (pGL3P). Also, because o f the presence of a naturally occurring NcoI site within the 83 construct, an AflIII restriction site was utilized at the 3¢-end of this construct (instead of NcoI) to generate a compatible cohesive end for cloning into the NcoI restriction site of pGL3-Promoter vector (pGL3P). Transient t ransfection of CV1 cells with each of the inhibitory constructs was performed using LipofectAMINE Plus (Invitrogen). For each transfection, 1–2 lg of luciferase r eporter plasmid was cotransfected with 100 n g of pcDNA 3.1/myc-His/lacZ vector and b-galac- tosidase activity was measured utilizing the b-galactosidase enzyme assay system (Promega) for normalization of results. Background measurements were unifo rmly low and cell survival was indistinguishable in all transfections performed. The cells were harvested 24 h later and luciferase activity was assayed using the luciferase assay syst em (Promega) following the manufacturer’s protocol. Relative luminescence values were measured in a Beckman Scintil- lation counter with a wide-open window. Subcellular fractionation of rat heart Subcellular fractionation of rat heart by differential centri- fugation w as performed essentially as described previously for r at liver [27]. In brief, rat heart was minced on ice and then homogenized in 3 vol. (w/v) of ice-cold homogeniza- tion buffer [0.25 M sucrose, 5 m M Mops,pH7.4,1m M EDTA and 0.1% (v/v) ethanol, 0.2 m M dithiothreitol containing protease inhibitors (0.2 m M phenylmethylsulfo- nyl fluoride, 1 lgÆmL )1 leupeptin, 1 lgÆmL )1 aprotinin and 15 lgÆmL )1 phosphoramidon)] using a Potter-Elvehjem homogenizer at 1000 r.p.m. with 8–10 strokes. The homo- genate was first centrifuged at 100 g for 1 0 min to remove cellular debris and then at 1000 g to obtain a nuclear pellet (nuclear fraction) and a supernatant fraction. The 1000 g supernatant fraction was further centrifuged at 3000 g for 20 min to collect a heavy mito chondrial pellet ( heavy mitochondrial fraction). The 3000 g supernatant was then centrifuged at 23 500 g for 20 m in to collect the light mitochondrial fraction pellet 2 3 5 00 g (light mitochondrial fraction). The 23 500 g supernatant was then centrifuged at 70 000 g for 20 m in to collect a second light mitochondrial pellet (70 000 g light mitochondrial fraction). Utilizing the above subcellular fractionation technique, the majority of mitochondria were pr esent in t he 3000 an d 23 500 g pellets, whereas t he large majority of peroxiso mal marker PMP70 was present in the supernatant. Promoter analysis iPLA 2 c seque nces were examined for the presence of putative promoter e lements utilizing t he inte rnet-based program TFSEARCH (http://150.82.196.184/research/db/ TFSEARCH.html). Promoter activity of iPLA 2 c sequences was analyzed by cloning sequences upstream of the luciferase reporter gene i n promoterless vector p GL3- Enhancer (Promega). The following primers were u tilized to amplify PCR products containing iPLA 2 c sequence: P1, 5¢-TCAAGGTACCATGATTTCCTGAAGG-3¢;P2, 5¢-CTGAAGATCTAGCCTTTACTTTCA-3¢;P3,5¢-GC TAGGTACCAATACAGTAATATATG-3¢;P4,5¢-TGC TAGATCTCCACCCACTCA-3¢;P5,5¢-TTATGGTACC TGAAAGGGAATAGCGGC-3¢;P6,5¢-GGCTGGTAC CCTTGCGCTCCGTC-3¢;P7,5¢-GGAGAGATCTGCG GGAAGCCGCGACAGA-3¢;p8,5¢-TTCCAGAT CTG CAGAGATAAGCCTCCC-3¢;p9,5¢-GCGTGAGATCT CTGGTTGGTTGC-3¢;P10,5¢-ACCAGGTACCGCA CAGCACGCCCC-3¢; and P11, 5¢-GTCCGGTACCGG AAGGCAAAACGA-3¢. Primers P1 and P2 were utilized to amplify a 584-nucleotide product containing sequence Table 1. PCR primer pairs for lo calization of transcriptional regulatory elements in the 5¢-coding region o f iPLA 2 c. Underlined residues indicate the locations of HindIII (AAGCTT), NcoI (CCATGG), o r Af l III (ACATGT) restriction sites utilized for cloning PCR p roducts. Construct PCR primer pairs 5¢-to3¢-sequence 88 88F GTTGAAGCTTGTGTCTATTAATCTGACTGTA 88R TAGACCATGGTGGCTTATCCTCCAGTAATGC 87 87F GTGTAAGCTTGAAGCAGAGAAGCAAGCAACTG 87R ACTGCCATGGTGGCCTTCACTTTTGGTCCATTTAC 85 85F TGGAAAGCTTGCCACATCAGTCTACAAAG 85R TGCTCCATGGTGGCATCCCAATATGTAAACCA 83 83F GAACCAAGCTTGAAGCACATTCTTGCAGTAAGCA 83R CAAAACATGTTGGCTACGGGACATACAAATGTTCA 80 80F GTTGAAGCTTTTTGAAACTTAGCACTTCTGC 80R ATTCCATGGTGGCTGAAATCATTTCATTTTGATTGCC 74 74F TCAAAAGCTTATGATTTCACGTTTAGCTC 74R CTTTCCATGGTGGCTGTCACTATATTTTTTCA 4712 D. J. Mancuso et al. (Eur. J. Biochem. 