site directed mutagenesis as a tool to characterize specificity in thiol based redox interaction
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... LDH was measured according to Crow and Pritchard [31] Final concentrations in assay was: 10 mm pyruvate, 0.2 mm NADH, mm fructose 1,6-bisphosphate All measured enzyme activities were related to ... close to (Clas % and Clas % 0) as can be inferred from the primary data However, it is interesting that a slight reduction in las activity resulted in a very strong decrease in growth rate and...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... 865 Table Specific activities of wild-type and mutant E1s in the various assays DCPIP assay Reductive acetylation assay % Wild-type E1aF26 6A E1aR26 7A E1aD27 6A E1aY28 1A E1aR28 2A E 1aS2 83C E1aY28 1A/ R28 2A/ S28 3A ... domain Mixtures of E1 and di-domain were submitted to nondenaturing PAGE using the Pharmacia Phast System The interaction of di-domain with E1 was also investigated using surface plasmon resonance ... catalytic activities in the reductive acetylation assay measured with the free lipoyl domain as substrate (Table 1) and that the PDH complex activity was measured with pyruvate at a concentration...
- 10
- 459
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... pond area in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has increased approximately 4 times, from 251 ha in 2000 to 902.5 ha in 2007. According ... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... The final step in evaluating the measures is to determine the weights for the alternatives. By referring to the standardized scores in Tables 5 and 7, and scoring card of combinations in ...
- 13
- 487
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem -based learning when teaching medical ... be studied and included in an Ishikawa diagram to remind clinicians of relevant information during their clinical reasoning processes For example, the Journal of Medical Case Reports has published ... published in the British Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information...
- 3
- 381
- 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
... require more information Calculating HGI should be feasible in ICUs that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses ... a measure of hyperglycaemia similar to what HbA1c is in diabetic outpatients • Admission glucose, mean glucose and morning glucose all have drawbacks as indicators of overall hyperglycaemia • ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...
- 6
- 264
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
... means among each other Note that in this approach part of the variation in the data set is attributed to a variation in factor effect within a session This is in contrast to the above ratio approach ... combination of session and condition Each condition was measured in different sessions In simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and ... likelihood approach assigns part of the variation to the estimated session factors The ratio approach can be seen as a special case, in which the user assumes that the multiplicative factor is the same...
- 8
- 304
- 0
báo cáo hóa học: " F-fluoride PET: changes in uptake as a method to assess response in bone metastases from castrate-resistant prostate cancer patients treated with 223Ra-chloride (Alpharadin)" pdf
... in clinical trials, to the extent that bone metastases are often regarded as a non-measurable disease [4] Criteria exist which use radiographic changes to measure response in bone metastases, ... performed as a pilot substudy of an open-label phase trial of Alpharadin in patients with bone metastases and castration-resistant prostate cancer Repeated 18F-fluoride PET imaging, PSA and ALP assessments ... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured...
- 6
- 286
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... obtained from animals cannot always be extrapolated to humans Bjelle [36] has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in loadbearing ... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149 ... OH, USA) and homogenised using a T8 Ultra-Turrax homogeniser (IKA Works, Inc.) and, finally, the RNA was extracted according to Tri Reagent manufacturer instructions Total RNA was quantified at...
- 11
- 520
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
... number of small microchromosomes, visualized as dots on metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which ... them as ancestral chromosomes although they are very rare in fish and batracians Indeed, they could have been inherited from a common ancestor of the vertebrates, as they can be encountered in ... Myakoshina Y.U., Chelysheva L .A. , Solovei LV., Gaginskaya E.P., Chiasmata on lampbrush chromosomes of Gallus gallus domesticus Cytogenetic investigations of recombination frequency and linkage group...
- 11
- 318
- 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
... analysis Infiltrative cancer was represented on all samples analyzed as verified by histological analysis Response was evaluated by cell counting in paraffin embedded and hematoxilin-eosin stained ... Acta Veterinaria Scandinavica 2008, 50:27 Introduction Human and canine malignant mammary tumors share some epidemiological and clinicopathological features Incidence in both species increases ... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT...
