Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx

Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells Ramesh Ummanni1, Steffen Teller1, Heike Junker1, Uwe Zimmermann2, Simone Venz1, Christian Scharf3, Jurgen Giebel4 and Reinhard Walther1 ă Department Department Department Department of of of of Medical Biochemistry and Molecular Biology, University of Greifswald, Germany Urology, University of Greifswald, Germany Otorhinolaryngology, Head and Neck Surgery, University of Greifswald, Germany Anatomy and Cell Biology, University of Greifswald, Germany Keywords apoptosis; cell migration; cell proliferation; prostate carcinoma; TPD52 Correspondence R Walther, Department of Medical Biochemistry and Molecular Biology, University of Greifswald, F.-Sauerbruchstraße, D-17487 Greifswald, Germany Fax: +49 3834 865402 Tel: +49 3834 865400 E-mail: rwalther@uni-greifswald.de (Received 13 August 2008, revised 16 September 2008, accepted 22 September 2008) doi:10.1111/j.1742-4658.2008.06697.x Tumor protein D52 (TPD52) is a protein found to be overexpressed in prostate and breast cancer due to gene amplification However, its physiological function remains under investigation In the present study, we investigated the response of the LNCaP human prostate carcinoma cell line to deregulation of TPD52 expression Proteomic analysis of prostate biopsies showed TPD52 overexpression at the protein level, whereas its transcriptional upregulation was demonstrated by real-time PCR Transfection of LNCaP cells with a specific small hairpin RNA giving efficient knockdown of TPD52 resulted in significant cell death of the carcinoma LNCaP cells As demonstrated by activation of caspases (caspase-3 and -9), and by the loss of mitochondrial membrane potential, cell death occurs due to apoptosis The disruption of the mitochondrial membrane potential indicates that TPD52 acts upstream of the mitochondrial apoptotic reaction To study the effect of TPD52 expression on cell proliferation, LNCaP cells were either transfected with enhanced green fluorescence protein-TPD52 or a specific small hairpin RNA Enhanced green fluorescence protein-TPD52 overexpressing cells showed an increased proliferation rate, whereas TPD52-depleted cells showed the reverse effect Additionally, we demonstrate that exogenous expression of TPD52 promotes cell migration via avb3 integrin in prostate cancer cells through activation of the protein kinase B ⁄ Akt signaling pathway From these results, we conclude that TPD52 plays an important role in various molecular events, particularly in the morphological diversification and dissemination of prostate carcinoma cells, and may be a promising target with respect to developing new therapeutic strategies to treat prostate cancer Prostate carcinoma (PCA) is the most common cancer among men In 2002, an estimated 48 650 German men were diagnosed with this disease and 11 839 died from PCA (http://www.rki.de) Autopsy studies have revealed that approximately 30% of men over the age of 50 years have microscopic evidence of prostate cancer [1] In the sequence of molecular events playing an important role in prostate cancer progression, genetic alterations such as the gain or loss of chromosome at 8q21 comprise important aberrations leading Abbreviations 2DE, 2D gel electrophoresis; DHT, dihydroxytestosterone; DIOC6, dihexyloxacarbocyanine iodide; EGFP, enhanced green fluorescence protein; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; PCA, prostate carcinoma; PI, propidium iodide; PKB ⁄ Akt, protein kinase B; shRNA, small hairpin RNA; TPD52, tumor protein D52 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5703 Tumor protein D52 in prostate cancer R Ummanni et al Results A protein profiling study on prostate biopsies identified differentially expressed proteins in cancer containing several proteins that are known to be dysregulated in prostate cancer [22] Among them, we identified TPD52 as being overexpressed in PCA compared to benign prostate epithelium (Fig 1A) To determine whether TPD52 is also overexpressed at the transcriptional level, TPD52 mRNA was estimated by quantitative real-time PCR from RNA isolated from the same 5704 A TPD52 TPD52 BPH B PCA TPD52/RPLP0 10 7.5 2.5 C 10.0 P < 0.0229 TPD52/RPLP0 to prostate cancer [2,3] cDNA library analysis has revealed the differential expression of a gene that was further assigned as TPD52 and its locus has been mapped on chromosome 8q21 [4,5] Its encoding gene is also referred to as PrLZ and is a member of the tumor protein D52 (TPD52) gene ⁄ protein family and is designated a proto-oncogene [6] TPD52 is overexpressed in breast cancer [7,8] prostate cancer [9,10] as well as ovarian cancer [11] due to gene amplification The identification of TPD52 as a tumor associated antigen in breast cancer patients highlights its role as a gene amplification target [12] One study on TPD52 gene characterization reported that epithelial cells express TPD52 predominantly and that it may play a role in the development of the epithelial cell phenotype [13] Its expression is controlled by androgens in LNCaP cells [9] The major circulating androgen, testosterone, interacts with the androgen receptor to control cellular processes such as proliferation, apoptosis and other metabolic events in prostate cancer [14] Taken together, a combination of gene amplification and androgen stimulation may cause overexpression of TPD52 in prostate cancer TPD52 undergoes post-translational modification (e.g phosphorylation) and interacts with annexinVI and MAL2 in a calcium dependent manner [15–18] Murine TPD52 induces tumorigenesis and metastasis of NIH3T3 fibroblasts [19] Recent studies have demonstrated that the PrLZ gene is reactivated and its expression increases with cancer progression from primary to tumor metastasis [20] and that it activates the protein kinase B (PKB ⁄ Akt) pathway, which plays an important role in prostate cancer development and progression [21] Because the precise mechanism of the function of TPD52 in prostate cancer progression