271) Ó FEBS 2004 upstream from iPLA 2 c exon 1. For construct I, primers P3 and P4 were utilized to amplify a 584 nucleotide product containing sequence upstream from iPLA 2 c exon 2. PCR products for constructs II–IX were prepared as follows: primers P5 and P4 were paired to amplify a 390-nucleotide product for construct I I; primers P6 a nd P4 were utilized to amplify a 197-nucleotide product for construct III; primers P5 and P8 were employed to amplify a 215-nucleotide product for construct IV; primers P3 and P8 were utilize d to amplify a 2 16-nucleotide p roduct for construct V; primers P3 and P7 were paired to amplify a 409-nucleotide product for c onstruct VI; primers P5 and P9 were utilized to amplify a 131-nucleotide p roduct for construct VII; primers P10 and P9 were paired to amplify a 106-nucleotide product for construct VIII; and primers P11 and P7 were employed to amplify a 1 55-nucleotide p roduct for construct IX. PCR products were subsequently cloned via KpnI/BglII restric- tion sites into the promoterless vector pGL3-Enhancer (Promega) and then utilized for LipofectAMINE Plus- mediated transien t transfection of CV1 ce lls followed 24 h later by analysis of luciferase activity utilizing the Lucife rase Assay System o f Promega. Empty p GL3-Enhancer vector and the SV40-containing promoter vector pGL3-Promoter were used as controls. MyoD vector used for c otransfection of CV1 cells with the pre-exon 1 iPLA 2 c construct was obtained from M. Chin (Harvard Medical School) [36]. Results were normalized to b-gal resulting fro m cotransfec- tion with a LacZ vector. 5¢-Rapid amplification of cDNA ends (RACE) 5¢-RACE was performed as p reviously described employin g human heart M arathon-Ready cDNA (BD Bioscien ces) and primers AP1 and M460 [26]. PCR products were gel purified with a QIAquick gel extraction kit, subcloned into pGEM-T vector (Promega), sequenced and analyzed by alignment with iPLA 2 c sequences. Electrophoretic mobility shift analyses Electrophoretic mobility shift analyses (EMSA) were per- formed with the Promega gel shift assay s ystem according to the manufacturer’s specifications by using 2 lg of nuclear protein for each gel shift reaction. For analysis o f t he 5¢-transcription inhibitory region of iPLA 2 c, double-stran- ded oligonucleotides containing 5 ¢-iPLA 2 c, sequence were end-labeled with [ 32 P]ATP using T 4 polynucleotide k inase, as instructed by the manufacturer (Promega). Competition studies were performed by adding a 100-fold molar excess of unlabeled oligonucleotide or nonspecific control oligo- nucleotide to the reaction m ixture p rior to the addition of radiolabeled probe. Reaction mixtures were analyzed on Novex 6% DNA retar dation polyacrylamide gels in 0.5· TBE (89 m M Tris/HCl, pH 8.0; 89 m M boric acid; 2 m M EDTA) as the running buffer. Electrophoresis was per- formed at 298 V for 20 m in, at 4 °C followed by drying of the gel at 80 °C under vacuum and visualization of DNA– protein complexes by autoradiography for 12–18 h. Sense and reverse complement oligonucleotide sequences corres- ponding to the following sequences were synthesized and annealed: g50 (5¢-TATTAATCTGACTGTAGATATAT ATATATTACCTCCTTAGTAATGC-3¢) and random- ized control g50c (5¢-TTGATAGTTATCTATTACAG TCTTCTTAGATTGAAACAA-3¢), g177 (5¢-CATACAA ACATAATAAGATGTAAATGG-3¢) and control g177c (5¢-TCATCTAAGTACAATAGATAGAAGAAA-3¢), g230 (5¢-TGTTACTCTCCAAGCAAC CA-3¢) and control g230c (5¢-GACACTTGTCATCACACTCA-3 ¢). For a na- lysis of the pre-exon 1 region, myo2 double-stranded DNA having the sequence 5 ¢-GAAGTACAGGTGTGGCTGG- 3¢ was u tilized along w ith control myo2ctl (5¢-GATCG TTGTGAAGAGGGCG-3¢). For analysis of the pre- exon 2 promoter region, Inr double-stranded DNA having the sequence 5¢-GCGTCACTTCCGCTGGGGGCGG-3¢ was utilized along with randomized control Inrc (5¢-GTG GCCGGGTGGTCCACCTCGG-3¢). Mitochondrial target prediction, iPLA 2 c–GFP constructs and confocal microscopy The internet-based MITOPROT computer program (http:// www.mips.gsf.de/cgi-bin/proj/medgen/mitofilter) [37] was utilized for prediction of mitochondrial targeting sequences in iPLA 2 c. To prepare the 74-GFP construct, complement- ary 5¢-phosphorylated primers (5¢-TCGAGCCAC CAT GATTTCACGTTTAGCTCAATTTAAGCCAAGTTCC CAAATTTTAAGAAAAGTAG-3¢ and 5¢-TCGACTACT TTTCTTAAAATTTGGGAACTTGGCTTAAATAAA CGTGAAATCATGGTGGC-3¢) were annealed by heat- ing a 4-l M mixture of primers to 95 °C for 3 min followed by cooling to 22 °C prior to cloning into the Xho1/Sal1 sites of vector pEGFP-N3. Integrity and orientation of the N-terminal fusion products were verified by sequencing. Vector pDsRed2-Mito (BD Biosciences), which encodes a mitochondrial-targeting sequence of human cyto- chrome c oxidase fused to red fluorescent protein, was utilized as a mitochondrial marker. HeLa cells were grown on two-well Laboratory Tek chamber slides to 60–80% confluency prior to LipofectAMINE Plus (Invitrogen) mediated single or cotransfection according to the manu- facturer’s suggested protocol. After 48 h, cells were washed in NaCl/P i , fixed with 4% (v/v) paraformaldehyde, coverslipped and fluorescence was analyzed utilizing a Zeiss Axiovert 200 (Carl Zeiss Inc., Thornwood, NY, USA) equipped with Zeiss LSM-510 confocal system with a63· oil immersion objective and excitation wavelengths of 488 and 633 nm. Single transfections with either pDsRed2-Mito or 74-GFP construct were utilized to optimize immunofluorescence conditions and eliminate bleed-through. Filters were optimized for double-label experiments to minimize bleed-through and fluorescence images were collected by utilizing Zeiss LSM software. Results Identification of transcriptional regulatory elements nested in the 5¢-coding region of iPLA 2 c In previous work, we demonstrated that expression of a baculoviral construct encoding the full-length 88 kDa coding sequence of iPLA 2 c in Sf9 cells resulted instead in the p roduction of downstream polypeptides of 77 a nd 63 kDa in nearly equal amounts [26]. This was remarkable because translation initiation almost always occurs at the Ó FEBS 2004 Regulation of iPLA 2 c biosynthesis (Eur. J. Biochem. 