so do you think of any solutions for these difficulties to have a better performance in forum
What do you think of the opinionpolls? doc
... before predictions are made with any degree of certainty Money is the instrument of exchange, helping in buying and selling and also in fixing a value on things and commodities It may be in ... indirectly resorted to at international level Money is helpful as a standard of price Money helps the owner to have power not only in buying things but also in influencing many human activities ... selected very carefully so that the right balance of ages, sexes and social classes can be achieved At first it was very difficult for many people to accept that a sample of one or two thousand could...
- 8
- 479
- 0
What do you think of the uselesstrifles? ppsx
... radio built into a toilet paper container Comfort and convenience are carried to extremes in the area personal care Without any real effort at all, or so the ads in these catalogues claim, you ... workload is certainly appreciated by any home maker Unfortunately, some of these clever items that claim to save time might actually end up making us waste time Take, for example, devices to save ... claim, you can go to bed and wake up feeling and looking better After taking special pills to melt away excess pounds, you can crawl into your bed and let it massage you all night long (A curious...
- 7
- 273
- 0
What do you think of the important role of the teaching of crafts in the school
... sống cho học sinh Ông thực hành hàng thủ công đặc thù đ a phương Đối với chàng trai trưởng thành hàng thủ với giá trị tiện ích hồ s a ch a, dây điện s a ch a radio nên dạy Điều có ngh a có thêm công ... Từ pin thông thường cho nhiều máy bay siêu âm tinh vi máy tính, người đàn ông thể khả để tạo chí vượt qua thiên nhiên Tinh thần sáng tạo liên quan đến gọi thủ công chương trình học Bất học sinh ... chuẩn bị cho học sinh cho sống mà cô giải sống công dân bình thường, cho họ cho xã hội nói chung Để hữu ích cần đào tạo để sử dụng khoa hay tài cách tốt Các khoa vật chất, tinh thần trí tuệ Nên...
- 3
- 240
- 0
Báo cáo toán học: " Nonexistence of nontrivial solutions for the p(x)-Laplacian equations and systems in unbounded domains of Rn" docx
... Nonexistence of nontrivial solutions for the p (x) −Laplacian equations and systems in unbounded domains of Rn AKROUT Kamel∗1 Department of mathematics and informatics.Tebessa university Algeria Email: AKROUT ... Khodja, Nonexistence of solutions for semilinear equations and systems in cylindrical domains Comm Appl Nonlinear Anal (2000), 19-30 10 W NI & J Serrin, Nonexistence thms for quasilinear partial ... Kamel∗ - akroutkamel@gmail.com; ∗ Corresponding author Abstract In this paper, we are interested on the study of the nonexistence of nontrivial solutions for the p (x) −Laplacian equations, in...
- 12
- 308
- 0
báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf
... AQGV-GITLS -PVQAKRAND -PVQAQRANA -PVQAQRANA -PVQAQRANS -PVQAKRAND SPVQAQRAQQ -PVQAERANA -PVQAERGNA -PKQAARANA -PVQANRAIA LAAAQSLAHK LAAAQGLDDK LAAAQGLADK LAAAQGLADK LAAAQSLSHK LADAQGLNGK LAAAQGLADK ... (5’ to 3’) GCACAATAAATTGGGCCTGA GCGAGTGTTGGGCTAAGTCT Reverse KSC138-23 TAAAGCCGCCTAGCCGATTG Forward TGCAGCAATAATCAATCAAATAGAA Reverse KSC138-22 TTCAATCAAATTTAGCACGTGTATT Forward CGGTCCAGATTTAATTCTTTCACTC ... g-TMT1 Forward CTGGAGGCAGAGTATAGCG Reverse AAACTCCCAGGTCCCACCCAAT g-TMT2 Nucleotide sequence (5’ to 3’) Forward CAGTGGACTTAAAACCATAAAGGGAGC CCACATACTCTATATCATTCACACGAG Forward TGATTAACAGGGACAGTCGG...
- 17
- 432
- 0
also, what kind of trade policy do you think should the government adopt for the benefit of the country as whole
... theory of national competitive advantage Company Proprietary and Confidential Company Proprietary and Confidential Part I: THE FRAMEWORK Trade theory • The theories of international trade also matter ... matter to international businesses because firms are major players on the international trade scene Company Proprietary and Confidential Company Proprietary and Confidential Company Proprietary and ... 73 Company Proprietary and Confidential Company Proprietary and Confidential Company Proprietary and Confidential Company Proprietary and Confidential PART III PART II Primary concern of government...
