sim a novel technique for assessment of local topological properties of porous and irregular structures
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... relational database (MySQL), and standard SQL statements and graphing utilities were used to interrogate the data Statistical tests were performed using the R software environment for statistical ... LW, AR, BZ, and EBW analyzed and interpreted the data JCS and EBW wrote the manuscript All authors have read and approved the final manuscript Competing interests JCS is Founder and President of...
- 15
- 476
- 0
Báo cáo hóa học: " A Novel Route for Preparation of Hollow Carbon Nanospheres Without Introducing Template" ppt
... realize polymerization and carbonization of alginate according to the theory of the rate of chemical reaction The filling ratio as an important parameter of hydrothermal systems has a critical ... may be explained why carbonization of alginate needed higher temperature than for carbonization of glucose Then nucleation of alginate took place when critical supersaturation of alginate was ... Fig 1a The broad peak indicates that the amorphism of product is because of poor crystallization As a kind of usual fashion, Raman spectroscopy is a powerful technique for characterizing the carbon...
- 6
- 349
- 0
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
... augment the detection process We are not alone in this vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches ... 17(5):323-329 Ito M, Nakamura F, Baba A, Tamada K, Ushijima H, Lau KHA, Manna A, Knoll W: Enhancement of surface plasmon resonance signals by gold nanoparticles on high-density DNA microarrays J Phys Chem ... 116 Hanania NA: Targeting airway inflammation in asthma: current and future therapies Chest 2008, 133(4):989-998 117 Anderson NL, Anderson NG: The human plasma proteome: history, character, and...
- 17
- 377
- 0
Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc
... creatinine [CR] and urea [UR]) or liver dysfunction (alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma-glutamyl transpeptidase [GGT], total and conjugated bilirubin, alkaline ... the total amount of available data Variable selection for the MLR model In the MLR model also, the variable selection was performed with a forward, a backward, and a stepwise algorithm for simple ... study by Willis and colleagues [42], using a population pharmacokinetic model based on Bayesian forecasting and adapted for individual pharmacokinetic, demographic, and covariate data, resulted in...
- 7
- 318
- 0
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes
... the case of a bill payable at the address of a 74 third party or in a locality other than that of the domicile of the drawee, or, except in the case of a bill drawn payable at a fixed period after ... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... 67 and 68); 309 Alterations (Article 69); 310 Limitation of actions (Articles 70 and 71); 311 Holidays, computation of limits of time and prohibition 312 of days of grace (Articles 72, 73 and...
- 37
- 673
- 0
Báo cáo y học: "Novel therapies for treatment of gout and hyperuricemia" pot
... Rheumatol 2004, 31:1575-1581 41 Sarawate CA, Brewer KK, Yang W, Patel PA, Schumacher HR, Saag KG, Bakst AW: Gout medication treatment patterns and adherence to standards of care from a managed care ... Such a combination approach can normalize serum urate in a substantial fraction of patients on submaximal allopurinol [32] An approach of this nature, using certain drugs with wider availability ... months of therapy [38,55] In my opinion, the known association of atrial and ventricular arrythmias and quantifiable altered heart rate variability with systemic inflammation (putatively mediated...
- 11
- 418
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed ... Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... or GAPDH The success of the RNA extraction and reverse transcription is determined by quantification of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according...
- 4
- 319
- 0
báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt
... normative database and standard analysis Table 2: Quick reference simplified set of normative data for electric activity obtained by surface EMG for masseter and submental group + platisma during ... electrode locations cover all stages of a swallow The staging of normal deglutition can be clinically important as an additional tool for establishing aetiology and localization – oral, pharyngeal, or ... be a very timely addition to our evaluation techniques 16 Summary 17 Surface SEMG of swallowing is a simple and reliable method for screening and initial evaluation of dysphagia and odynophagia...
- 11
- 315
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 1 ppt
... (a) plasma based and (b) non plasma based LIGA The LIGA is a German term which means LIthographie (Lithography) Galvanoformung (Electroforming) Abforming (Molding) The exact English meaning of ... Mak and Hoi Wai Choi Chapter Laser Ablation for Polymer Waveguide Fabrication 109 Shefiu S Zakariyah Chapter Micro Eletro Discharge Milling for Microfabrication 131 Mohammad Yeakub Ali, Reyad ... advantage of being able to adapt to metallic and non-metallic surfaces alike, and also generate 3-D features and/ or free-form sculpted surfaces However, the challenges of achieving accuracy, precision...
- 20
- 548
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 3 doc
... substrate, and z0 is a parameter chosen to eliminate the surface singularity as t → Fig Geometry and intensity and temperature profiles for laser ablation Fundamentals of Laser Ablation of the Materials ... different materials and structures at a time For example, a laser can be used to cut a channel to one depth, cut a via to another depth, trim a metal trace, release a check valve structure, and weld ... vaporized material is often subsequently ionized 40 Micromachining Techniques for Fabrication of Micro and Nano Structures by the laser radiation, leading to a plasma and plume that can have the...