271) 4713 AUG most proximal to the polyhedrin baculoviral promo- ter [ 38,39]. Accordingly , the virtual absence of the 88 kDa protein product was unanticipated. To begin identifying the reasons underlying the differential expression of iPLA 2 c polypeptides, we prepared pFASTBac1 vectors with the baculovirus p romotor proximal to each o f the individual AUG putative translation initiation codons. Analysis of t he membrane fractions from Sf9 cells infected at identical MOIs with vector harbori ng the construct containing the polyhedrin promoter proximal to sequence encoding the full-length iPLA 2 c 88 kDa polypeptide revealed two bands of  77 and 63 kDa as previously reported [26] with the 63 kDa being the predominant product (Fig. 1, lane 1). An uncharacterized band of  50 kDa was also present in a ll fractions, including the uninfected control ( lanes 4 and 8), which may represent either endogenous Sf9 cell iPLA 2 c protein or alternatively nonspecific antibody binding. Ana- lysis of t he membrane fraction from Sf9 cells infected with vector harboring the truncation mutant encoding the putative 74 kDa polypeptide revealed modest bands cor- responding to the 74- and 63 kDa protein products (Fig. 1, lane 2). The chemical identity of the minor protein product of molecular mass > 74 kDa (Fig. 1, lane 2) is unclear and may be due to secondary processing of the 74 kDa product which could migrate anomalously. Alternatively, w e cannot rule out the possibility that a minor amount of 3¢ read- through from the expression co nstruct occurred. Remark- ably, expression of the construct containing the polyhedrin promoter proximal to sequence encoding the predicted 63 kDa product was over 75-fold higher than constructs encoding either the 74- or 88 kDa protein products (Fig. 1, lanes 3 and 7). Lysates f rom v iral infections of the construct producing the r ecombinant 6 3 kDa product pos sessed r obust P LA 2 activity (as assessed by release of oleic a cid from plasmenyl- PC) t hat was markedly higher than that manifest in either the 88- or 74 kDa transfected cells (data not s hown). The rate of hydrolysis using p lasmenylcholine was similar to t hat using phosphatidylcholine (each radiolabelled a t the sn -2 position with 9 ,10-[ 3 H]oleic acid). These results demonstrate that the i PLA 2 c enzyme can attack the sn-2 carbonyl a nd suggest that hydrolysis of these substrates by the 63 kDa iPLA 2 c occurs predominantly at the sn-2 position. Measurement of mRNA content and kinetics of mRNA species encoding individual iPLA 2 c isoforms Alterations in the amount of iPLA 2 c isoform expression could be due to changes in mRNA synthesis, differences in mRNA half-lives, or translational mechanisms for each of the sequentially truncated coding constructs. Accordingly, we first examined the amount and stability of mRNA resulting from each of the constructs in the baculoviral expression system. Northern analysis revealed only modest amounts of mRNA mass corresponding to the constructs encoding the 88 k Da protein and virtually none encoding the message for the 74 kDa protein (Fig. 2A). Remarkably, a dramatic increase in the mRNA content in cells transfected with vector encoding the 63 kDa protein product w as present (Fig. 2A). These experiments were all performed at identical MOIs and reproduced on multiple occasions. After actinomycin D treatment, the half-life of each mRNA species was compared by two independent techniques. First, compar isons of iPLA 2 c mRNA mass expressed from each of the constructs over a 4 h interval following actinomycin D treatment did not reveal any discernable differences in mRNA stability by northern analysis (t 1/2  1–2 h; Fig. 2B). Second, quantitative PCR analysis after actinomycin D treatment indicated that mRNA levels expressed following viral infection with the 63 kDa construct w ere substantially higher than those o f either the 88- or 74 kDa constructs (t 1/2  2–4 h; Fig. 2C). Collectively, these results demonstrated that transcriptional regulation was a major mechanism underlying the experi- mentally observed dramatic increase in the 63 k Da protein mass but did not rule out contributions from translational mechanisms as well (vide infra). Localization of the regulatory domain mediating transcriptional repression of