is still under investigation, the main objective of the present study was the functional characterization of TPD52 alterations in the androgen responsive prostate cancer cell line LNCaP The effect of TPD52 expression on different cellular events was examined to determine the role of TPD52 expression in prostate cancer 7.5 5.0 2.5 0.0 BPH (n = 8) PCA (n = 12) Fig TPD52 is overexpressed in prostate cancer (A) Enlarged region of SYPROÒ Ruby stained 2DE gel images indicating tumor protein D52 (TPD52) upregulation in PCA (right panel) and benign prostatic hyperplasia (BPH) (left panel) (B) Quantitative reverse transcription PCR of TPD52 transcripts shown from benign prostate tissue (white bars, n = 8) and localized prostate cancer (black bars, n = 12) (C) The ratio of PHB expression was normalized against RPLP0 expression and this is graphically presented by box plots with 95% confidence intervals (nonparametric two-tailed Mann– Whitney test performed at 95% confidence interval, P < 0.0229) biopsies used for proteomic analysis RPLP0 was used as a house keeping gene to normalize expression levels (Fig 1B) Real-time PCR data have shown a significant increase (Fig 1C, box plots) of the amount of TPD52 mRNA in PCA compared to benign prostatic hyperplasia, suggesting that upregulated protein expression in PCA is caused by an enhanced transcription rate To assess the physiological effects of TPD52 expression on prostate cancer progression, enhanced green fluorescence protein (EGFP)-TPD52 fusion protein producing constructs were generated and expression of the fusion protein in LNCaP cells was estimated by fluorescence microscopy (Fig 2A) and western blotting FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS R Ummanni et al A Tumor protein D52 in prostate cancer BM C TPD52 EGFP TPD52 RPLP0 24 h 48 h 72 h 96 h 120 h M oc kC EGFP E F 150 1.0 EGFP-TPD52 100 0.5 0.0 Rel expression of EGFP-TPD52 1.5 Rel TPD52 mRNA expression D GAPDH pEGFP-TPD52 + Mock C 12 h 24 h 36 h 48 h 72 h 96 h Time (h) + pSuper – + – pSuper-shRNA – – + + 50 Lane Lane Lane Fig Dysregulation of TPD52 expression in androgen dependant prostate cancer cells (LNCaP) (A) LNCaP cells transfected with either EGFP (left panel) or EGFP-TPD52 (right panel) fusion protein producing recombinant vector and, 24 h posttransfection, cells were observed under a microscope for expression of fusion protein (B) Confirmation of expression of EGFP-TPD52 by western blotting with anti-EGFP serum (C) Downregulation of TPD52 by shRNA For the kinetics of TPD52 knockdown, mRNA expression was assessed by semiquantitative RT-PCR and (D) quantitative real-time PCR after LNCaP cells were transfected with either specific shRNA producing or mock vector and incubated for the indicated times; the results are the mean ± SD of two experiments (E) Western blotting for EGFP-TPD52 knockdown EGFP-TPD52 positive LNCaP cells were transfected with shRNA or control vector and incubated for 24 h Total protein (30 lg) was separated by 12% SDS ⁄ PAGE and detected with anti-EGFP serum Lane 1, EGFP-TPD52 positive cells; lane 2, EGFP-TPD52 positive cells transfected with control; lane 3, EGFP-TPD52 positive cells transfected with specific shRNA Only a representative blot is shown here (F) Quantification of western blot signals showing 40% of downregulation; the results are the mean ± SD of three experiments (Fig 2B) using anti-EFGP serum On the other hand, co-transfection (1 : 10 ratio) of pSUPER.neo-gfp vector expressing small hairpin RNA (shRNA) designed to downregulate TPD52 and recombinant psiCHECKÔ-2-TPD52 vector followed by luciferase assays confirmed the specificity of shRNA against the TPD52 transcript (data not shown) Transfection of pSUPER.neo-gfp vector expressing shRNA in EGFPTPD52 positive cells confirmed the downregulation of TPD52 by up to 40% at the transcriptional level after 24 h (Fig 2C,D) A significant downregulation was observed at the protein level, as confirmed by western blotting (Fig 2E) with anti-EGFP serum and densitometric quantification Corresponding bands revealed a reduced expression of EGFP-TPD52 down to 40% of the control level (Fig 2F) No significant difference was observed between nontransfected and mock transfected cells Dysregulation of TPD52 affects the proliferation rate of LNCaP cells First, we studied whether overexpression or downregulation of TPD52 influences the proliferation rate of LNCaP cells To determine the effect of TPD52 expression on cell proliferation, 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assays were performed after overexpression or downregulation of TPD52 in LNCaP cells MTT assays showed a significantly increased proliferation of the PCA cell line LNCaP after transient overexpression of EGFPTPD52 (Fig 3A) The proliferation of these cells was 20% higher than the proliferation of EGFP-transfected control cells 48 h after transfection Dihydroxytestosterone (DHT) was used as a control in MTT assays On the other hand, downregulation of TPD52 leads to decreased cell proliferation, an effect that could be suppressed to a certain extent when growth medium was supplemented with mm DHT (Fig 3B) Silencing of TPD52 by shRNA leads to apoptosis in LNCaP cells Considering that proliferation and migration has been affected by overexpressed TPD52, we next studied whether downregulation of TPD52 by RNA interference leads to apoptosis through the activation of caspase cascade in LNCaP cells Cell death was analysed by flow cytometry Propidium iodide (PI) was applied to LNCaP cells depleted for TPD52 expression to measure cell death Based on the results of flow cytometry, we observed approximately 36% cell death in TPD52 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5705 Tumor protein D52 in prostate cancer MTT formazan formation (570 nm) A MTT formazan formation (570 nm) by TPD52 downregulation, we next examined caspase9 activation in TPD52 depleted LNCaP cells (Fig 4F) After shRNA mediated knockdown of TPD52 in LNCaP cells, caspase-9 is activated by 1.6-fold compared to control cells (P £ 0.0213) Additionally, we examined the effect of TPD52 depletion on mitochondrial membrane depolarization by determining mitochondrial transmembrane potential (Dwm) 48 h after TPD52 downregulation in LNCaP cells (Fig 4G) In 30% of the TPD52 knockdown cells, a significant decrease of Dwm (P £ 0.0013) could be observed, whereas nontransfected or mock transfected cells were less than 10% of the total cells, suggesting that the depolarization of the mitochondrial membrane leads to cytochrome c release, which in turn activates caspase-9 to initiate apoptosis The activation of caspases-3 and -9 taken together with the loss of mitochondrial membrane potential suggests that downregulation of TPD52 leads to activation of the intrinsic pathway to initiate apoptosis in LNCaP cells 0.75 * 0.50 * 0.25 0.00 pEGFP + pEGFP-TPD52 – + DHT B R Ummanni et al 0.5 – + + ** + – – – + – * 0.4 * 0.3 0.2 Influence of TPD52 overexpression on LNCaP cell migration 0.1 0.0 Mock + – + – shRNA(204) – + – + DHT + + – – Fig Influence of TPD52 overexpression on the proliferation of the PCA cell line LNCaP (A) Cell proliferation after overexpression of TPD52 and (B) cell proliferation after downregulation of TPD52 Viability of cells was measured in a colorimetric MTT assay by the detection of formazan formation The proliferation of control cells transfected with EGFP was set at 100% The results are the mean ± SD of four independent experiments; DHT was used as a control for the proliferation of LNCaP cells depleted LNCaP cells after 48 h of post-transfection of shRNA compared to mock transfected cells showing approximately 7% cell death (Fig 4A–D) To obtain further insight into the mechanisms by which TPD52 downregulation induces cell death, we determined the involvement of caspase activation and mitochondria membrane depolarization In many cell types, activation of procaspase-3 is a distinguishing feature of apoptotic cell death Thus, we first examined whether caspase-3 is activated after downregulation of TPD52 (Fig 4E) We observed a 3.5-fold activation of caspase-3 in TPD52 knockdown LNCaP cells compared to mock transfected cells (P £ 0.0008) To obtain further information on the apoptosis signaling triggered 5706 Furthermore, we analyzed whether overexpression of EGFP-TPD52 fusion protein affects LNCaP cell migration Haptotactic cell migration assays with vitronectin and collagen type I demonstrated that overexpression of EGFP-TPD52 stimulates specifically avb3-mediated LNCaP cell migration on vitronectin (P £ 0.0029; Fig 5A) but not integrin b1-mediated cell migration on collagen type I (Fig 5B) The observed effects could not be confirmed in EGFP-TPD52 expressing MCF-7 cells (data not shown) To investigate whether the activation of PKB ⁄ Akt pathway is involved, EGFP-TPD52 or EGFP expressing LNCaP cells were allowed to attach to vitronectin coated plates After intervals of and h, the amount of phosphorylated PKB ⁄ Akt (Ser473) was analyzed We observed a significantly increased phosphorylation of PKB ⁄ Akt in EGFP-TPD52 expressing cells compared to EGFP expressing cells after h of incubation on vitronectin (Fig 5C) To confirm the involvement of the Akt pathway in TPD52 induced cell migration towards vitronectin, a cell migration assay in the presence of inhibitor for PI3-kinase, which acts upstream of Akt phosphorylation, revealed no significant increase in migration (Fig 5D) Discussion Subsequent to the latest advances for early diagnosis and new therapeutics for efficient treatment options, FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS *** 100 101 102 PI 103 F ** Mock + shRNA(204) – Taxol – + – + – + – – – – 104 Events 128 100 101 102 PI 103 104 100 101 102 PI 104 103 G * 60 ** + Mock shRNA(204) – Taxol – – – + Events 128 Events 104 M1 103 36% cells M1 102 PI D Δψm loss (% of cells) E 101 26% cells M1 Relative caspase-9 activity 100 Relative caspase-3 activity 6.93% cells M1 C 128 B Events A Tumor protein D52 in prostate cancer 128 R Ummanni et al – + – + – + – – – ** 40 20 Mock + shRNA(204) – Taxol – – – + *** + – + – + – – – – – – + Fig Downregulation of TPD52 induces cell death in LNCaP cells Cells were transfected with specific shRNA or control using LipofectamineÔ 2000 and cell death was measured by PI staining using fluorescence activated cell sorting analysis at the indicated time points (A) Mock transfected cells (B) Cells transfected with specific shRNA after (C) 24 h and (D) 48 h (D) Overlay of (A) and (C) TPD52 downregulation activates caspase activity and increases the loss of mitochondrial membrane potential (E, F) Showing the relative caspase-3 and -9 activities, respectively, as the ratio of mock transfected cells to shRNA transfected cells after 48 h Taxol was used as a control for activation of caspases (G) Effect of TPD52 downregulation on mitochondrial membrane potential dissipation assessed by cytofluorimetric analysis of DIOC6; columns indicate the mean ± SD of three independent experiments performed in triplicate A ** B 150 TPD52 1000 % Age of control % Age of control 1250 750 500 250 EGFP 100 EGFP TPD52 50 Vitronectin D 4h 2h ** 1000 TPD52 Akt pAkt EGFP + – + – EGFP-TPD52 – + – % Age of control C Collagen-1 750 500 TPD52 + LY, 294,002 250 + EGFP Vitronectin Fig Overexpression of TPD52 stimulates cell migration LNCaP cells transiently transfected with EGFP-TPD52 or EGFP as a control were analysed by haptotactic cell migration toward vitronectin (A) and collagen type I (B) The data represent the results obtained from three independent experiments performed in triplicate and are given as the mean ± SD (C) Adhesion of EGFP-TPD52-LNCaP cells to vitronectin increases PKB ⁄ AKT (Ser473) phosphorylation EGFP or EGFP-TPD52 positive LNCaP cells starved in serum free medium for 24 h were harvested and seeded on vitronectin coated dishes at 37 °C for the indicated time intervals The total protein of harvested cells (20 lg per lane) was separated by 12% SDS ⁄ PAGE Phosphorylation of PKB ⁄ AKT was detected by polyclonal phospho-AKT (Ser473) antibodies and