Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf

Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster ´ Herve Colinet1,2, Siu Fai Lee2 and Ary Hoffmann2 ´ ´ ´ ´ Unite d’Ecologie et de Biogeographie, Biodiversity Research Centre, Universite catholique de Louvain, Louvain-la-Neuve, Belgium Department of Genetics, Centre for Environmental Stress and Adaptation Research, Bio21 Institute, University of Melbourne, Parkville, Australia Keywords cold stress; Drosophila melanogaster; gene expression; Hsp; recovery Correspondence H Colinet, Bio21 Institute, University of Melbourne, 30 Flemington Road, Parkville, Victoria 3010, Australia Fax: +61 8344 2279 Tel: +61 8344 2520 E-mail: herve.colinet@uclouvain.be (Received September 2009, revised 28 October 2009, accepted 30 October 2009) doi:10.1111/j.1742-4658.2009.07470.x A common physiological response of organisms to environmental stresses is the increase in expression of heat shock proteins (Hsps) In insects, this process has been widely examined for heat stress, but the response to cold stress has been far less studied In the present study, we focused on 11 Drosophila melanogaster Hsp genes during the stress exposure and recovery phases The temporal gene expression of adults was analyzed during h of cold stress at °C and during h of recovery at 25 °C Increased expression of some, but not all, Hsp genes was elicited in response to cold stress The transcriptional activity of Hsp genes was not modulated during the cold stress, and peaks of expression occurred during the recovery phase On the basis of their response, we consider that Hsp60, Hsp67Ba and Hsc70-1 are not cold-inducible, whereas Hsp22, Hsp23, Hsp26, Hsp27, Hsp40, Hsp68, Hsp70Aa and Hsp83 are induced by cold This study suggests the importance of the recovery phase for repairing chilling injuries, and highlights the need to further investigate the contributions of specific Hsp genes to thermal stress responses Parallels are drawn between the stress response networks resulting from heat and cold stress Introduction Temperature plays a crucial role in determining the distribution and abundance of animals In insects and other ectotherms, temperature simultaneously affects physiological processes, biophysical structures, and metabolic activities, as well as developmental rates and growth [1] Many insect species are seasonally exposed to suboptimal or supraoptimal temperatures, and this has led to the evolution of protective biochemical and physiological mechanisms For example, heat shock proteins (Hsps) are considered to play crucial roles in environmental stress tolerance and in thermal adaptation [2–5] Hsp genes constitute a subset of a larger group of genes coding for molecular chaperones Their functions include transport, folding, unfolding, assembly ⁄ disassembly, and degradation of misfolded or aggregated proteins [2,5,6] Many Hsps are upregulated in response to a diverse array of stresses [2] In arthropods, they are induced by environmental stressors such as heat, heavy metals, ethanol, and desiccation [3,7,8] The possibility that cold stress could elicit heat stress responses has not been investigated in many biological systems [9] The molecular basis of adaptation to nonfreezing low temperatures has not received as much attention as the Abbreviations Cp, crossing point; Ct, cycle threshold; HSF, heat shock factor; Hsp, heat shock protein; qRT-PCR, quantitative RT-PCR; RA, recovery with agar; RF, recovery with food; RNAi, RNA interference; sHsp, small heat shock protein 174 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS H Colinet et al Heat shock response to cold stress high temperature extreme [10,11] The first report of a cold-induced heat shock response in insects was provided by Burton et al [12], who noticed the induction of a 70 kDa protein after a cold treatment However, the biochemical diversity of cold-induced heat shock responses remains poorly understood, because much of the early work [12–14] used one-dimensional gel electrophoresis, which fails to discriminate different Hsps within a family [15] Hsps are usually divided into different families on the basis of their sequence homology and their molecular masses The major families include Hsp100, Hsp90, Hsp70, Hsp60, Hsp40, and the small Hsps (sHsps) (sizes below 30 kDa) [2,3] The molecular mechanisms behind recovery from cold shock are complex, and it seems that more genes ⁄ proteins are activated during the recovery phases than during the actual period of the cold stress itself [16] It is thus essential to differentiate between the cold exposure and the subsequent recovery phase [16,17], and this aspect was investigated in studies using alternating temperatures [18–20] Although Hsps have been implicated in cold survival, there is little direct evidence in the literature to confirm this link [21] In insects, there has been a long-standing focus on Hsp70, which remains the most commonly studied stress protein in cold-related studies [11,16,21] Even if the level of Hsp70 expression is a good indicator of the whole inducible stress response, studying it alone gives an incomplete picture of the organism’s stress response [11] Hsp70 is known to interact with a network of other Hsps [22–24] Therefore, if Hsp70 displays mild modulation under a specific condition, it is possible that changes in the expression of other Hsp genes or Hsp proteins might occur and might be overlooked [11] In the present study, we investigated the temporal expression patterns of 11 Hsp genes in adult Drosophila melanogaster during both the cold stress exposure phase and the recovery phase Results and Discussion Adult flies were subjected to prolonged cold stress for up to h at °C, and then allowed to recover at 25 °C for up to h, with or without food (Fig 1) We investigated the temporal expression patterns of 11 Hsp genes during both the cold stress phase and the recovery