the iPLA 2 c constructs The observed differences in baculoviral expression patterns of the sequentially truncated iPLA 2 c message suggested that a transcriptional i nhibitory element w as present comprised of nucleic acid sequence encoding the N-terminus of iPLA 2 c located between the 88- and 63 kDa potential translational initiation sites. To localize the regulatory domain upstream ofthe63kDastartsiteofiPLA 2 c responsible for the observed transcriptional repression, PCR products contain- ing 124-nucleotide blocks of sequence upstream of the 63 kDa start site were amplified from iPLA 2 c template and inserted between the SV40 promoter and a luciferase reporter gene in a pGL3-promoter vector for transient expression in monkey kidney (CV1) cells. Through this approach, w e sought to determine which elements in the 5¢-coding sequence a cted as transcriptional repressors in a mammalian cell line. Constructs corresponding to each of the first four 124-nucleotide sequences encoding truncated sequences from the 5¢ of nucleo tide 315 greatly inhibited luciferase expession (on average  80%), whereas segments further 3¢ were not inhibitory in comparison with control Fig. 1. Baculoviral e xpression of truncated iPLA 2 c polypeptides initi- ating translation at downstream in-frame initiator methionine residues. Sf9 cells were infected with iPLA 2 c con structs initiating at the 88, 74 or 63 kDa start sites. At 48 h postinfection, cells we re collected and membrane (lanes 1–4) and cytosolic (lanes 5–8) fractions were p re- pared a s described in Experimental proced ures. Fractions (100 lg protein per lane) w ere loade d onto a 10% polyacrylamide gel, resolved by S DS/PAGE, transferred to a p oly(vinylidene difluoride) me mbrane, incubated with immunoaffinity-purified antibody directed against iPLA 2 c and visualization of immunoreactive bands by ECL. Expressed recombinant polypeptides are de sign ated according to their expected masses. Lanes 1 and 5, 88 kDa iPLA 2 c; lanes 2 and 6, 74 kDa iPLA 2 c; lanes 3 and 7, 63 kDa iPLA 2 c; lanes 4 and 8, wi ld-type control baculovirus. Molecular mass standards are indicated on the left. 4714 D. J. Mancuso et al. (Eur. J. Biochem. 271) Ó FEBS 2004 vector (P<0.001) (Fig. 3 A). Moreover, EMSA of the 5¢-coding region utilized for the above s tudy (nucleotides 1–230 of iPLA 2 c) revealed three separate regions producin g gel shifts, a ll localized within the identified region of tran- scriptional repression. Oligonucleotide g 50 was predicted to contain s ites with a high match to chicken homeobox CdxA binding sites. Oligonucleotide g177 shares homology with the Oct1 binding site, whereas oligonucleotide g230 did not contain a predicted site for binding of nuclear proteins. Utilizing radiolabeled oligonucleotide dimer g50 (corres- ponding to residues 6–50 starting from the 88 kDa AUG codon) a single shifted protein-radiolabeled DNA complex utilizing HeLa nuclear extract was identified which was competed out with a 100-fold molar excess of unlabeled oligonucleotide dimer g50 but not with nonspecific control g50c oligonucelotide dimer (Fig. 3B, column 1, arrow). Similarly, oligonucleotide dimers g177 and g230 also produced shifted bands that were specifically competed out with 100-fold molar excess unlabeled oligonucleotide dimer but not with nonspecific control oligonucleotide dimer (Fig. 3B, columns 2 and 3). Translational regulation of iPLA 2 c in myocardium Owing to the obvious complexity of the regulation of iPLA 2 c resulting from the combined presence of transcrip- tional and trans lational regulation, we recognized that current hypotheses relegating the role of iPLA 2 c exclusively to peroxisomal lipid metabolism were likely limited in appropriate scope. In prior work, we identified robust amounts of iPLA 2 activity in the mitochondrial compart- ment of both canine and human hearts [7,8]. Moreover, we recognized early on that t he iPLA 2 family of proteins had the potential for providing substrate f or mitochondrial fatty acid oxidation by lipid hydrolysis [7], for g enerating lipid second messengers ( eicosanoids and l ysolipids), for modu- lating ion channel kinetics [19,40] and for providing fatty acids for univalent transmembrane ion transport [41]. Accordingly, we c onsidered the possibility t hat myocardial iPLA 2 c may be present in mitochondria. Western analysi s demonstrated that iPLA 2 c cosedimented with mitochondria (in the light mitochondrial fraction) (Fig. 4). Remarkably, multiple high m olecular mass (63–88 kDa) immunoreactive proteins were detected in rat mitochondria after differential centrifugation o f r at hear t homogenates, c onsistent with the utilization of translation initiation sites producing 88, 77, 74 and 63 kDa protein p roducts. Products corresponding to the 77 a nd 74 kDa products were t he major i mmuno- reactive bands. A dditional lower molecular m ass immuno- reactive