loading control PKB ⁄ AKT was detected by polyclonal AKT antibodies (D) The influence of TPD52 on LNCaP cell migration analysed in the presence of PI3 kinase inhibitor LY, 294,002 The results indicate that there is no significant increase in the migration of EGFP-TPD52 overexpressing cells in the presence of inhibitor FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5707 Tumor protein D52 in prostate cancer R Ummanni et al the mortality rate of prostate cancer has been decreased significantly In spite of all new treatment strategies to increase survival, PCA is the most common type of cancer found in men in Western countries and is the leading cancer death, next to lung and colorectal cancer In the present study, we demonstrate the physiological consequences of TPD52 expression in the androgen responsive prostate cancer cell line LNCaP It is an oncogene overexpressed in prostate, breast and ovarian cancer, as demonstrated by DNA microarray analysis and high density tissue microarrays Its overexpression due to gene amplification was confirmed by array comparative genomic hybridization, single nucleotide polymorphism arrays and fluoresecemce in situ hybridization analysis to measure gene copy number on clinically localized prostate cancer specimens [4,9,10,23] Expression of recombinant TPD52 in acini of rat pancreas stimulates amylase secretion [24] As reported previously, the results from our proteomic analysis aiming to define the protein signature of prostate cancer biopsies revealed the overexpression of TPD52 in cancer patient material [22] To date, the main physiological role of TPD52 in prostate cancer progression remains under investigation In a recent study, Wang et al [20] found that TPD52 expression increases with age and undergoes translocation during development from early to adult tissues The expression of TPD52 proteins is linked with cell proliferation in different cancer cell types This is highlighted by reports that the expression of TPD52 in neuroepithelial cells by retroviral transduction indicated its role in cell proliferation [5,25] The presence of androgen response elements in the promoter region of TPD52 gene indicates that the expression of TPD52 is controlled by androgens [14] Testosterone as the major circulating androgen can trigger an androgen receptor response, which in turn activates various genes for transcription in the nucleus [26] TPD52 expression at both the transcriptional and translational levels is positively regulated by estradiol in breast cancer cells [5] and androgens in prostate cancer cells [9,10,14,27] From the present study, we noted that dysregulation of TPD52 expression slightly altered the proliferation of LNCaP cells A common molecular strategy used by tumor cells to evade apoptosis is the upregulation of anti-apoptotic proteins or the downregulation of pro-apoptotic proteins Human D53L1, another member of the TPD52 family, interacts with apoptosis signal regulating kinase and promotes apoptosis [28] Gene silencing by antisense oligonucleotides or RNA interference technology comprise useful tools to validate candidate proteins [29,30] We found that TPD52 knockdown in 5708 LNCaP cells is accompanied by enhanced cell death This was further confirmed by apoptosis using different methods, such as measurement of caspase activity and loss of mitochondrial membrane potential In summary, it is suggested that TPD52 acts upstream of the mitochondria related apoptosis However, the exact mechanism by which TPD52 influences apoptosis needs to be investigated in detail It has been proposed that cancer arises due to several molecular events leading to transformation of normal to tumor cells, with further progression to metastasis, including cell migration into the surrounding tissue, survival and proliferation in the host tissue [31] The expression of several genes, such as CARD10 [32] and Vav3 [33], and integrins is important in determining the formation of metastatic cells [34,35] The expression of murine TPD52 in NIH3T3 cells induces the expression of several genes involved in the promotion of metastasis and the genes responsible for prevention of metastasis were downregulated [19] From our cell migration assays, we found that overexpression of TPD52 in LNCaP cells promotes cell migration towards vitronectin Integrins are transmembrane receptors composed of a and b subunits To date, 24 different integrins with different combinations of a and 18 b subunits are known [36] Integrins bind to different extracellular matrix proteins and control functions such as adhesion, migration, differentiation, proliferation, survival and motility [37] Usually, integrins avb3 and avb5 are involved in cell migration and attachment to the extracellular matrix proteins: vitronectin, fibronectin, fibrinogen, laminin, osteopontin, amongst others [38] Vitronectin can bind to avb5 and avb3 integrin receptors The expression of avb3 in LNCaP is controversial Zheng et al [39] noted that LNCaP cells did not express avb3 Witkowski et al [40] and Chatterjee et al [41] reported the expression of both avb3 integrins in LNCaP cells In addition to these reports, Putz et al [42] reported four prostate cancer cell lines that were derived from bone marrow expressing av and b3 integrin subunits The MCF-7 cells chosen lack avb3-integrin expression, making it possible to demonstrate that overexpression of TPD52 is involved in avb3-mediated cell attachment to vitronectin [43,44] Previously, it was been shown that avb3 mediated cell migration and adhesion of LNCaP cells to vitronectin activates the Akt ⁄ PI3 kinase pathway via phosphorylation of Akt at Ser473 [39] The results obtained in the present study show that TPD52 expression activates the Akt ⁄ PI3 kinase pathway This supports the idea of the activation of the avb3 signalling pathway in TPD52 induced cell migration In the avb3 signalling pathway, ligation of avb3 with multiple FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS R Ummanni et al ligands activates FAK, which interacts and activates