... 5¢-GATCCCCGCGGAA ACTTGGAATCAATTTCAAGAGAATTGATTCCAAGT TTCCGCTTTTTA-3¢ and reverse, 5¢-AGCTTAAAAA GCGGAAACTTGGAATCAATTC TCTTGAAATTGAT TCCAAGTTTCCGCGGG-3¢ MTT assay for cell proliferation The effect of ... TPD52 induces cell death in LNCaP cells Cells were transfected with speci c shRNA or control using LipofectamineÔ 2000 and cell death was measured by PI staining using fluorescence activated cell ... (underlined) for the restriction enzyme XhoI The antisense primer (5¢-CACTTGGTACCCAGGCTCTCCTGTGTCTT TTC-3¢) contains a site for KpnI (underlined) Insertion of the XhoI ⁄ KpnI digested PCR product into...
... Potentials in the Cochlea Abstract 57 Introduction 57 Electrical Potentials in the Cochlea 57 3.1 Cochlear Microphonics 58 3.2 Summating Potential 59 3.3 Action Potential 59 3.4 Electrocochleographic ... Frequency Tuning in Nuclei of the Ascending Auditory Pathways 102 3.5 Tonotopic Organization in the Nuclei of the Ascending Auditory Pathways 104 3.6 Extraction of Information from Place Coding of ... important roles in reducing the risk of noise induced hearing loss The basis for that is discussed in several chapters in the book The practical and legal aspects of hearing conservation are covered in...
... hearing and no history of Chapter Sound Conduction to the Cochlea BOX 2.7 BASIC CONCEPTS OF IMPEDANCE Mechanical and acoustic systems are often described by their electrical analogue circuits because ... capacitor in an electrical circuit and the acoustic impedance of a narrow passage such as that of a narrow tube corresponds to an inductance in an electrical circuit The acoustic impedance is thus the ... muscles in studies of the acoustic middle-ear reflex for oto-neurologic diagnosis Electrical circuits and mechanical systems are analogous in many ways Thus in an electrical circuit, electrical...
... are indications that the non-classical ascending pathways are dormant in adults but active in FIGURE 5.11 Schematic drawing of the connections from the ICC to the ICX and the DC, and connections ... FIGURE 5.14 Schematic drawings of the two descending systems in the cat (A) Cortico-thalamic system (B) Cortico-cochlear and olivocochlear systems: P =principle area of the auditory cortex; LGB ... in humans but estimates of the cochlear tuning in humans can be obtained by recording of the ECoG potentials from the ear in connection with masking (two tone masking [32]) Obtaining psychoacoustic...
... recording from the round window of the cochlea and from the intracranial portion of the auditory nerve in a cat using a concentric electrode The stimulation was clicks M is the cochlear microphonic ... be close to the cochlea and the cochlear nucleus and potentials that originate in the cochlea and the cochlear nucleus are conducted to the recording site by passive conduction in the eighth cranial ... time Clicks can be either condensation clicks or rarefaction clicks Condensation clicks move the tympanic membrane (initially) inward while rarefaction clicks cause movement of the tympanic membrane...
... frequency modulated sounds in the cochlear nucleus of the rat Acta Physiol Scand 86: 223–238, 1972 172 Møller AR Coding of increments and decrements in stimuli intensity in single units in the cochlear ... of normal aging causing decline in hearing sensitivity (presbycusis) are thus caused by a combination of deficits in the auditory periphery (cochlea) and the effect of changes in the central auditory ... EFFECT OF A HOLE IN THE TYMPANIC MEMBRANE Acoustically, a small hole in the tympanic membrane acts in the same way as an electrical inductance in an electrical circuit and the middle-ear cavity...
... ototoxic substances mainly affect outer hair cells, carboplatin causes injury mainly to inner hair cells in one animal species, the chinchilla, leaving outer hair cells intact In the guinea pig, carboplatin ... decrease of excitability of neurons, change in processing of information, or re-routing of information Expression of neural plasticity can cause change of synaptic efficacy, formation or elimination ... perilymphatic space can be regulated locally in the cochlea, at least in individuals in whom the cochlear aqueduct is patent The roleof the endolymphatic sac in pressure regulationin the inner ear is incompletely...
... important rolein the success of cochlear and cochlear nucleus implants Training is a powerful method for activating neural plasticity and training is a part of all cochlear and cochlear nucleus ... implants cannot replicate the spectral analysis that occurs in the cochlea and not include temporal coding of sounds The fact that cochlear implants that use the vocoder principle are successful in ... in the cochlear nucleus The changes in cochlear nucleus cells were most prominent when the destruction of the cochlea was done in the developing animal Protein synthesis in neurons of the cochlear...
... The peptide fraction was collected, evaporated and counted in a Capintec radioisotope calibrator (Capintec, Inc., NJ, USA) to calculate the specific activity of the product Since 64Cu-labeled NOTA-dimer ... recherché en santé du Québec (FRSQ) The work was financially supported by the Natural Sciences and Engineering Research Council of Canada (NSERC), the Canadian Institute of Health Research (CIHR, ... growth of human prostatic cancer cells in vitro Cancer 1989, 63:1714-1720 14 Festuccia C, Angelucci A, Gravina G, Eleuterio E, Vicentini C, Bologna M: Bombesindependent pro-MMP-9 activation in prostatic...