bands were also detected (< 60 kDa). Collectively, these results identified the presence of multiple iPLA 2 c protein products in mitochondria resulting from usage of different translation initiation codons in rat myocardium. Alternative splicing of iPLA 2 c in mammalian tissues In the years since our first report of the g enomic organiza- tion of the iPLA 2 c gene, i ncreasing evidence o f extensive Fig. 2. Analysis of iPLA 2 c mRNA in the baculoviral system. (A) Sf9 cells were infected w ith iPLA 2 c constructs en coding full-len gth (88 kDa) or truncated 74 an d 63 kDa pro ducts. At 48 h postinfectio n, cells were recovered and total R NA was extracted, fractionated on a latitude RNA gel, transferredtonylonmembraneandhybridizedwith[ 32 P]iPLA 2 c probe followed by autoradiography as described in Experimental procedures. Lane 88 kDa, RNA f rom 8 8 kDa full-length expression; lane 7 4 kDa, RNA from 74 kDa ex pression; l ane 63 kDa, RNA from 63 kDa expressio n. The relative positions of RNA size markers in kb are indicated on the left. (B) N orthern analysis of total RNA e xtracted from Sf9 ce lls infecte d for 48 h with re combinant full-length or truncated iPLA 2 c baculovira l c onstructs and then treated with actinomycin D for 0, 0.25, 0 .5, 1, 2 or 4 h prior to RN A e xtraction. Lane 88 kDa, RNA from 88 kDa fu ll-length expression; lane 7 4 kDa, R NA from 74 kDa expre ssion; lane 63 kDa, RNA f rom 63 kDa expression. The relative positions of RNA size mar kers a re shown in k b on the left. (C) Quantitative P CR analys is of iPLA 2 c mRNA levels. RNA isolated and DNase treated from 48 h infected Sf9 cells was revers e transcr ibed usin g MultiS cribe reverse transcriptase and the resultant cDNA (20 ngÆreaction )1 )utilizedinquantitativePCRasdescribedinÔExperimental proced ures.Õ Log of the relative mRN A level i s p lotted v s. time (in hours) after actinomycin D addition for RNase-free DN ase-treated R NA extracts of baculoviral extracts e xpressing the 63 kDa ( m), 74 kDa (j)and88kDa(r)iPLA 2 c p olypeptides. Ó FEBS 2004 Regulation of iPLA 2 c biosynthesis (Eur. J. Biochem. 271) 4715 alternative splicing in the 5¢-region of t he iPLA 2 c gene has accumulated along with evidence for the existence of two previously undescribed exonic sequences within some of the alternatively spliced iPLA 2 c variants in GenBank TM data- bases. Although previously only present as raw sequence in the EST database, we now specifically identify two novel sequences as iPLA 2 c exons. The first exon comprised of 296 nucleotides was located at the 5¢-end of EST sequences containing iPLA 2 c sequence and is the 5¢-most exonic sequence located thus far for the iPLA 2 c gene. F or this reason, t his exon has been designated exon 1 (Fig. 5 ). Based on its location relative to other iPLA 2 c exons, we have designated the second new exon as exon 4 . Exon 4 is comprised of 112 nucleotides and, remarkably, has a high degree of homology with the human mammalian transpo- son-like element MaLR repeat sequence. The s ignificance of this sequence homology in the context o f exons within the iPLA 2 c gene remains unknown. Thus, the second draft of the iPLA 2 c genomic map contains 13 exons, the first four of which contain noncoding sequence (Fig. 5). The first potential in-frame AUG start site occurs in exon 5 , while the nucleotide binding and lipase consensus sites occur in exons 7 and 8, respectively, and the peroxisomal localiza- tion signal occurs in exon 13 (Fig. 5). Fig. 4. Immunoblot analysis of iPLA 2 c in subcellular fractionations of rat heart. E quivalent subcellular fractions (100 lg protein) of rat heart prepared as described in Experimental procedures were loaded on a 10% gel, resolved by SDS/PAGE , transferred to a poly(vinylidine difluoride) membrane, incubated with immunoaffinity-purified anti- iPLA 2 c, a nd im munoreac tive ba nds were visualized by ECL. Lane 1, rat heart homogenate; lane 2, crude pellet; lane 3, heavy mitochondrial fraction; lane 4, 23 500 g light mitochondrial f raction; lane 5, 70 000 g light mitochondrial fraction; lane 6, nuclear fraction. Molecular mass markers are indicated on the righ t. Fig. 3. Identification of a regulatory domain within t he coding region of iPLA 2 c using a luciferase reporter assay system. Th e i nhib itory e ffect of iPLA 2 c sequences on luc iferase expression were examined by prepar- ing a series iPLA 2 c-pGL3-Prom oter constructs consisting of 124-nucleotide segments of iPLA 2 c sequence (fro m the region upstream from the 63 kDa i PLA 2 c start site) cloned immedia tely upstream fro m the luciferase reporter gene in vector p GL3-Promoter. CV1 cells were transiently t ransfected with the iPLA 2 c-pGL3-Pro- moter constructs (100 ng) and harvested 24 h later to assay luciferase activity as described in Experimental procedures. (A) The regions of the iPLA 2 c coding sequence included in iPLA 2 c-pGL3-Promoter