PI3 kinase The PI3 kinase activates PKB ⁄ Akt by phosphorylation and activated PKB phosphorylates several substrates to control various biological processes, such as cell migration, adhesion, survival and proliferation [21] A very recent study reported that expression of PrLZ activates the PKB ⁄ Akt signalling pathway in prostate cancer cells [45] The C-terminal domain of the PrLZ gene product shares homology with TPD52 Therefore we speculate that TPD family proteins may activate Akt via activation of integrins Taken together, migration studies confirm the involvement of avb3 integrin in TPD52 mediated migration of LNCaP cells towards vitronectin Similar to breast cancer cells, prostate cancer cells metastasize to the bone, which consists of extracellular matrix proteins specific to avb3 [21,46] TPD52 involvement in avb3 mediated cell migration may play a role bone metastasis of prostate cancer patients In conclusion, it appears that TPD52 is involved in different molecular processes, such as the regulation of apoptosis and proliferation Its association with cell migration suggests a role in tumor dissemination Because the PKB ⁄ Akt pathway is the central pathway involved in prostate cancer progression, activation of PKB ⁄ Akt by its phosphorylation is a possible mechnism of cell survival and migration that is controlled by TPD52 Taken together, TPD52 may be a potential and valid target to improve therapeutic strategies for better treatment Experimental procedures Clinical samples collection Tissue samples and patient data were obtained after informed consent The study was approved by the local ethics committee of the University of Greifswald and carried out in accordance with the declaration of Helsinki Ultrasound guided biopsies were taken from each patient and biopsies were investigated histopathologically by two experienced pathologists Preparation of protein/RNA extracts Approximately 6–10 mg of prostate biopsies was homogenized in 0.5 mL of TrizolÒ reagent (Invitrogen, Karlsruhe, Germany) in a bead mill (Sartorius, Gottingen, Germany) ă Total protein and total RNA was isolated according to the protocols recommended by the supplier (Invitrogen) for TrizolÒ reagent Protein pellets were vacuum dried, resuspended directly in lysis buffer [8 m urea (Sigma-Aldrich, Munich, Germany); m thiourea (Sigma-Aldrich, Munich, Tumor protein D52 in prostate cancer Germany); 4% Chaps (Roth Chemicals, Karlsruhe, Germany); 40 mm Tris base (Roth Chemicals) containing 65 mm dithiothreitol (Roth Chemicals)] and stored at )80 °C until use The protein concentration of the extracts was determined by a modified Bradford assay [47] Total RNA was stored at )20 °C 2D gel electrophoresis (2DE), imaging, analysis and MS 2DE was performed as described previously by Ummanni et al [22] Briefly, to prepare samples for analytical 2DE, 150 lg of protein sample of each patient were made up to 450 lL with rehydration buffer [8 m urea, m thiourea, 2% Chaps, 50 mm dithiothreitol with 0.5% v ⁄ v IPG buffer, pH 4–7 (GE Healthcare, Uppsala, Sweden)] and used to passively rehydrate each IPG strip overnight For preparative 2DE, 650 lg of protein sample pooled from equal amount of protein isolated from PCA biopsies were used The analytical gels were stained with SYPROÒ Ruby protein gel stain (Bio-Rad, Munchen, Germany) Preparative ă gels were stained with colloidal coomassie brilliant blue stain (Roth Chemicals) SYPROÒ Ruby stained gel images were scanned at 100 lm resolution using a FS-700 molecular dynamics laser densitometer (Bio-Rad) and pdquest software, version 7.3.3 Basic (Bio-Rad) Image analysis was carried out with the pdquest 2D analysis software package, version 7.4 (Bio-Rad) and changes in expression level were restricted to being greater than 1.5-fold Protein identification was performed as described previously [22,48] Measurements of TPD52 gene transcripts by quantitative real-time PCR Quantitative real-time PCR for TPD52 expression was performed using the SYBR Green kit (Eppendorf, Hamburg, Germany) as described previously [22] Briefly, RNA was isolated from the same biopsies used for proteome analysis using TrizolÒ reagent (Invitrogen) according to the manufacturers’ protocol and RNA quality was assessed by 1.0% agarose formaldehyde gel electrophoresis cDNA was prepared by reverse transcription of lg of total RNA using oligo dT primer (15mer) and M-MLV reverse transcriptase (Promega Corp., Madison, WI, USA) Primer pairs were designed using the oligo direct programme (Invitrogen) and synthesized by Invitrogen The sequences for TPD52 and RPLP0 (house keeping gene) are: TPD52 sense: 5¢-GAGG AAGGAGAAGATGTTGC-3¢, TPD52 antisense: 5¢-GCC GAATTCAAGACTTCTCC-3¢, RPLP0 sense: 5¢-TTGTGT TCACCAAGGAGGAC-3¢, RPLP0 antisense: 5¢-GACTC TTCCTTGGCTTCAAC-3¢ Primer sets were used to generate a single amplicon of the desired size evaluated by agarose gel electrophoresis Quantitative real-time PCR was performed in the Master- FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5709 Tumor protein D52 in prostate cancer R Ummanni et al cyclerÒ ep realplex (Eppendorf) with optimized thermal cycles using the SYBR Green kit (Eppendorf) At the end of the PCR, samples were subjected to a melting analysis to confirm the specificity of the amplicon To obtain statistical significance, the data obtained were analysed by a nonparametric two-tailed Mann–Whitney U-test performed at 95% confidence interval Cell culture The PCA cell line LNCaP was purchased from DSMZ (Braunschweig, Germany) and maintained in RPMI1640 (Invitrogen) supplemented with 10% fetal bovine serum, 100 unitsỈmL)1 penicillin and streptomycin, glucose, sodium pyruvate, sodium bicarbonate and Hepes Cells were grown in an incubator at 37 °C with a constant supply of 5% CO2 and split after reaching 85–90% confluence Cells were regularly tested for mycoplasma contamination using the MycoAlertÔ Mycoplasma Detection Kit (Cambrex Bio Science Rockland, Inc., Rockland, ME, USA) Overexpression of EGFP-TPD52 fusion protein An EGFP-TPD52 fusion protein