- 9
- 337
- 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... /4e, and between any residue at position 451 and an equatorial 4-OH was called g4e Interactions involving these same residues and an axial 4-OH were named / 4a and g 4a, respectively Likewise, interactions ... hydroxyls and were designated and 6, where ÔeÕ stands for an equatorial hydroxyl and a for an axial one Therefore, the interaction between any residue at position 39 and an equatorial 4-OH was called ... mutation at position E451, the primer sequence was 5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢, with GAC, CAA and TCA as mutated codons for E451D, E451Q and E451S, respectively DNA sequencing...
- 9
- 371
- 0
Báo cáo khoa học: Probing the unfolding region of ribonuclease A by site-directed mutagenesis potx
... 6-FAM-dArU(dA)2-6-TAMRA as substrate [23], revealed that all RNase A variants are active (Table 3) However, while the RNase A variants with mutations in the Ala20 loop region as well as N34DRNase A and L3 5A- RNase ... CGG AAT GCC ACC AAA GAT CGA TGC AAG C-3Â rev 5Â-G CTT GCA TCG ATC TTT GGT GGC ATT CCG GCT CTT CAT CAT C-3Â fw 5Â-G ATG ATG AAG AGC CGG AAT TCC ACC AAA GAT CGA TGC AAG C-3Â rev 5Â-G CTT GCA TCG ATC ... Germany) with BSA as calibration standard according to the instructions of the manufacturer The absorbance of the samples was measured at 560 nm after incubation at 37 C for 30 using a micro plate...
- 10
- 491
- 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... RgDAAO-Y238 mutants were Activity assay and gel electrophoresis DAAO activity was assayed with an oxygen electrode at pH 8.5 and 25 C with 28 mM D-alanine as substrate at air oxygen saturation ... range at 25 C Following absorbance at 455 nm, an initially rapid decrease in the oxidized avin absorption was observed, followed by a steady-state phase, and then by a further decrease to reach ... substrate-binding pocket remains intact, as all mutants bind the same ligands as the wild-type (Table 2) The steady state parameters determined with various D-amino acids at a xed O2 concentration...
- 10
- 496
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G ... Molecular mass determination PNAE was found to migrate on SDS/PAGE with a mobility corresponding to an apparent molecular mass of 30 000 Da [6] After gel filtration of the recombinant and the native...
- 8
- 345
- 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt
... functional capacity in MS patients with paresis The gravity-supporting Armeo Spring was employed as a training tool assisting participants to additionally and independently practice task-oriented ... card playing) The mechanical-assisted training was given supplementary on customary care comprising physical and/or occupational therapy aimed at the maintenance of general functional status (e.g ... signed-rank test was implemented to appraise changes in outcome measures after 24 training sessions and at 2-month follow-up relative to baseline All analyses were done using Statistica (Statsoft Inc.,...
- 8
- 678
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... difficult to prove The case against swine in transmitting the avian influenza is not proven either One, how does an intestinal virus change to that of a respiratory airborne-virus that is adapted to ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature ... which in turn infects mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and...
- 4
- 520
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... showed that flavor concentration rated as being most pleasant by the elderly in a laboratory setting failed to predict pleasantness and food intake in realistic settings Wysocki and Pelchat (1993)...
- 10
- 599
- 1
Using eliciting question as a technique to teach english to 11th form pupils
... questions are formed in exactly the same way as Yes/No questions, but contain two final elements and differ in intonation; instead of the final rising tone, they contain a separate nucleus for each alternative: ... Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar Is there a story behind that magnificent trophy? asked the tourist ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher...
- 42
- 641
- 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active -site- directed pharmacologic chaperone for a lysosomal storage disease Galactose ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med...
- 7
- 507
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25