constructs 88, 87, 85, 83 and 80 as well as regions correspond ing to oligonucleotide g50, g 177 a nd g230 used for EMSA are schematically represented. A portion of t he 5¢ iPLA 2 c coding sequence (iPLA 2 )is represented in the center of the diagram as a heavy solid bar w ith the scale in nucleotides ( nt) sh own below. (B) The bar graph i ndicates the relative luminescent value of iPLA 2 c-pGL3-Prom oter constructs 88, 87, 85, 83, 80 and 74 compared with unmodified pGL3-Promoter control vec tor u sed i n t he lu cife rase as say system. Results represent the average o f three sets of data (± SE). Co mp arison of the RFV o f the 80 construct with 88, 87, 85 and 83 constructs (P < 0.001) is indicated (*). (C) E MSA o f t he iPLA 2 c regulatory domain. EMSA was per- formed utilizing double-stranded radiolabeled oligonucleotides g50 ( 1), g177 (2), and g230 (3) as d escribed in Experimental procedures. Lane a , negative control minus HeLa nu clear extract; lane b, positive co ntrol containing HeLa nuclear extract; lane c, competitive assay containing 100-fold molar excess o f unlabeled oligonucleotide; lane d, noncom- petitive assay containing 100-fold molar excess unlabeled nonspecific control oligonucleotide. Results are representative of three s eparate EMSA. Arrows: specific DNA–nuclear protein complex. 4716 D. J. Mancuso et al. (Eur. J. Biochem. 271) Ó FEBS 2004 In addition to transcriptional regulation of mRNA levels, alternative splicing represents an additional mechanism for the r egulation of iPLA 2 c biosynthesis. Examination of the EST database a nd 5¢-RACE analyses revealed a total of ten different splice variants from eight different tissues which begin with e ither t he exon 1 or e xon 2 sequence (but do not contain both) (Fig. 6). Multiple iPLA 2 c splice variants were identified in a wide range of t issues, including human heart, smooth muscle, endothelial cell, hippocampus, t estis, pitu- itary, placenta and pancreas. The predominant splice variant isolated by 5¢-RACE, and the one most often present in the EST d atabase, was splice v ariant VI followed by splice variants V and IV. Multiple splice variants from different tissues that differ w ith regard to their 5 ¢-terminus were present. Seven begin with exon 2, whereas three begin with the exon 1 sequence. Splice variants I and II do not contain the exon 5 sequence and thus do not contain sequence for the four alternative AUG start sites initiating biosynthesis of the 88, 77, 74 and 6 3 k Da iPLA 2 c isoforms. Instead, based on current information about iPLA 2 c and i ts splicing, the fi rst in -frame AUG site is downstream o f the nucleotide binding and lipase consensus domains and thus encodes a putative potential 33 kDa polypeptide which does not contain the serine active site. The reasons underlying the presence of this product are unknown, but it could be involved in regulatory events similar to s plice variants o f iPLA 2 b previously identified that do not contain the active site serine [42–44]. Splice variants III, IV, VIII and IX have an alternative AG/GT splice site within exon 5 resulting in a truncated exon 5 that is missing the 88 kDa iPLA 2 c start site. Intere stingly, the alternative splicing that g enerates variant IV results in a new 5 ¢ in-frame AUG start site, which Fig. 6. Splice variants o f iP LA 2 c be ginning with e ither exon 1 or ex on 2. A diagrammatic representation of iPLA 2 c e xons is indicated at the top with the relative locations of th e 88, 77, 74 a nd 63 kDa ATG start sites indicated by triangles. Vertical arrows indicate th e locations of t he nucleotide (ATP) and lipase consensus s ites. Representatio ns of ten splice variants a re sho wn b elow with lines indicating splicing across exons. O pen boxes represent 5¢-untranslated sequence while shaded boxes represent the open reading frame . In addition to the f our upstre am A TG start sites encoding 88, 7 7, 74 and 63 kDa products, all potential in-frame downstream ATG start sites are also indicated with triangles. Slashes ind icate the e xtent of known seque nce f or e ach ES T. Asterisks designate splice v ariants ide ntified by 5¢-RACE in this study. Fig. 5. G enomic m ap of iPLA 2 c. The intron–exon boundaries of the iPLA 2 c gene are sho wn in scale (k b). The 13 exons o f the iPLA 2 c gene a re indicated as boxes. Spaces between the exons represent t he relative sizes of the 12 introns contained within the iPLA 2 c gene. Re gions of the gene t hat correspond to the nucleotide binding, lipase, and peroxisomal localization consensus sequences are indicated in exons 7, 8 and 13, respectively. Open boxes at the bottom indicate the n ucleot ide numbers (corresponding to the original BAC genomic clone report, GenBank accession number AC005058) with the sizes of each exon in nucleotides (nt) and in amino acids (aa) shown within. The asterisk is i nserted to note that different 5¢ extents of exon 2 have been reported in GenBank [26, 45] a s well as in the EST database. Ó FEBS 2004 Regulation of iPLA 2 c biosynthesis (Eur. J. Biochem. 