expressing recombinant vector was generated by cloning the coding region of the human TPD52 (Accession number NM 001001875) cDNA derived from LNCaP cells into the vector pEGFP-N3 (Clontech, Palo Alto, CA, USA) The cDNA was prepared by reverse transcription of lg of total RNA from LNCaP cells using oligo dT primer (15mer) and M-MLV reverse transcriptase (Promega Corp.) A specific primer pair was designed using oligo direct programme (Invitrogen) and synthesized by Invitrogen TPD52 cDNA was generated by PCR using Pwo DNA Polymerase (Peqlab, Erlangen, Germany) The sense primer (5¢-GCTACTCGAGCCATGGACCG CGGCGAGCAAGGT-3¢) contains a recognition site (underlined) for the restriction enzyme XhoI The antisense primer (5¢-CACTTGGTACCCAGGCTCTCCTGTGTCTT TTC-3¢) contains a site for KpnI (underlined) Insertion of the XhoI ⁄ KpnI digested PCR product into the XhoI ⁄ KpnI restriction sites of the vector resulted in a C-terminal fusion of TPD52 to EGFP The sequence of the cloned PCR fragment was confirmed by DNA sequencing (Seqlab, Gottingen, Germany) ă Downregulation of TPD52 To downregulate TPD52 in LNCaP cells, we designed different shRNA pairs directed against three splice variants of TPD52 using oligoengine programme and synthesized by Invitrogen shRNA oligos were annealed in annealing buffer by heating the mixture at 95 °C for followed by slowly cooling down to room temperature Annealed oligos were phosphorylated by T4 polynucleotide kinase in the presence of ATP and cloned into pSUPER.neo-gfp vector 5710 (Oligoengine RNA interference) between the BglII and HindIII restriction sites The shRNA expressing vectors were screened for their antisense activity using recombinant psiCHECKÔ2-TPD52 vector Co-transfection of two vectors into LNCaP cells and luciferase assay after 24 h revealed that the following sequence is more specific for antisense activity than the others: forward, 5¢-GATCCCCGCGGAA ACTTGGAATCAATTTCAAGAGAATTGATTCCAAGT TTCCGCTTTTTA-3¢ and reverse, 5¢-AGCTTAAAAA GCGGAAACTTGGAATCAATTC TCTTGAAATTGAT TCCAAGTTTCCGCGGG-3¢ MTT assay for cell proliferation The effect of TPD52 overexpression on proliferation of the PCA cell line LNCaP was measured by the MTT (SigmaAldrich, St Louis, MO, USA) proliferation assay In brief, · 104 cells were grown in 24 well plates at 37 °C ⁄ 5% CO2 for 20 h Cells were then transfected with EGFP- or EGFPTPD52 vector by the LipofectamineÔ 2000 method Twenty-four hours after transfection, MTT solution was added to the wells and cells were incubated for an additional h at 37 °C ⁄ 5% CO2 After solubilization buffer was added, formazan production was measured at 570 nm in a spectrophotometer (Novaspec II, Pharmacia, Uppsala, Sweden) Cell proliferation assays were performed with and without DHT (Sigma-Aldrich, Munich, Germany) Cell proliferation values are the mean of three independent experiments, each carried out with triplicate samples For calculation of significance, a t-test was performed using graph pad prism, version 3.0 (GraphPad Software Inc., San Diego, CA, USA) Cell migration assay To study the influence of TPD52 on cell migration, a hapototactic cell migration test was performed after overexpression of EGFP-TPD52 in LNCaP or MCF-7 cells Haptotactic cell migration assays were performed in Transwell chambers (#3422; Costar Inc., Cambridge, MA, USA) according to Zhang et al [45] Porous membranes were coated on the bottom surface with vitronectin (10 lgỈmL)1) or collagen type I (10 lgỈmL)1) for h at 37 °C LNCaP or MCF-7 cells were transfected with EGFP or EGFPTPD52 expressing vectors using LipofectamineÔ 2000 (Invitrogen) and grown at 37 °C ⁄ 5% CO2 for 24 h Transfected cells were then trypsinized and washed in the presence of soyabean trypsin inhibitor with migration buffer (RPMI 1640, mm CaCl2, mm MgCl2, 0.2 mm MnCl2, 0.5% BSA) Cells were resuspended in migration buffer with or with out PI3 kinase inhibitor LY, 294,002 (Alexis Biochemicals, San Diego, CA, USA) and · 105 cells were added onto the top of the membrane and allowed to move through it and bind vitronectin or collagen type I for h at 37 °C in migration buffer in the lower chamber After FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS R Ummanni et al removal of the remaining cells in the upper chamber, membranes were fixed in NaCl ⁄ Pi with 4% formaldehyde and cells were counted using an inverse fluorescence microscope (IX-70; Olympus, Tokyo, Japan) PI uptake for cell death Cell death was analysed with PI uptake Cells were harvested, washed with NaCl ⁄ Pi and fixed in ethanol at )20 °C After centrifugation, cells were resuspended in NaCl ⁄ Pi containing glucose, RNase and PI (50 lgỈmL)1), and incubated for 20 in the dark at room temperature After washing with NaCl ⁄ Pi buffer, PI uptake was analysed by fluorescence activated cell sorting (FACS CaliburÔ System; BD Bioscience, Erembodegem, Belgium) on an FL-2 fluorescence detector (20 000 events were recorded for each condition) Flow cytometry data were analysed using winmdi software (The Scripps Research Institute, La Jolla, CA, USA) Determination of caspase-3 and -9 activity Caspase-3 and -9 activities were measured 48 h after downregulation of TPD52 using fluorogenic substrates Ac-DEVD-AFC and LEHD-AFC, respectively Harvested cells were lysed with caspase lysis buffer (10 mm Tris–HCl, 10 mm sodium phosphate buffer, pH 7.5, 130 mm NaCl, 1% Triton X-100 and 10 mm Na2P2O7) and then incubated with the respective substrate (25 lgỈmL)1) in 20 mm Hepes (pH 7.5), 10% glycerol and mm dithiothreitol at 37 °C for h The release of AFC was analyzed by fluorimeter using an excitation ⁄ emission wavelength of 390 ⁄ 510 nm Relative caspase activities were calculated as the ratio of values between mock transfected and transfected cells Paclitaxel was used as a positive control Measurement of mitochondrial transmembrane potential Dwm Changes in the mitochondrial potential were detected with the potential-sensitive probe dihexyloxacarbocyanine iodide (DIOC6) uptake [49] Dwm was determined 48 h after downregulation of TPD52 TPD52 depleted