phase, using quantitative RT-PCR (qRTPCR) At °C, adults fall directly into chill coma, because of the inability to maintain muscle resting potentials [25] In addition to this neuromuscular perturbation, chilling injuries accumulate at low temperatures as a result of various physiological dysfunctions, recently reviewed by Chown and Terblanche [26] Within certain limits, these physiological injuries are reversible As previously noted in D melanogaster [27], when the cold stress period is increased, the associated chilling injuries accumulate, and the time needed for recovery increases In our experiments, recovery times (Fig 2) followed periods of stress exposure, increasing significantly with time spent at °C (ANOVA; F = 239.2; degrees of freedom = 3,156; P < 0.0001) Recovery time is a highly variable physiological trait We observed that coefficients of variation ranged from 10% to 13% for stress duration of 0.25–6 h, and then increased to 28% for h of cold stress As often observed in animals, the phenotypic variability of a trait increases rather than decreases when the level of stress becomes more severe [7] There was no mortality even after h of cold stress, ensuring that expression changes were not confounded by mortality Recovered with food (RF) Stressed (S) 25 °C 0.25 h 3h 0.5 h 6h 2h 4h 8h 9h 25 °C °C 25 °C 0.5 h 2h 4h 8h Recovered with agar (RA) Corresponding controls 25 °C 0h 3h 6h 9h 11 h 13 h 17 h Fig Experimental protocol used to evaluate the cumulative effects of prolonged cold stress followed by a recovery period on expression of Hsp genes Treated flies were stressed (S) at °C for periods ranging from 0.25 to h, and allowed to recover at 25 °C with food (RF) or with only agar (RA) for periods ranging from 0.5 to h Samples for gene expression measurements were taken at several time points during the cold stress and the recovery treatments (see text for further details) Control flies were kept at 25 °C and were sampled at the same time points as the treated flies FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 175 Heat shock response to cold stress H Colinet et al Table Primer pairs used for qRT-PCR Gene Fig Increasing recovery time for flies exposed to increasing durations of cold stress Each circle represents the value of an individual fly Means are indicated ± standard errors (n = 40) We focused on 11 Hsp genes representing all major Hsp families Because chilling injury is a cumulative process, we verified whether Hsp transcripts, other than those of Hsp70, accumulate during cold stress All qRT-PCR assays yielded specific products (i.e single melting peak), and qRT-PCR efficiencies were between 80% and 101% There was no difference in the relative expression of the housekeeping gene RpS20 between all treatment–duration combinations, including controls (ANOVA; F = 0.656; degrees of freedom = 11,30; P = 0.766) Hsp70 and Hsp68 Of the 11 Hsp genes examined, Hsp70Aa and Hsp68 were the most cold-inducible, with overall expression being treatment-specific, and expression being upregulated during recovery treatments (Table and Fig 3) Hsp70Aa was only marginally upregulated towards the end of the cold stress, but was upregulated 68-fold after h of recovery Upon commencement of the 25 °C recovery, the accumulation of Hsp68 transcripts underwent a 0.5 h delay before peaking at h of recovery with 22-fold upregulation Goto and Kimura [28] also found that in some temperate species of Drosophila, Hsp70 mRNA accumulated after the flies were returned to 23 °C following cold treatment The only exception was Drosophila watanabei, where a low level Primer sequence (5¢- to 3¢) RpS20 (forward) RpS20 (reverse) Hsp22 (forward) Hsp22 (reverse) Hsp23 (forward) Hsp23 (reverse) Hsp26 (forward) Hsp26 (reverse) Hsp27 (forward) Hsp27 (reverse) Hsp40 (forward) Hsp40 (reverse) Hsp60 (forward) Hsp60 (reverse) Hsp67Ba (forward) Hsp67Ba (reverse) Hsp68 (forward) Hsp68 (reverse) Hsp70Aa (forward) Hsp70Aa (reverse) Hsc70-1 (forward) Hsc70-1 (reverse) Hsp83 (forward) Hsp83 (reverse) CCGCATCACCCTGACATCC TGGTGATGCGAAGGGTCTTG GCCTCTCCTCGCCCTTTCAC TCCTCGGTAGCGCCACACTC GGTGCCCTTCTATGAGCCCTACTAC CCATCCTTTCCGATTTTCGACAC GTCACATCATGCGCCACTTTG TTGTAGCCATCGGGAACCTTGTAG GGCCACCACAATCAAATGTCAC CTCCTCGTGCTTCCCCTCTACC GAGATCATCAAGCCCACCACAAC CGGGAAACTTAATGTCGAAGGAGAC ACATCTCGCCGTACTTCATCAACTC GGAGGAGGGCATCTTGGAACTC TGGATGAACCCACACCCAATC CGAGGCAACGGGCACTTC GAAGGCACTCAAGGACGCTAAAATG CTGAACCTTGGGAATACGAGTG TCGATGGTACTGACCAAGATGAAGG GAGTCGTTGAAGTAGGCTGGAACTG TGCTGGATGTCACTCCTCTGTCTC TGGGTATGGTGGTGTTCCTCTTAATC GGACAAGGATGCCAAGAAGAAGAAG CAGTCGTTGGTCAGGGATTTGTAG Fragment length (bp) 134 66 153 52 171 112 66 89 88 98 87 150 of upregulation of Hsp70 mRNA was observed, not only during cold exposure, but also during recovery from cold Using RNA interference (RNAi), recent studies on other insect species have demonstrated that Hsp70 is critically important for cold survival [29,30] Hsp68, which belongs to the Hsp70 family, was highly expressed during recovery Hsp68 is induced by heat stress in Drosophila [23,31,32], but there is no previous report of cold induction in this gene Hsp68 is thought to have a similar function to Hsp70 in the protection and ⁄ or renaturation of proteins, but this function may be part of a temporally different response [31] Hsp40 and Hsp83 Hsp40 (also called DnaJ-1) had a fairly high level of basal expression in untreated flies (relative to the housekeeping gene RpS20), confirming that it is a constitutively expressed gene [22] Hsp40 was upregulated Fig Mean relative expression (+standard error), based on log2 transformation of qRT-PCR ratios of the assayed Hsp genes relative to RpS20 White bars represent flies exposed to cold stress (S) for periods ranging from 0.25 to h (S05–S9) Gray and black bars represent flies recovering from h of cold stress at 25 °C with food (RF) or agar (RA), respectively, for periods ranging from 0.5 to h (R05F–R8F and