271) 4717 can potentially encode a polypeptide of 91.6 kDa. Trans- lation from this upstream A UG site thus results i n an additional potential N-terminal 43 amino acids from sequence previously regarded as 5 ¢-untranslated sequence. Because of the truncation of exon 5 , there is also a loss of 15 amino acids including the 8 8 k Da start site. The c omplete sequence of two splice v ariants (V and VI) h as been published [ 26,45]. 5 ¢-RACE w as utilized to clone sequence corresponding to splice variants III, IV, V, VI, VII, IX and X in this study. Sequence for splice sequence IX, isolated in this study by 5¢-RACE of human myocardial cDNA, has not been previously reported in the EST database. Collec- tively, these results underscore the complexity in the genetic and molecular biologic m echanisms regulating the tran- scriptional processing of iPLA 2 c into moieties suitable fo r translation o f s pecific polypeptides potentially tailored t o fulfill specific biologic roles in different tissues. Identification of alternative promotors present in iPLA 2 c and demonstration of three MyoD regulatory elements Alternative promoter usage represents yet another potential mechanism for the regulation of t he biosynthesis of iPLA 2 c. Because iPLA 2 c splice variants began with either exon 1 or exon 2, sequences upstream of these exons were next examined for promoter a ctivity. Accordingly, we prepared constructs in which 584 nucleotides of upstream iPLA 2 c sequence from each e xon were utilized to drive luciferase reporter gene expression in CV1 cells. Sequences upstream of exon 2 had high promoter activity, whereas the pre- exon 1 sequence had negligible prom oter activity in CV1 cells (Fig. 7A). Truncation of the 5 ¢ 200 nucleotides of the pre-exon 2 sequence (Fig. 7B, construct II) resulted in an  15-fold increase in promoter activity suggesting the presence of repressor elements in the region 400–600 nucleotides upstream of exon 2. Removal of an additional 200 nucleotides from construct II resulted in the loss of the majority of activity (construct III) indicating that the region 200–400 nucleotides upstream o f exon 2 contains a signifi- cant proportion of pre-exon 2 promoter activity. This conclusion was supported by use of a construct containing sequence 200–400 nucleotides upstream of e xon 2 (con- struct IV) which resulted in a fivefold increase in promoter activity compared with the original construct (I), whereas a construct containing sequence 400–584 nucleotides up- stream of exon 2 (V) had only slight promoter activity. Construct VI, including sequence 200–584 nucleotides upstream of exon 2 , had promoter activity similar to that of construct IV. Construct VII (sequence 300–400 nucleo- tides upstream of exon 2) had no detectable promoter activity, whereas constructs VIII (sequence 200–300 nucleo- tides upstream of exon 2) and IX (200–350 nucleot ides upstream of exon 2) had similar promoter activity com- pared with t he original construct. Promoter activity of genes are typically regulated by a complex interplay of multiple promoter elements and t his is reflected in the data prese nted in Fig. 7B. These results s uggested that a region 200–400 nucleotides upstream of exon 2 contains a major proportion of the promoter activity of the pre-exon 2 sequence. However, this activity is clearly modulated by sequences upstream a nd downst ream of this region. The region 200– 400 nucleotides upstream of exon 2 includes predicted A B C Fig. 7. Promoter analysis of the 5¢ flanking region of iPLA 2 c exon 2. (A) An iPLA 2 c promoter co nstruct containing 584-nu cleotide iPLA 2 c sequence up stream of exons 1 or 2 inserted upstream via HindIII/NcoI sites i nto the pr omoterless vector pG L3-Enhancer from Pro mega. Empty pGL3-Enhancer vector and t he SV40 containing promoter vector pGL3-Promoter were used as controls. Luciferase activity measured as relative luminescencevalueisshownforvectorpGL3- Enhancer constructs utilizing 584 nucleotide of iPLA 2 c sequen ce as an upstream promoter. Lanes indicate construct s containing as p romo ters pre-exon 1 s equence (pre-exon 1), p re-exon 2 sequence (p re-exon 2), and the promoterless vector pGL3-Enhancer (pGL3E). (B) Constructs I–IX containing sequence upstream from exon 2 were prepared by PCR a mplificatio n of intronic sequence u pstream from iPLA 2 c exon 2, cloning the PCR products into promoterless vector pGLE, followed by transfection of CV1 cells as described in Experimental procedures. Relative size s and n ucleotid e regions include d in each construct are indicated as blocks t o the left. Luciferase activity, expressed as relative luminescence value, for each construct is indicated on the right. (C) Competitive gel retardation analysis of the pre-exon 2 iPLA 2 c region utilizing In r dime r. Lane 1 , negative c ontrol min us He La nuc - lear extract; lane 2, positive control containing HeLa nuclear extract; lane 3, competitive assay containing 100-fold molar excess Inr dimer; lane 4, noncompetitive assay c ontaining 100-fold molar excess non- specific control dimer. Results a re representative of three s eparate EMSA. Arrow: specific DNA–nuclear protein complex. 