cells were incubated with 50 nm DIOC6 (Molecular Probes, Carlsbad, CA, USA) at 37 °C for 30 After washing with NaCl ⁄ Pi, 20 000 cells were analysed by fluorescence activated cell sorting (FL-1 detector of FACS CaliburÔ System) The results were analysed by cellquest software (Becton Dickinson, Franklin Lakes, NJ, USA) Western blotting Cells were lysed in 2DE lysis buffer and the protein concentration was determined by modified Bradford assay Protein extracts were separated by 12% SDS ⁄ PAGE and electro- Tumor protein D52 in prostate cancer phoretically transferred onto nitrocellulose membrane Blocking was carried out in 1· Rotiblock solution (Roth Chemicals) followed by incubating the membrane with primary antibody [mouse anti-(human EGFP); : 2000 (Roche Chemicals); rabbit anti-(human GAPDH) (Roche Chemicals) : 2000 or rabbit anti-(human AKT) or Ser473 phospho AKT : 1000 (Cell Signalling Technology, Frankfurt, Germany)] overnight at °C Excess antibodies were removed by washing with NaCl–Tris–Tween 20 Incubation with secondary antibody conjugated to horseradish peroxidase [anti-(mouse IgG) or anti-(rabbit IgG), diluted : 5000 in 1· Rotiblock] was performed for h at room temperature After three washes, the reaction was developed by the addition of LumiGLO substrate (Cell Signalling Technology) The emitted light was captured on X-ray film Acknowledgements Ramesh Ummanni was supported by the AlfriedKrupp von Bohlen und Halbach Stiftung, Graduiertenkolleg Tumorbiologie We thank Chithra devi Palani for technical support concerning the caspase activity measurements References Scardino PT (1989) Early detection of prostate cancer Urol Clin North Am 16, 635–655 Macoska JA, Trybus TM, Sakr WA, Wolf MC, Benson PD, Powell IJ & Pontes JE (1994) Fluorescence in situ hybridization analysis of 8p allelic loss and chromosome instability in human prostate cancer Cancer Res 54, 3824–3830 Macoska JA, Trybus TM, Benson PD, Sakr WA, Grignon DJ, Wojno KD, Pietruk T & Powell IJ (1995) Evidence for three tumor suppressor gene loci on chromosome 8p in human prostate cancer Cancer Res 55, 5390–5395 Byrne JA, Tomasetto C, Garnier JM, Rouyer N, Mattei MG, Bellocq JP, Rio MC & Basset P (1995) A screening method to identify genes commonly overexpressed in carcinomas and the identification of a novel complementary DNA sequence Cancer Res 55, 2896–2903 Byrne JA, Mattei MG & Basset P (1996) Definition of the tumor protein D52 (TPD52) gene family through cloning of D52 homologues in human (hD53) and mouse (mD52) Genomics 35, 523–532 Rhodes DR, Barrette TR, Rubin MA, Ghosh D & Chinnaiyan AM (2002) Meta-analysis of microarrays: interstudy validation of gene expression profiles reveals pathway dysregulation in prostate cancer Cancer Res 62, 4427–4433 Balleine RL, Fejzo MS, Sathasivam P, Basset P, Clarke CL & Byrne JA (2000) The hD52 (TPD52) gene is a FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5711 Tumor protein D52 in prostate cancer 10 11 12 13 14 15 16 17 18 R Ummanni et al candidate target gene for events resulting in increased 8q21 copy number in human breast carcinoma Genes Chromosomes Cancer 29, 48–57 Pollack JR, Sorlie T, Perou CM, Rees CA, Jeffrey SS, Lonning PE, Tibshirani R, Botstein D, BorresenDale AL & Brown PO (2002) Microarray analysis reveals a major direct role of DNA copy number alteration in the transcriptional program of human breast tumors Proc Natl Acad Sci USA 99, 12963– 12968 Rubin MA, Varambally S, Beroukhim R, Tomlins SA, Rhodes DR, Paris PL, Hofer MD, Storz-Schweizer M, Kuefer R, Fletcher JA et al (2004) Overexpression, amplification, and androgen regulation of TPD52 in prostate cancer Cancer Res 64, 3814–3822 Wang R, Xu J, Saramaki O, Visakorpi T, Sutherland WM, Zhou J, Sen B, Lim SD, Mabjeesh N, Amin M et al (2004) PrLZ, a novel prostate-specific and androgen-responsive gene of the TPD52 family, amplified in chromosome 8q21.1 and overexpressed in human prostate cancer Cancer Res 64, 1589–1594 Byrne JA, Balleine RL, Schoenberg FM, Mercieca J, Chiew YE, Livnat Y, St HL, Peters GB, Byth K, Karlan BY et al (2005) Tumor protein D52 (TPD52) is overexpressed and a gene amplification target in ovarian cancer Int J Cancer 117, 1049–1054 Scanlan MJ & Jager D (2001) Challenges to the development of antigen-specific breast cancer vaccines Breast Cancer Res 3, 95–98 Chen SL, Zhang XK, Halverson DO, Byeon MK, Schweinfest CW, Ferris DK & Bhat NK (1997) Characterization of human N8 protein Oncogene 15, 2577– 2588 Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham M, White J, Hood L & Lin B (2002) The program of androgen-responsive genes in neoplastic prostate epithelium Proc Natl Acad Sci USA 99, 11890–11895 Kaspar KM, Thomas DD, Taft WB, Takeshita E, Weng N & Groblewski GE (2003) CaM kinase II regulation of CRHSP-28 phosphorylation in cultured mucosal T84 cells Am J Physiol Gastrointest Liver Physiol 285, G1300–G1309 Tiacci E, Orvietani PL, Bigerna B, Pucciarini A, Corthals GL, Pettirossi V, Martelli MP, Liso A, Benedetti R, Pacini R et al (2005) Tumor protein D52 (TPD52): a novel B-cell ⁄ plasma-cell molecule with unique expression pattern and Ca(2+)-dependent association with annexin VI Blood 105, 2812–2820 Wilson SH, Bailey AM, Nourse CR, Mattei MG & Byrne JA (2001) Identification of MAL2, a novel member of the mal proteolipid family, though interactions with TPD52-like proteins in the yeast two-hybrid system Genomics 76, 81–88 Parente JA, Goldenring JR, Petropoulos AC, Hellman U & Chew CS (1996) Purification, cloning, and expres- 5712 19 20 21 22 23 24 25 26 27 28 29 30 31 32 sion of a novel, endogenous, calcium-sensitive, 28-kDa phosphoprotein J Biol Chem 271, 20096–20101 Lewis JD, Payton LA, Whitford JG, Byrne JA, Smith DI, Yang L & Bright RK (2007) Induction of tumorigenesis and metastasis by the murine orthologue of tumor protein D52 Mol Cancer Res 5, 133–144 Wang R, Xu J, Mabjeesh N, Zhu G, Zhou J, Amin M, He D, Marshall FF, Zhau HE & Chung LW (2007) PrLZ is expressed in normal prostate development and in human prostate cancer progression Clin Cancer