- 20
- 396
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 4 pot
... temperature or /and finite absorption materials such as sapphire and Pyrex The increase is less for narrow band gap or /and high absorption materials such as silicon Laser systems can micromachine materials ... and plays a predominant role in the materials selection 54 Micromachining Techniques for Fabrication of Micro and Nano Structures Fig 13 A laser-cut plastic laminate microfluidic cartridge for ... physical properties of sapphire, silicon, and Pyrex (Chen & Darling, 2005, 2008) Fundamentals of Laser Ablation of the Materials Used in Microfluiducs 55 In general, the laser ablation rates of sapphire,...
- 20
- 364
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 6 docx
... the adiabatic expansion of water vapour as well as the vapour plume of ablated material (Gusarov, et al 2000) At this instance, the GaN surface temperature in water is in general lower than that ... certain area of GaN, the GaN layer can be separated into multiple electrically isolated small-area LEDs These LEDs can be connected together by metal interconnects at a later stage, allowing a variety ... GaN 0.25 (Akane, et al 199 9a; Liu, et al 2002) 100000 – 150000 (Muth, et al 1997) Sapphire 4.5 (Li, et al 2004) 0.01 – (Patel and Zaidi 1999) Table Parameters of GaN and sapphire that facilitate...
- 20
- 492
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 7 docx
... overview of laser technology for material processing and in particular for polymer waveguide fabrication Acknowledgment The authors wish to thank Khadijah Olaniyan, Abdul Lateef Balogun, Mayowa Kassim ... Micromachining Techniques for Fabrication of Micro and Nano Structures mirrors It is argued [Zakariyah, 2010] that laser ablation is a more suitable fabrication technique as it allows for both the waveguide ... and a single pass showing (a) a schematic diagram, and (b) an SEM image of an initial trial 3.4 Integrated mirror fabrication Optical signals on PCBs need to be routed to different parts of a...
- 20
- 431
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 9 docx
... consisting of a hard material and a binder phase with very different mechanical properties For manufacturing and stability reasons, micro end mills made of monocrystalline diamond are no less than 50 ... cohesion forces of the machined material The material removal rate is higher than for grinding and most of the heat is transferred to and removed with the chips A good approximation for the removal of ... the feed rate, capacitance and voltage are 4.79 µm/s, 0.10 nF and 80.00 volts respectively The achieved Ra and Ry values are in the acceptable range for many MEMS applications The result of multiple...
- 20
- 512
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 10 docx
... a high material removal rate With some limitations on ceramic materials, all kinds of materials like metals, polymers and ceramics can be machined However, the kind of material machined has a ... stainless steel (1.4301, Fig 24) and MACOR (Fig 25), a machinable ceramic consisting of about 45 % borosilicate glass and 55 % mica acting as micro crack propagators [Mac] While MACOR and aluminum ... micromachining is a very flexible and cost efficient technique, not only for large scale series but also for prototyping and applicable for a wide range of materials Due to mechanical and material scientific...
- 20
- 409
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 11 pot
... system along with a closeup of a nozzle and representative AWJ-cut parts made of various materials The advantages and disadvantages of AWJs in comparison with lasers, EDM, plasma, flame cutting, and ... could have a large market potential in many industrial applications Advances in personal computers and peripherals, pumping technology, and materials sciences have greatly benefited the advancement ... sacrificial pieces where they are needed Most commercial AWJ systems machine 2D and 2D+ parts, although there are commercial 5+-axis AWJ systems available for machining simple 3D parts Alternatively,...
- 20
- 298
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 12 docx
... two-phase ASJs have a finer stream diameter, higher abrasive mass flow rate, and faster abrasive speed than AWJs As a result, the cutting power of ASJs is potentially up to times greater than that ... technological and manufacturing merits of waterjet technology One of the advanced software packages used for AWJ machining is the PC-based CAD/CAM.15 It was particularly designed with “ease of use” ... effectiveness) of waterjet technology An R&D program was initiated to revisit the fatigue performance of AWJ-machined aircraft aluminum and titanium parts for fatigue-critical applications by incorporating...
- 20
- 545
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 13 potx
... miniature samples made of various materials for a broad range of applications Many of the samples with basic features as small as 100 µm were machined to demonstrate the versatility of waterjet ... intense heating and hence material removal takes place Atoms of the parent material get dislodged and material removal takes place There are partial sparks occurring, theses may not be having enough ... Micromachining Techniques for Fabrication of Micro and Nano Structures Results and discussions Measurements of on line average current, and post measurements of width and depth of microchannels are...
- 20
- 524
- 0
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 14 ppt
... Electrochemical Spark, Proc Of the 2nd International and 23rd AIMTDR Conf Shanmugam and Ramesh Babu, Eds, pp 653-658 Kulkarni, A V Sharan and G.K Lal, (2002) An Experimental Study of Discharge Mechanism ... acknowledged (Grant no SR/S3/MERC-079/2004) Thanks are due to the staff at Manufacturing Science Lab and Centre for Mechatronics, at IIT, Kanpur Ms Shivani Saxena and Mr Ankur Bajpai, Research Associates ... of a Novel Technique to Measure Depth of Micro-channels: A Practical Approach for Surface Metrology, Proc of the ICAME 2010, R Venkat Rao, Ed, pp 1008-1012 Kulkarni A V., Jain V K., and Misra...
- 20
- 533
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25