R05A–R8A) The symbol (w) indicates mean values that are significantly (P < 0.05) different from A value equal to indicates no difference in expression level from control flies, whereas positive and negative values indicate upregulation and downregulation, respectively 176 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS H Colinet et al FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS Heat shock response to cold stress 177 Heat shock response to cold stress H Colinet et al during the recovery period (Table and Fig 3), without a lag period; expression was already significantly different from that of the control after 0.5 h of recovery (P < 0.05) A peak of Hsp40 expression was observed after h of recovery Hsp40 is known to respond to heat stress in Drosophila [23,33], but this particular Hsp gene has not previously been reported to be cold-inducible Hsp40 is an essential cofactor that interacts with the members of the Hsp70 family It accelerates the dissociation of the ADP–Hsp70 complex, and therefore an increase in Hsp40 concentration may cause an increase in Hsp70 activity [34] Likewise, the expression of Hsp83 (a homolog of mammalian Hsp90) was not modulated during cold stress, but was upregulated during the recovery period (Table and Fig 3) After h of recovery, there was significant modulation, reaching 3.4-fold Hsp83 was highly expressed in control flies (nearly as much as RpS20), confirming its constitutive expression [22,35] The Hsp90 family gene has been implicated as having a role in the insect diapause In this context, Hsp90 mRNA levels display species-specific modulation, being either upregulated [36,37], downregulated [29], or unregulated [38] Whereas, in diapausing insects, expression results are conflicting, in nondiapausing insects upregulation of Hsp90 following cold treatment seems to be a general rule [28,35,36], and our Drosophila data confirm this sHsp genes All four members of the sHsp family (Hsp22, Hsp23, Hsp26, and Hsp27) showed similar temporal patterns of expression (Fig 3), which differed among treatments (Table 2) The mRNA levels did not show any modulation relative to controls during the cold stress and in the early stage of the recovery phase After this period, gene expression was significantly upregulated A marked peak of expression occurred after h of recovery, with average fold changes relative to controls ranging from four-fold to eight-fold (Fig 3) Only a few studies have analyzed sHsp expression in relation to cold stress in insects Yocum et al [39] found that expression of the Hsp23 transcript of the nondiapausing flesh fly was induced in response to both severe heat and cold shocks (43 °C and )10 °C for h) Sinclair et al [17] did not observe any modulation of Hsp23 transcription during recovery from a short cold stress (3 h at °C) in D melanogaster Perhaps, as for Hsp70 [12], it takes several hours under mild cold stress to obtain a response in sHsp genes However, in the same species, Qin et al [40] reported the upregulation of Hsp23 and Hsp26 during a 30 recovery phase preceded by a cold stress of only h at °C In the present study, flies were stressed for h at °C, and we observed upregulation of four sHsp genes during recovery The reason why D melanogaster has four structurally similar sHsps is still unclear [41] In addition to their molecular chaperone function, sHsps are involved in various processes [4], some of which are important for insect cold tolerance Suppressing the expression of Hsp23 by using RNAi undermines insect survival at low temperature [29] Our expression results suggest that sHsps may play an important role in cold tolerance Hsp22 is a key player in cell protection against oxidative injuries [42], a typical feature of chilling injury [43] In addition, sHsps are effective in preserving the integrity of the actin cytoskeleton and microfilaments [44] This function is particularly important, because there is increasing evidence that cytoskeletal components are involved in insect cold tolerance [19,45] Finally, sHsps prevent caspasedependent apoptosis [46], a process that occurs during heat and cold stress in Drosophila cells [47] Table Comparison of the overall expression of Hsp genes between the three treatments: cold stress (S), RF, and RA Different letters in the same line indicate a significant pairwise difference between treatments by least significant difference tests after ANOVA (a = 0.05) FlyBase ID Hsp22 Hsp23 Hsp26 Hsp27 Hsp40 Hsp60 Hsp67Ba Hsp68 Hsp70Aa Hsc70-1 Hsp83 178 F FBgn0001223 FBgn0001224 FBgn0001225 FBgn0001226 FBgn0015657 FBgn0015245 FBgn0001227 FBgn0001230 FBgn0013275 FBgn0001216 FBgn0001233 3.751 10.78 12.02 14.00 25.91 0.31 2.51 20.23 81.51 0.514 20.20 P < < < < < < S 0.032 0.0002 0.0001 0.0001 0.0001 0.729 0.093 0.0001 0.0001 0.601 0.0001 RF RA a a a a a a a a a a a b b b b b a a b b a b b b b b b a a b b a b FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS H Colinet et al Other Hsp genes The mRNA levels of Hsp60, Hsp67Ba and Hsc70-1 did not show any significant modulation relative to controls during cold stress and during recovery periods (Table and Fig 3) In contrast to Hsp70, little is known about the significance of eukaryotic Hsp60 [48] Hsp60 had a fairly high level of basal expression (relative to the housekeeping gene RpS20), confirming its constitutive expression [49] Heat stress does not modulate the expression of Hsp60 transcripts in Drosophila [23,32], but it increases the expression of Hsp60 in the blowfly [48] Our data indicate that cold stress does not upregulate transcriptional expression of Hsp60, suggesting that this gene is not induced by thermal stress (heat and cold), at least in D melanogaster Hsc70, a member of the Hsp70 family, is constitutively expressed under nonstress conditions [2] In insects, Hsc70 displays species-specific transcriptional changes in response to heat stress, being either induced [50,51] or