Res 13, 6040–6048 Hullinger TG, McCauley LK, DeJoode ML & Somerman MJ (1998) Effect of bone proteins on human prostate cancer cell lines in vitro Prostate 36, 14–22 Ummanni R, Junker H, Zimmermann U, Venz S, Teller S, Giebel J, Scharf C, Woenckhaus C, Dombrowski F & Walther R (2008) Prohibitin identified by proteomic analysis of prostate biopsies distinguishes hyperplasia and cancer Cancer Lett 266, 171–185 Chen SL, Maroulakou IG, Green JE, Romano-Spica V, Modi W, Lautenberger J & Bhat NK (1996) Isolation and characterization of a novel gene expressed in multiple cancers Oncogene 12, 741–751 Thomas DD, Taft WB, Kaspar KM & Groblewski GE (2001) CRHSP-28 regulates Ca(2+)-stimulated secretion in permeabilized acinar cells J Biol Chem 276, 28866–28872 Proux V, Provot S, Felder-Schmittbuhl MP, Laugier D, Calothy G & Marx M (1996) Characterization of a leucine zipper-containing protein identified by retroviral insertion in avian neuroretina cells J Biol Chem 271, 30790–30797 Ellis JA, Sinclair R & Harrap SB (2002) Androgenetic alopecia: pathogenesis and potential for therapy Expert Rev Mol Med 4, 1–11 DePrimo SE, Diehn M, Nelson JB, Reiter RE, Matese J, Fero M, Tibshirani R, Brown PO & Brooks JD (2002) Transcriptional programs activated by exposure of human prostate cancer cells to androgen Genome Biol 3, RESEARCH0032 Cho S, Ko HM, Kim JM, Lee JA, Park JE, Jang MS, Park SG, Lee DH, Ryu SE & Park BC (2004) Positive regulation of apoptosis signal-regulating kinase by hD53L1 J Biol Chem 279, 16050–16056 Dias N & Stein CA (2002) Antisense oligonucleotides: basic concepts and mechanisms Mol Cancer Ther 1, 347–355 Brummelkamp TR, Bernards R & Agami R (2002) A system for stable expression of short interfering RNAs in mammalian cells Science 296, 550–553 Hanahan D & Weinberg RA (2000) The hallmarks of cancer Cell 100, 57–70 Wang L, Guo Y, Huang WJ, Ke X, Poyet JL, Manji GA, Merriam S, Glucksmann MA, DiStefano PS, Alnemri ES et al (2001) Card10 is a novel caspase FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS R Ummanni et al 33 34 35 36 37 38 39 40 41 42 recruitment domain ⁄ membrane-associated guanylate kinase family member that interacts with BCL10 and activates NF-kappa B J Biol Chem 276, 21405–21409 Zeng L, Sachdev P, Yan L, Chan JL, Trenkle T, McClelland M, Welsh J & Wang LH (2000) Vav3 mediates receptor protein tyrosine kinase signaling, regulates GTPase activity, modulates cell morphology, and induces cell transformation Mol Cell Biol 20, 9212–9224 Alghisi GC & Ruegg C (2006) Vascular integrins in tumor angiogenesis: mediators and therapeutic targets Endothelium 13, 113–135 Janes SM & Watt FM (2006) New roles for integrins in squamous-cell carcinoma Nat Rev Cancer 6, 175–183 Plow EF, Haas TA, Zhang L, Loftus J & Smith JW (2000) Ligand binding to integrins J Biol Chem 275, 21785–21788 Giancotti FG & Ruoslahti E (1999) Integrin signaling Science 285, 1028–1032 Varner JA & Cheresh DA (1996) Tumor angiogenesis and the role of vascular cell integrin alphavbeta3 Important Adv Oncol 1996, 69–87 Zheng DQ, Woodard AS, Tallini G & Languino LR (2000) Substrate specificity of alpha(v)beta(3) integrinmediated cell migration and phosphatidylinositol 3-kinase ⁄ AKT pathway activation J Biol Chem 275, 24565–24574 Witkowski CM, Rabinovitz I, Nagle RB, Affinito KS & Cress AE (1993) Characterization of integrin subunits, cellular adhesion and tumorgenicity of four human prostate cell lines J Cancer Res Clin Oncol 119, 637– 644 Chatterjee S, Brite KH & Matsumura A (2001) Induction of apoptosis of integrin-expressing human prostate cancer cells by cyclic Arg-Gly-Asp peptides Clin Cancer Res 7, 3006–3011 Putz E, Witter K, Offner S, Stosiek P, Zippelius A, Johnson J, Zahn R, Riethmuller G & Pantel K (1999) Tumor protein D52 in prostate cancer 43 44 45 46 47 48 49 Phenotypic characteristics of cell lines derived from disseminated cancer cells in bone marrow of patients with solid epithelial tumors: establishment of working models for human micrometastases Cancer Res 59, 241–248 Brooks PC, Klemke RL, Schon S, Lewis JM, Schwartz MA & Cheresh DA (1997) Insulin-like growth factor receptor cooperates with integrin alpha v beta to promote tumor cell dissemination in vivo J Clin Invest 99, 1390–1398 Wong NC, Mueller BM, Barbas CF, Ruminski P, Quaranta V, Lin EC & Smith JW (1998) Alphav integrins mediate adhesion and migration of breast carcinoma cell lines Clin Exp Metastasis 16, 50–61 Zhang H, Wang J, Pang B, Liang RX, Li S, Huang PT, Wang R, Chung LW, Zhau HE, Huang C et al (2007) PC-1 ⁄ PrLZ contributes to malignant progression in prostate cancer Cancer Res 67, 8906–8913 Cooper CR, Bhatia JK, Muenchen HJ, McLean L, Hayasaka S, Taylor J, Poncza PJ & Pienta KJ (2002) The regulation of prostate cancer cell adhesion to human bone marrow endothelial cell monolayers by androgen dihydrotestosterone and cytokines Clin Exp Metastasis 19, 25–33 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam LT, Buttner K, Buurman G, Scharf C et al (2004) A comprehensive proteome map of growing Bacillus subtilis cells Proteomics 4, 2849– 2876 Metivier D, Dallaporta B, Zamzami N, Larochette N, Susin SA, Marzo I & Kroemer G (1998) Cytofluorometric detection of mitochondrial alterations in early CD95 ⁄ Fas ⁄ APO-1-triggered apoptosis of Jurkat T lymphoma cells Comparison of seven mitochondrion-specific fluorochromes Immunol Lett 61, 157–163 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5713 ... A Tumor protein D52 in prostate cancer BM C TPD52 EGFP TPD52 RPLP0 24 h 48 h 72 h 96 h 120 h M oc kC EGFP E F 150 1.0 EGFP-TPD52 100 0.5 0.0 Rel expression of EGFP-TPD52 1.5 Rel TPD52 mRNA expression. .. define the protein signature of prostate cancer biopsies revealed the overexpression of TPD52 in cancer patient material [22] To date, the main physiological role of TPD52 in prostate cancer progression... microscope for expression of fusion protein (B) Confirmation of expression of EGFP-TPD52 by western blotting with anti-EGFP serum (C) Downregulation of TPD52 by shRNA For the kinetics of TPD52 knockdown,