- 20
- 1,303
- 0
báo cáo khoa học: " Survey of smokers'''' reasons for not switching to safer sources of nicotine and their willingness to do so in the future" pdf
... is as bad for you as smoking I believe that using nicotine in any form is as bad for you as smoking I believe that using smokeless tobacco is socially unacceptable or gross (because you have to ... Institute, Cary, North Carolina) was used for data cleaning and analysis Our analysis methodology called for simply reporting univariate summaries of responses as well as the bivariate analysis that appears ... switching to ST to stop smoking but continuing to use nicotine1 I believe that using tobacco in any form is as bad for you as smoking I believe that using smokeless tobacco is socially unacceptable...
- 8
- 361
- 0
Báo cáo toán học: " Existence of Positive Solutions for Nonlinear m-point Boundary Value Problems on Time Scales" doc
... ordinary differential equations (BVPs for short) arise in a variety of different areas of applied mathematics and physics For example, the vibrations of a guy wire of a uniform cross section and ... a positive solution to a first-order p-Laplacian BVP on a time scale Nonlinear Anal 74, 1926–1936 (2011) 22 20 He, ZM: Double positive solutions of boundary value problems for p-Laplacian dynamic ... corresponds to a multi-point boundary value condition [5] The study of multi-point BVPs for linear second-order ordinary differential equations was initiated by Il in and Moiseev [6] Since then many authors...
- 24
- 398
- 0
Báo cáo hóa học: "Existence of positive solutions for nonlocal second-order boundary value problem with variable parameter in Banach spaces" doc
... Immediate publication on acceptance Open access: articles freely available online High visibility within the field Retaining the copyright to your article Submit your next manuscript at springeropen.com ... (1.1) In Section 3, the main results will be stated and proved Basic facts about ordered Banach space E can be found in [10,11] In this article, let me just recall a few of them The cone P in E induces ... (2009) doi:10.1016/j.na.2008.04.015 10 Guo, D, Lakshmikantham, V, Liu, X: Nonlinear Integral Equations in Abstract Spaces Kluwer Academic Publishers, Dordrecht (1996) 11 Guo, D, Lakskmikantham,...
- 6
- 297
- 0
Báo cáo hóa học: " Blow-up criterion of smooth solutions for magneto-micropolar fluid equations with partial viscosity" pptx
... Fan, J: Logarithmically improved regularity criteria for the 3D viscous MHD equations Forum Math (2010, in press) 35 Beale, J, Kato, T, Majda, A: Remarks on the breakdown of smooth solutions for ... is of major importance for both theoretical and practical purposes For incompressible Euler and Navier-Stokes equations, the well-known Beale-Kato-Majda’s criterion [35] says that any solution ... E, Rojas-Medar, M: On the uniqueness and regularity of the weak solution for magneto-micropolar fluid equations Revista de Matemáticas Aplicadas 17, 75–90 (1996) Ortega-Torres, E, Rojas-Medar,...
- 11
- 314
- 0
báo cáo hóa học: " Existence and multiplicity of positive solutions for a nonlocal differential equation" docx
... b Then, A has at least ... Republic of China 2College of Science, Hohai University, Nanjing 210098, People’s Republic of China 3Department of Mathematics, Nanjing University of Aeronautics and Astronautics, Nanjing 210016, ... Sign-changing solutions of Kirchhoff type problems via invariant sets of descent flow J Math Anal Appl 317 (2), 456–463 (2006) doi:10.1016/j.jmaa.2005.06.102 10 Guo, D, Lakshmikantham, V: Nonlinear...
- 11
- 324
- 0
Báo cáo hóa học: " Research Article Existence of Positive Solutions for Nonlocal Fourth-Order Boundary Value Problem with Variable Parameter" doc
... Bai, “The method of lower and upper solutions for a bending of an elastic beam equation,” Journal of Mathematical Analysis and Applications, vol 248, no 1, pp 195–202, 2000 Z Bai, “The upper and ... positive solutions to a singular cantilever beam equation,” Journal of Mathematical Analysis and Applications, vol 363, no 1, pp 138–154, 2010 15 J Zhao and W Ge, “Positive solutions for a higher-order ... 1.1 can be regarded as the special case of BVP 1.2 with B t β Since the parameters B t is variable, we cannot expect to transform directly BVP 1.2 into an integral equation as in 16 We will apply...
- 11
- 423
- 0
báo cáo hóa học:" Research Article Existence of Homoclinic Solutions for a Class of Nonlinear Difference Equations" pot
... dynamical systems have been already recognized from Poincar´ ; homoclinic orbits play an important role in analyzing the chaos of e dynamical system In the past decade, this problem has been intensively ... nonlinear differential equations,” Journal of Mathematical Analysis and Applications, vol 217, no 1, pp 1–14, 1998 10 M Marini, “On nonoscillatory solutions of a second-order nonlinear differential ... 430, 2003 A Castro and R Shivaji, “Nonnegative solutions to a semilinear Dirichlet problem in a ball are positive and radially symmetric,” Communications in Partial Differential Equations, vol...