not induced [23,52] The response of Hsc70 to cold stress is poorly documented In the flesh fly, transcription of Hsc70 is upregulated by cold shock and not by heat shock [52] In the rice stem borer, the level of Hsc70 mRNA decreases slightly during cold acclimation [37] In mites, the level of Hsc70 transcript is not changed by heat or cold shock, or by recovery after either shock [53] We found that, in D melanogaster, cold stress does not modulate the transcriptional expression of Hsc70-1 Finally, the multicopy gene Hsp67 is not responsive to cold stress There are no data on this gene in the cold stress-related literature In Drosophila, expression of Hsp67 is upregulated by heat stress [32,33] Therefore, it seems that, unlike the other Hsp genes tested here, Hsp67 does not respond similarly to heat and cold stress The absence of transcriptional change in expression in these three Hsp genes suggests that they not contribute to the cold repair or cold acclimation machinery However, we cannot exclude the possibility of potential translational or post-translational regulation Heat shock response to cold stress tions match that reported in Bettencourt et al [23], in the context of heat stress induction in D melanogaster This suggests that thermal stress (heat or cold) triggers expression changes in the same set of heat shock genes However, differences exist between the two responses: the level of expression is much higher for heat stress, and the response is also direct, whereas it is delayed for cold stress Differences between heat and cold responses could arise from differential activation of the various Drosophila heat shock factor (HSF) isoforms [54] or from incomplete activation of HSFs under cold stress, as observed under mild heat stress [55] Upregulation of Hsps may be triggered by various accumulated chilling injuries [14,56], and there is evidence that Hsps play a role in the repair process in insects [30] However, the possibility that the stress response observed is a result of the activation of hardening ⁄ acclimation mechanisms should also be considered, as both processes involve expression of some Hsps in Drosophila [40,57] Finally, it has been suggested that expression of Hsps during recovery from cold might result from the thermal stress experienced during the upshift in temperature [12] However, other results have shown that cold itself acts as a cue for the induction [28] The maximum expression levels were only attained when flies were returned to an optimal temperature (peak after h) The functional explanation for this delay is unknown, but it may reflect the strong repression of metabolic activity at low temperature An additional test was performed to address the possible repair ⁄ protective function of Hsps during the recovery phase On the basis on recovery times (Fig 4), flies exposed to constant cold for 16 h were Functional significance There are different degrees of cold inducibility in the D melanogaster Hsp network Some genes are only constitutively expressed, whereas others are constitutively expressed and upregulated after stress or are exclusively inducible According to their cold stress responses, we consider that Hsp60, Hsp67Ba and Hsc70-1 are not cold-inducible, whereas Hsp22, Hsp23, Hsp26, Hsp27, Hsp40, Hsp68, Hsp70Aa and Hsp83 are cold-inducible Apart from Hsp67Ba, these designa- Fig Sigmoid models describing the cumulative proportion of flies recovering (Y) in relation to time spent after cold stress (X) Circles: h treatment (i.e h of cold stress) Squares: + + h treatment (i.e two successive cold stresses of h separated by h of recovery) Triangles: 16 h treatment (i.e 16 h of cold stress) The equation Y = A ⁄ [1 + 10(log B–X)C] was used to fit the data,and to estimate the following parameters: A, which represents the plateau; B, which represents the halfway point between the bottom and the top; and C represents the slope Adjusted coefficients of determination (r2) are provided for each group FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 179 Heat shock response to cold stress H Colinet et al the most affected (16 h treatment), followed by flies exposed to cold for 16 h but with an intermediate pulse of h at 25 °C (8 + + h treatment), and finally, flies exposed to cold for h (8 h treatment) were the least affected (Fig 4) With the 16 h treatment, 29% of the flies did not recover at all after 90 (but were still alive), and parameter B (i.e the halfway point between the bottom and the plateau of the sigmoidal curve) was 51.99 ± 0.38 With the + + h treatment, 13% of the flies did not recover after 90 (but were still alive), and parameter B was 42.94 ± 0.27 Finally all flies of the h treatment group recovered within 90 min, and parameter B was 31.20 ± 0.21 The results suggest that the short pulse at 25 °C, during which some Hsp genes are highly expressed, allows partial repair of chilling injuries Even though flies from the + + h treatment group suffered less than flies from the 16 h treatment group, the beneficial impact of the short pulse at 25 °C was not sufficient to completely offset the physiological cost of the first h of cold stress This short pulse did not seem to provide any protection, as flies of the + + h treatment group took longer to recover than the h treatment flies In summary, these results suggest: (a) a possible role of Hsp upregulation ´ in repair functions, supporting the ideas of Kosˇ tal and ´ ´ Tollarova-Borovanska [30]; and (b) no role of Hsp upregulation in protective functions, supporting the ideas of Nielsen et al [57] In addition to Hsps, the expression of other genes, proteins or metabolites could be regulated during the recovery from cold [16,19,20], and may be responsible for repair processes during recovery Because flies are immobilized at °C (chill coma), long-term cold stress may damage flies though a combination of temperature and starvation stresses In