... rate-controlling factor in Ak4 leukemia An excess of FA clearly accelerated the leukemic process, causing the animals to die before untreated controls Acceleration of CML by vitamin B12 in patients ... units of Intrinsi B12/folate (Metagenics, San Clemente, CA, USA Each dose unit contained 20 mg of porcine intrinsic factor and 500 μg of vitamin B12, as well as 400 μg of FA, and 400 μg of L-5-methyltetrahydrofolate ... [13] involving vitamin B 12 and reduced folates included the folate and vitamin B12 dependence of the conversion of homocysteine to methionine minimizing toxic homocysteine while generating the...
... phosphorylation of choline to form phosphocholine, catalyzed by choline kinase; transfer of CMP from CTP to phosphocholine to form CDP-choline, catalyzed by CTPphosphocholine cytidylyltransferase (CCT); ... Figure Amino acid alignment of choline kinase isoforms Alignment of human choline kinase isoforms (hCKα2, α1, β2), C elegans choline kinase isoform alpha-2 (cCKA2), mouse choline kinase isoform ... inhibits choline uptake /phosphorylation in cancer cells Decreased choline phosphorylation resulted in transient uptake of choline radiotracers in cultured cancer cells and 9L tumors suggesting...
... insufficient dilution or removal of infectious droplet nuclei Air circulation Recirculation of air containing infectious droplet nuclei Specimen handling Improper specimen handling procedures ... insufficient dilution or removal of infectious droplet nuclei C Recirculation of air containing infectious droplet nuclei D Improper specimen handling procedures that generate infectious droplet nuclei ... rifampin, plus any fluoroquinolone and at least one of three injectable second-line drugs (i.e., amikacin, kanamycin, or capreomycin) Because XDR TB is resistant to first-line and second-line drugs,...
... SREBP- 1c is involved in hepatosteatosis and pancreatic b-cell dysfunction [25,26] Insulin resistance in liver and impaired insulin secretion in b-cells Molecular dissection of the underlying mechanisms ... SREBP- 1c could contribute to diabetes include exocytosis of insulin-containing granules by uncoupling protein-2 through ATP consumption, and granuphilin through inhibition of the vesicle fusion machinery ... acids activate, and PUFAs suppress, SREBP 1c, leading to and protecting from hepatic insulin resistance and pancreatic b-cell insulin secretion, respectively [39] FA, fatty acid In 3T3L1 adipocytes,...
... Describe the layers of skin and the characteristics of each layer Explain the factors that affect skin color List the accessory organs of skin and describe their structures and functions Describe ... antibodies chromosomes, which are threadlike structures made up of DNA Nucleic Acids DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are two examples of nucleic acids DNA contains the genetic information ... skin and the characteristics of each layer Explain the factors that affect skin color List the accessory organs of skin and describe their structures and functions Describe the appearance, causes,...
... all of those animals that are conscious of sacrifices; that is, if an animal is conscious of sacrifice he is capable of being conscious of this compensation which we term, love of offspring For ... to consider the character and extent of the compensation which these organisms, which are unconscious of sacrifice, receive The conscious sacrifice of higher animals receives a conscious compensation; ... low in the scale of life to be conscious of either sacrifice or love of offspring, nature seems to have arranged another scale of sacrifices and compensations—sacrifice taking the form of contention...
... main categories: small-cell lung cancers (SCLC), which account for about 20% of cases, and non-small-cell lung cancers (NSCLC), which account for the other 80% Non-small-cell lung cancers include ... squamous cell carcinomas (35% of all lung cancers), adenocarcinomas (27%) and large cell carcinomas (10%) NICE Guideline – lung cancer Patient-centred care This guideline offers best practice advice ... cancer is the most common cause of cancer death for men, who account for 60% of lung cancer cases In women, lung cancer is the second most common cause of cancer death after breast cancer Survival...
... pubic portion of the innominata d, The arch of the pubes; e, The junction of the sacrum and lower lumbar vertebra 94 The COCCYX, in infants, consists of several pieces, which, in youth, become ... articular 46surfaces of the bones a thin incrustation, not more than the sixteenth of an inch in thickness Upon convex surfaces it is the thickest in the centre, and thin toward the circumference; ... individual Closely associated with this is the power of life, or vitality, which is the most distinguishing characteristic of organic structure; since we find nothing similar to this in the inorganic...
... cancer in women The incidence of breast cancer in women in high-income countries in 2000 was at least twice that of any other cancer, similar to the incidence of cancer of the cervix in low-income ... situ 20% Invasive carcinoma 70%–85% Ductal carcinoma (no special type) 79% Lobular carcinoma 10% Tubular/cribriform carcinoma 6% Mucinous carcinoma 2% Medullary carcinoma 2% Papillary carcinoma ... Breast cancer stages Stage Type 5-year survival rate Ductal carcinoma in situ or lobular carcinoma in situ 92% I Invasive carcinoma cm or less in size (including carcinoma in situ with micro invasion)...
... t test in the case of continuous variables and the chi-square test of association in the case of categorical variables Between group differences in baseline to 12-month changes in clinical and ... hope of decreasing the risk of recurrence A limitation of the current study is that it cannot provide definitive conclusions concerning the effect of our intervention on disease specific survival ... statistically significant, the magnitude of these changes was relatively modest However, the direction of change may be clinically significant since an increase in PSA predicts clinical progression,...