- 19
- 394
- 0
báo cáo hóa học:" Research Article Global Structure of Nodal Solutions for Second-Order m-Point Boundary Value Problems with Superlinear Nonlinearities" pot
... Functional Analysis, vol 7, pp 487–513, 1971 G T Whyburn, Topological Analysis, Princeton Mathematical Series No 23, Princeton University Press, Princeton, NJ, USA, 1958 10 Y Naito and S Tanaka, “Sharp ... sign-changing solutions for some m-point boundary-value problems,” Electronic Journal of Differential Equations, vol 2004, no 89, pp 1–14, 2004 S Jingxian, X Xian, and D O’Regan, “Nodal solutions for ... that L−1 ζ n u o u for u near in E The results of Rabinowitz for 3.8 can be stated as follows For each integer k ≥ ν n 1, ν ∈ { , −}, there exists a continuum {Ck } of solutions of 3.8 joining...
- 12
- 309
- 0
Báo cáo sinh học: " Research Article Existence and Lyapunov Stability of Periodic Solutions for Generalized Higher-Order Neutral Differential Equations" potx
... Journal of Mathematical Analysis and Applications, vol 329, no 1, pp 677–689, 2007 10 M R Zhang, “Periodic solutions of linear and quasilinear neutral functional-differential equations,” Journal of ... σ are constants ≡ Since the neutral operator is divided into two cases |c| / and |c| 1, it is natural to study the neutral differential equation separately according to these two cases The case ... Journal of Mathematical Analysis and Applications, vol 325, no 1, pp 377–385, 2007 12 R E Gaines and J L Mawhin, Coincidence Degree, and Nonlinear Differential Equations, Lecture Notes in Mathematics,...
- 21
- 349
- 0
báo cáo hóa học:" Existence of Positive Solutions for Nonlinear m-point Boundary Value Problems on Time Scales" pdf
... ordinary differential equations (BVPs for short) arise in a variety of different areas of applied mathematics and physics For example, the vibrations of a guy wire of a uniform cross section and ... a positive solution to a first-order p-Laplacian BVP on a time scale Nonlinear Anal 74, 1926–1936 (2011) 22 20 He, ZM: Double positive solutions of boundary value problems for p-Laplacian dynamic ... corresponds to a multi-point boundary value condition [5] The study of multi-point BVPs for linear second-order ordinary differential equations was initiated by Il in and Moiseev [6] Since then many authors...
- 24
- 193
- 0
báo cáo hóa học:" Existence of Positive Solutions for Nonlinear m-point Boundary Value Problems on Time Scales" pptx
... ordinary differential equations (BVPs for short) arise in a variety of different areas of applied mathematics and physics For example, the vibrations of a guy wire of a uniform cross section and ... a positive solution to a first-order p-Laplacian BVP on a time scale Nonlinear Anal 74, 1926–1936 (2011) 22 20 He, ZM: Double positive solutions of boundary value problems for p-Laplacian dynamic ... corresponds to a multi-point boundary value condition [5] The study of multi-point BVPs for linear second-order ordinary differential equations was initiated by Il in and Moiseev [6] Since then many authors...
- 24
- 213
- 0
báo cáo hóa học:" Existence of positive solutions for fourth-order semipositone multi-point boundary value problems with a sign-changing nonlinear term" docx
... main results The proof of the main results will be stated in Section A class of examples are given to show that our main result is applicable to many problems in Section Preliminaries and lemmas ... problem at resonance Nonlinear Anal 24(10), 1483–1489 (1995) [5] Gupta, CP, Ntouyas, SK, Tsamatos, P: On an m-point boundary value problem for second-order ordinary differential equations Nonlinear Anal ... Acknowledgments The author is very grateful to Editor of the Journal and the anonymous referees for their carefully reading of the first draft of the manuscript and making many valuable suggestions 22 and comments...
- 25
- 221
- 0
báo cáo hóa học:" Existence and multiplicity of positive solutions for a class of p(x)-Kirchho type equations" ppt
... of solutions for a class of problem involving a e nonlinear operator Comm Appl Nonlinear Anal 8, 43–56 (2001) 31 [26] Corr a, FJSA, Menezes, SDB, Ferreira, J: On a class of problems involving a ... a local minimizer of the associated energy functional in the C -topology is also a local minimizer in the H -topology Such lemma have been extended to the case of the p-Laplacian equations (see ... is said to be the p(x)-Laplacian, and becomes p-Laplacian when p(x) ≡ p (a constant) The p(x)-Laplacian possesses more complicated nonlinearities than the p-Laplacian; for example, it is inhomogeneous...
- 35
- 437
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25