mites, the Hsc70 mRNA level decreases as a result of food restriction [53] In Drosophila, Hsp26, Hsp27 and Hsp70 are upregulated after 58 h of starvation [58] Sinclair et al [17] analyzed the response of Hsp70 and Hsp23 transcripts after a h starvation period, and neither showed any expression modulation In our experimental design, flies were starved at °C for h, and then allowed to recover with or without food for h Therefore, flies recovering without food experienced a total starvation period of 17 h We did not observe any difference between these two conditions in the expression of the 11 genes analyzed, suggesting that starvation stress was not severe and ⁄ or long enough to cause any differential Hsp expression The response of D melanogaster to low temperature is complex and still not fully understood, despite the availability of new molecular tools [59] The current 180 study shows that expression of some, but not all, Hsp genes is elicited in response to prolonged cold stress Some Hsp genes (Hsp22, Hsp27, Hsp40, and Hsp68) are reported as being cold-inducible for the first time Although there is a strong indication that Hsps lead to cold tolerance [29,30], the functional significance of the heat shock response for cold stress is not fully understood, especially as protein denaturation is unlikely to occur at °C [14] Both Hsp70-deficient and HSF-deficient mutant flies maintain some degree of heat tolerance, suggesting that compensatory modification of other Hsp genes, such as Hsp40, Hsp68, and Hsp83, may underlie the maintenance of some degree of thermotolerance [22,60] A key feature of the heat shock response is its suppression following restoration of normal environmental conditions [6], because some Hsps can be detrimental to normal growth [5] However, we show that, for cold, the stress response is essentially observed during the recovery phase This study provides an overview of the temporal expression of D melanogaster Hsp genes in response to cold stress As the network of Hsp genes clearly shows species specificity [61], it would be interesting to compare the stress response of D melanogaster with other models Why cold stress induces the expression of eight different Hsp genes in D melanogaster and whether or not these Hsps have overlapping activities remain open questions The use of mutant (e.g deletion and extra copy numbers) and transgenic (RNAi and overexpression) lines will help us to better understand the relationship between Hsps and cold tolerance Experimental procedures Fly culture We conducted our experiments on a mass-bred D melanogaster population derived from about 50 females collected in Innisfail (Australian east coast, 17°33¢S) in May 2008 Flies were maintained in 250 mL bottles for 15 generations at 19 °C and 70% relative humidity under continuous light on a medium that contained yeast (3.2% w ⁄ v), agar (3.2%) and sugar (1.6%) standard fly medium [62] The fly density was kept at approximately 500 individuals per bottle Flies were transferred at 25 °C for three generations at the time of experiments Conditions for cold stress and recovery Both sex and age can differentially affect cold resistance and Hsp expression [5] Therefore, all tests were performed using synchronized 4-day-old virgin males CO2 anesthesia is a standard technique used to sex Drosophila flies How- FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS H Colinet et al ever, there is increasing evidence that anesthesia interacts with stress recovery [63] Therefore, to avoid any potential confusing effect on Hsp gene expression, all flies were sexed without CO2 within an h window after eclosion For measurement of gene expression during the cold stress and during the recovery period, groups of 20 males (4 days old, virgin) were placed in 42 mL glass vials (without food), which were immersed in a 10% glycol solution cooled to °C to induce chill coma Flies were sampled after 0.25, 3, and h of cold stress, denoted as S025, S3, S6, and S9, respectively (Fig 1) Preliminary experiments were performed to determine stress durations at low temperature that were not associated with mortality To ensure that gene expression was not confounded by nutritional effects during recovery (i.e flies refeeding after cold-induced starvation), mRNA expression was compared in flies recovering with or without food After h of cold stress, flies were returned to 25 °C to recover, and randomly divided into two groups: recovery with food (RF), or recovery with agar (RA) (Fig 1) Flies of the RF group were placed in vials with $ 10 mL of standard food medium Flies of the RA group were transferred to vials containing $ 10 mL of 1% agar, which provides a source of water but not nutrients For determination of any cumulative patterns of gene expression during the recovery period, samples were taken after 0.5, 2, and h during recovery (i.e R05F, R2F, R4F and R8F with food, and R05A, R2A, R4A and R8A with agar only) (Fig 1) For every sampling time, there was a corresponding control, consisting of males kept at 25 °C for the same period of time (Fig 1) For each treatment–duration combination, four vials (20 males each) were used for molecular analysis At each specific sampling time, flies were directly transferred into mL screwcap storage tubes, snap-frozen in liquid nitrogen, and stored at )80 °C until RNA extraction In order to detect the cumulative effect of low temperature on the time required to recover, we used the method described in Hoffmann et al [64] Briefly, for each cold stress duration (i.e 0.25, 3, and h), 40 males were allowed to recover at 25 °C, and the recovery time was recorded Flies were considered to have recovered when they stood up RNA extraction and reverse transcription Flies were ground to fine powder in 1.5 mL tubes placed in liquid nitrogen Samples were mixed with 600 lL of lysis buffer (containing 1% b-mercaptoethanol) from RNeasy RNA extraction