4718 D. J. Mancuso et al. (Eur. J. Biochem. 271) Ó FEBS 2004 [...]... regulates the flow of the Gibbs free energy inherent in C–C bonds in fatty acids into the production of either chemical energy or heat by directing the flow of iPLA2c into either the peroxisomal compartment (expression of the 63 kDa isoform which does not possess a mitochondrial localization signal) or into the mitochondrial compartment (by production of isoforms containing a mitochondrial localization sequence)... also contain one or more specialized forms of iPLA2c in lower amounts Recently, we have implicated a role for iPLA2c in obesity by demonstrating that iPLA2c (as well as iPLA2b) is essential in hormone-induced 3T3-L1 cell differentiation into adipocytes [67] In these studies, iPLA2c message, protein mass and activity increased during adipogenesis and siRNA knockdown of iPLA2c- inhibited adipogenesis [67]... Regulation of iPLA2c biosynthesis (Eur J Biochem 271) 4721 transcriptional regulatory elements within the coding sequence of many genes exist [54–58] In this study, evidence for transcriptional regulation of iPLA2c by elements nested within the coding region was based on a dramatic and concomitant increase in both mRNA encoding iPLA2c and protein synthesis upon sequential truncation of the 5¢-end of. .. function in other genes where it can in uence many cellular processes including signal transduction, transcriptional regulation, cellular transformation and subcellular localization in other genes [60–63] Accordingly, alternative splicing of iPLA2c can modulate both the site and the amount of enzymic activity (e.g through removal of the N-terminal mitochondrial localization signal or removal of the lipase... C-terminal SKL peroxisomal localization sequences) in isoforms that carry both signals It is important to note that synthesis of the 63 kDa isoform obligatorily is relegated to the peroxisomal compartment by virtue of the absence of any N-terminal mitochondrial leader sequence in this isoform Discussion After the initial discovery of a novel intracellular calciumindependent PLA2 activity in myocardium [6],... prior northern blot analyses demonstrated that myocardium was the most abundant source of mRNA encoding iPLA2c Our results confirm the abundance of iPLA2c in myocardium and demonstrate the diverse repertoire of iPLA2c protein products generated from a single gene under complex regulatory control including transcriptional, translational and proteolytic mechanisms Recently, the functional importance of. .. increases in the understanding of mitochondrial import machinery have led to the generation of computer algorithms that can accurately assess the potential for mitochondrial localization of a peptide with great accuracy and predictive probabilities Analysis of the sequence of iPLA2c corresponding to the 74 kDa encoded peptide identified a putative mitochondrial localization sequence with a predictive value of. .. 63 kDa isoform of iPLA2c was predominantly expressed in rat liver peroxisomes [27] This study demonstrated that multiple higher molecular mass immunoreactive polypeptides were expressed in rat heart The molecular masses of the observed polypeptides were in accordance with the predicted molecular masses of the iPLA2c isoforms originating from translation initiation at each of the proximal four in- frame... products from a single gene suggests that mechanisms for diversification and specialization have evolved to allow iPLA2c to participate in regulating lipid metabolism in multiple compartments thereby contributing to orchestrating energy storage, utilization and signal transduction pathways in multiple compartments through utilization of a repertoire of discrete chemically distinct isoforms by multiple different... unsuspected complexity of catalytically active isoforms which could be discriminated based upon their molecular mass differences, subcellular localizations, kinetic characteristics, substrate selectivities, chromatographic profiles and protein chemical techniques including radiolabeling with [3H]BEL [7–12] Study of human heart PLA2 underscored the complexity of multiple distinct isoforms of iPLA2 in the . Complex transcriptional and translational regulation of iPLA 2 c resulting in multiple gene products containing dual competing sites for mitochondrial. [7], for g enerating lipid second messengers ( eicosanoids and l ysolipids), for modu- lating ion channel kinetics [19,40] and for providing fatty acids for