kits (Qiagen Pty, Doncaster, Australia) and vortexed for 3–5 to complete homogenization RNA extraction and purification was performed using an RNeasy spin column (Qiagen), following the manufacturer’s instructions Optional on-column DNase digestion was performed to remove any potential genomic DNA contamination, using an RNase-Free DNase Set (Qiagen) Total RNA was eluted in 30 lL of diethylpyrocarbonate-treated water RNA was Heat shock response to cold stress quantified and quality-checked with a UV spectrophotometer (Gene Quant Pro, Amersham Bioscience, Analytical Instruments, Golden Valley, MN, USA) (criteria: A260 nm ⁄ A230 nm > 1.85; A280 nm ⁄ A260 nm > 1.85) The integrity of RNA (i.e the presence of twp intense rRNA bands) was examined by running lL of each RNA sample on a 1% agarose gel Only samples that satisfied both the quality and integrity requirements were used in subsequent experiments Four highquality RNA samples (i.e biological replicates) were obtained for each condition except for SO25, S6, R2F, R4F, R8F, and R8A, which had three biological replicates Three hundred nanograms of total RNA was used in the reverse transcription to cDNA, using the Superscript III First-Strand Synthesis System for qRT-PCR (Invitrogen Pty, Thornton, Australia), according to the manufacturer’s instructions The cDNA was diluted 10-fold in diethylpyrocarbonate-treated water, and stored at )20 °C until use Real-time PCR The coding sequences of the Hsp genes were retrieved from Flybase (http: ⁄ ⁄ flybase.org ⁄ ), and primers were designed using the primer3 module in biomanager (http: ⁄ ⁄ www angis.org.au) (see Table for details) For genes with multiple transcripts, only sequences common to all transcripts were considered We performed electronic PCR for all primer pairs on the reference D melanogaster genome to check for primer specificity (http: ⁄ ⁄ www.ncbi.nlm.nih.gov ⁄ tools ⁄ primer-blast ⁄ ) Real-time PCRs were performed on the LightCycler 480 system Reactions were performed in 384-well LightCycler plates, using LightCycler 480 High Resolution Melting Master Mix (Roche Diagnostics Pty, Castle Hill, Australia), and the crossing point (Cp), equivalent to the cycle threshold (Ct), estimates were obtained using the absolute quantification module in the software package The PCR reactions were performed in a final volume of 10 lL containing lL of cDNA sample, 0.4 lm each primer, and lL of the 2· High Resolution Melting Master Mix After 10 at 95 °C, the cycling conditions were as follows: 60 cycles at 95 °C for 10 s, 60 °C for 15 s, and 72 °C for 15 s To validate the specificity of amplification, a postamplification melt curve analysis was performed Amplicons were first denatured at 95 °C for min, and then cooled to 65 °C, and the temperature was then gradually raised to 95 °C in increments of 0.02 °CỈs)1 Fluorescence data were recorded continuously during this period, and subsequently analyzed using the Tm calling module in the LightCycler 480 software Ratio ẳ controltreatedị Etarget ịDCp target controltreatedị =Ereference ÞDCp reference ð1Þ Relative expression ratios (i.e fold change) were calculated using the efficiency calibrated model of Pfaffl [65], FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 181 Heat shock response to cold stress H Colinet et al rather than the classic 2)DDCt method, which assumes optimal and identical amplification efficiencies in target and reference genes In the Pfaffl model (Eqn 1), Cp is the crossing point (i.e Ct) and E the efficiency of PCRs The ratio of the target gene is expressed in treated samples versus matched controls (calibrators), and normalized using the housekeeping reference gene We used RpS20 as reference [66] instead of actin, because cytoskeletal structures are thermally labile in insects [19,45] To demonstrate stability of the RpS20 transcripts within and between thermal treatments, the expression of RpS20 was standardized relative to another D melanogaster housekeeping gene (DmRP140) [67], and analyzed using one-way ANOVA Because amplification efficiency may not be exactly 100%, accurate determination of ratios requires the estimation of efficiency [65], preferably for every reaction [68] We used a noiseresistant iterative nonlinear regression algorithm (realtime pcr miner; http: ⁄ ⁄ www.miner.ewindup.info ⁄ ) to determine the efficiency of every individual reaction It has been established that this method provides the best precision for real-time PCR efficiency estimation [68,69] Additional test To address the functional role of Hsps during the recovery phase, we compared the time to recovery of flies exposed to three different cold stress treatments: constant °C for h (8 h treatment), or °C for h followed by h of recovery at 25 °C and then another h at °C (8 + + h treatment), or constant °C for 16 h (16 h treatment) In the + + h treatment, flies experienced a total cold stress duration of 16 h, but the short pulse at 25 °C allows the upregulation of Hsp genes (as observed in the present study) All flies used were 4-day-old males, as described previously The hypotheses advanced were as follow If expression of Hsp genes during recovery has a repair function, the recovery time should be less after the + + h treatment than after the 16 h treatment The Hsp induction requires exposure to a rather long period of cold stress [12] If this cold stress period has no physiological cost, because of complete repair during the recovery, the time to recover should be similar after the h and the + + h treatments Finally, if the induction of Hsp genes during recovery has a protective function, the recovery time after the + + h treatment should be less than after the h treatment We used 45 flies in each group, and recovery times were recorded at 25 °C over a maximum period of 90 (as described before) The proportion of flies that had recovered was cumulated over time, giving a sigmoid-shaped function A nonlinear regression method (i.e Eqn 2) was used to fit the relationship between the dependent variable Y (cumulative percentage of recovery) and the independent variable X (time after cold stress) In Eqn (2), the parameter A estimates the plateau, 182 B the halfway point between the bottom and the top, and C the slope: Y ẳ A=1 ỵ 10log BXịC ị 2ị Acknowledgements We are grateful to L Rako, J Shirriffs, S de Garis, A Rako, L Carrington, K Mitchell and M Telonis for assistance with fly work This study was supported by ‘Fonds de la Recherche Scientifique – FNRS’, the Australian Reseach Council, and the Commonwealth Environmental Research Fund This paper is number BRC 148 of the Biodiversity Research Centre References Sinclair BJ, Vernon Ph, Klok CJ & Chown SL (2003) Insects at low temperatures: an ecological perspective Trends Ecol Evol 18, 257–262 Feder ME & Hofmann GE (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology Annu Rev Physiol 6, 243–282 Hoffmann AA, Sørensen JG & Loeschcke V (2003) Adaptation of Drosophila to temperature extremes: bringing together quantitative and molecular approaches J Therm Biol 28, 175–216 Frydenberg J, Hoffmann AA & Loeschcke V (2003) DNA sequence variation and latitudinal associations in hsp23, hsp26 and hsp27 from natural populations of Drosophila melanogaster Mol Ecol 12, 2025–2032 Sørensen JG, Kristensen TN & Loeschcke V (2003) The evolutionary and ecological role of heat shock proteins Ecol Lett 6, 1025–1037 Parsell DA & Lindquist S (1993) The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins Annu Rev Genet 27, 437–496 Hoffmann AA & Parsons PA (1991) Evolutionary Genetics and Environmental Stress Oxford University Press, New York Tammariello SP, Rinehart JP & Denlinger DL (1999) Desiccation elicits heat shock protein transcription in the flesh fly, Sarcophaga crassipalpis, but does not enhance tolerance to high or low temperatures J Insect Physiol 45, 933–938 Al-Fageeh MB & Smales CM (2006) Control and regulation of the cellular responses to cold shock: the responses in yeast and mammalian systems Biochem J 397, 247–259 10 Norry FM, Gomez FH & Loeschcke V (2007) Knockdown resistance to heat stress and slow recovery from chill coma are genetically associated in a central region FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS H Colinet et al 11 12 13 14 15 16 17 18 19 20 21 22 23 of chromosome in Drosophila melanogaster Mol Ecol 16, 3274–3284 Sørensen JG & Loeschcke V (2007) Studying stress responses in the post-genomic era: its ecological and evolutionary role J Biosci 32, 447–456 Burton V, Mitchell HK, Young P & Petersen NS (1988) Heat shock protection against cold stress of Drosophila melanogaster Mol Cell Biol 8, 3550–3552 Joplin KH, Yocum GD & Denlinger DL (1990) Cold shock elicits expression of heat shock proteins in the flesh fly, Sarcophaga crassipalpis J Insect Physiol 36, 825–834 Petersen NS, Young P & Burton V (1990) Heat-shock m-RNA accumulation during recovery from cold shock in Drosophila melanogaster Insect Biochem 20, 679–684 Fangue NA, Hofmeister M & Schulte PM (2006) Intraspecific variation in thermal tolerance and heat shock protein gene expression in common killifish, Fundulus heteroclitus J Exp Biol 209, 2859–2872 Clark MS & Worland MR (2008) How insects survive the cold: molecular mechanisms – a review J Comp Physiol B 178, 917–933 Sinclair BJ, Gibbs AG & Roberts SP (2007) Gene transcription during exposure to, and recovery from, cold and desiccation stress in Drosophila melanogaster Insect Mol Biol 16, 435–443 Colinet H, Hance T, Vernon P, Bouchereau A & Renault D (2007) Does fluctuating thermal regime trigger free amino acid production in the parasitic wasp Aphidius colemani (Hymenoptera: Aphidiinae)? Comp Biochem Physiol A 147, 484–492 Colinet H, Nguyen TTA, Cloutier C, Michaud D & Hance T (2007) Proteomic profiling of a parasitic wasp exposed to constant and fluctuating cold exposure Insect Biochem Mol Biol 37, 1177–1188 ´ Lalouette L, Kosˇ tal V, Colinet H, Gagneul D & Renault D (2007) Cold-exposure and associated metabolic changes in adult tropical beetles exposed to fluctuating thermal regimes FEBS J 274, 1759–1767 Michaud MR & Denlinger DL (2004) Molecular modalities of insect cold survival: current understanding and future trends Int Congress Ser 1275, 32–46 Neal SJ, Karunanithi S, Best A, So AK, Tanguay RM, Atwood HL & Westwood JT (2006) Thermoprotection of synaptic transmission in a Drosophila heat shock factor mutant is accompanied by increased expression of Hsp83 and DnaJ-1 Physiol Genomics 25, 493–501 Bettencourt BR, Hogan CC, Nimali M & Drohan BW (2008) Inducible and constitutive heat shock gene expression responds to modification of Hsp70 copy number in Drosophila melanogaster but does not compensate for loss of thermotolerance in Hsp70 null flies BMC Biol 6, 5, doi:10.1186/1741-7007-6-5 Heat shock response to cold stress 24 Duncan RF (2005) Inhibition of Hsp90 function delays and impairs recovery from heat shock FEBS J 272, 5244–5256 25 Hosler JS, Burns JE & Esch HE (2000) Flight muscle resting potential and species-specific differences in chill coma J Insect Physiol 46, 621–627 26 Chown SL & Terblanche JS (2008) Physiological diversity in insects: ecological and evolutionary contexts Adv Insect Physiol 33, 50–152 27 Rako L & Hoffmann AA (2006) Complexity of the cold acclimation response in Drosophila melanogaster J Insect Physiol 52, 94–104 28 Goto SG & Kimura MT (1998) Heat- and cold-shock responses and temperature adaptations in subtropical and temperate species of Drosophila J Insect Physiol 44, 1233–1239 29 Rinehart JP, Li A, Yocum GD, Robich RM, Hayward SA & Denlinger DL (2007) Up-regulation of heat shock proteins is essential for cold survival during insect diapause Proc Natl Acad Sci USA 104, 11130–11137 ´ ´ ´ 30 Kosˇ tal V & Tollarova-Borovanska M (2009) The 70 kDa heat shock protein assists during the repair of chilling injury in the insect, Pyrrhocoris apterus PLoS ONE 4, e4546, doi:10.1371/journal.pone.0004546 31 Palter KB, Watanabe M, Stinson L, Mahowald AP & Craig EA (1986) Expression and localization of Drosophila melanogaster hsp70 cognate proteins Mol Cell Biol 6, 1187–1203 32 Sørensen JG, Nielsen MM, Kruhøffer M, Justesen J & Loeschcke V (2005) Full genome gene expression analysis of the heat stress response in Drosophila melanogaster Cell Stress Chap 10, 312–328 33 Leemans R, Egger B, Loop T, Kammermeier L, He H, Hartmann B, Certa U, Hirth F & Reichert H (2000) Quantitative transcript imaging in normal and heat-shocked Drosophila embryos by using high-density oligonucleotide arrays Proc Natl Acad Sci USA 97, 12138–12143 34 Laufen T, Mayer MP, Beisel C, Klostermeier D, Reinstein J & Bukau B (1999) Mechanism of regulation of Hsp70 chaperones by DnaJ co-chaperones Proc Natl Acad Sci USA 96, 5452–5457 35 Xiao H & Lis T (1989) Heat shock and developmental regulation of the Drosophila melanogaster hsp83 gene Mol Cell Biol 9, 1746–1753 36 Chen B, Kayukawa T, Monteiro A & Ishikawa Y (2005) The expression of the HSP90 gene in response to winter and summer diapauses and thermal-stress in the onion maggot, Delia antiqua Insect Mol Biol 14, 697– 702 37 Sonoda S, Fukumoto K, Izumi Y, Yoshida H & Tsumuki H (2006) Cloning of heat shock protein genes (hsp90 and hsc70) and their expression during larval diapause and cold tolerance acquisition in the rice stem FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 183 Heat shock response to cold stress 38 39 40 41 42 43 44 45 46 47 48 49 50 51 184 H Colinet et al borer, Chilo suppressalis Walker Arch Insect Biochem Physiol 63, 36–47 Goto SG & Kimura MT (2004) Heat-shock-responsive genes are not involved in the adult diapause of Drosophila triauraria Gene 326, 117–122 Yocum GD, Joplin KH & Denlinger DL (1998) Upregulation of a 23 kDa small heat shock protein transcript during pupal diapause in the flesh fly, Sarcophaga crassipalpis Insect Biochem Mol Biol 28, 677–682 Qin W, Neal SJ, Robertson RM, Westwood JT & Walker VK (2005) Cold hardening and transcriptional change in Drosophila melanogaster Insect Mol Biol 14, 607–613 Morrow G, Heikkila JJ & Tanguay RM (2006) Differences in the chaperone-like activities of the four main small heat shock proteins of Drosophila melanogaster Cell Stress Chap 11, 51–60 Morrow G, Samson M, Michaud S & Tanguay RM (2004) Overexpression of the small mitochondrial Hsp22 extends Drosophila life span and increases resistance to oxidative stress FASEB J 18, 598–599 Rojas RR & Leopold RA (1996) Chilling injury in the housefly: evidence for the role of oxidative stress between pupariation and emergence Cryobiology 33, 447–458 Sun Y & MacRae TH (2005) Small heat shock proteins: molecular structure and chaperone function Cell Mol Life Sci 62, 2460–2476 Kim M & Denlinger DL (2009) Decrease in expression of beta-tubulin and microtubule abundance in flight muscles during diapause in adults of Culex pipiens Insect Mol Biol 18, 295–302 Concannon CG, Gorman AM & Samali A (2003) On the role of Hsp27 in regulating apoptosis Apoptosis 8, 61–70 Yi SX, Moore CW & Lee RE (2007) Rapid cold-hardening protects Drosophila melanogaster from coldinduced apoptosis Apoptosis 12, 1183–1193 Sharma S, Reddy PVJ, Rohilla MS & Tiwari PK (2006) Expression of HSP60 homologue in sheep blowfly Lucilia cuprina during development and heat stress J Therm Biol 31, 546–555 Norry FM, Sambucetti P, Scannapieco AC, Gomez FH & Loeschcke V (2007) X-linked QTL for knockdown resistance to high temperature in Drosophila melanogaster Insect Mol Biol 16, 509–513 Sonoda S, Ashfaq M & Tsumuki H (2006) Cloning and nucleotide sequencing of three heat shock protein genes (hsp90, hsc70, and hsp19.5) from the diamondback moth, Plutella xylostella (L.) and their expression in relation to developmental stage and temperature Arch Insect Biochem Physiol 62, 80–90 Wang H, Dong SZ, Li K, Hu C & Ye GY (2008) A heat shock cognate 70 gene in the endoparasitoid, Pteromalus puparum, and its expression in relation to thermal stress BMB Rep 41, 388–393 52 Rinehart JP, Yocum GD & Denlinger DL (2000) Developmental upregulation of inducible hsp70 transcripts, but not the cognate form, during pupal diapause in the flesh fly, Sarcophaga crassipalpis Insect Biochem Mol Biol 30, 515–521 53 Shim JK, Jung DO, Park JW, Kim DW, Ha DM & Lee KY (2006) Molecular cloning of the heat-shock cognate 70 (Hsc70) gene from the two-spotted spider mite, Tetranychus urticae, and its expression in response to heat shock and starvation Comp Biochem Physiol B 145, 288–295 54 Fujikake N, Nagai Y, Popiel HA, Kano H, Yamaguchi M & Toda T (2005) Alternative splicing regulates the transcriptional activity of Drosophila heat shock transcription factor in response to heat ⁄ cold stress FEBS Lett 579, 3842–3848 55 Park HG, Han SI, Oh SY & Kang HS (2005) Cellular responses to mild heat stress Cell Mol Life Sci 62, 10–23 56 Sejerkilde M, Sørensen JG & Loeschcke V (2003) Effects of cold- and heat hardening on thermal resistance in Drosophila melanogaster J Insect Physiol 49, 719–726 57 Nielsen MM, Overgaard J, Sørensen JG, Holmstrup M, Justesen J & Loeschcke V (2005) Role of HSF activation for resistance to heat, cold and high-temperature knock-down J Insect Physiol 51, 1320–1329 58 Wang HD, Kazemi-Esfarjani P & Benzer S (2004) Multiple-stress analysis for isolation of Drosophila longevity genes Proc Natl Acad Sci USA 101, 12610–12615 59 Doucet D, Walker VK & Qin W (2009) The bugs that came in from the cold: molecular adaptations to low temperatures in insects Cell Mol Life Sci 66, 1404–1418 60 Gong WJ & Golic KG (2006) Loss of Hsp70 in Drosophila is pleiotropic, with effects on thermotolerance, recovery from heat shock and neurodegeneration Genetics 172, 275–286 61 Li ZW, Li X, Yu QY, Xiang ZH, Kishino H & Zhang Z (2009) The small heat shock protein (sHSP) genes in the silkworm, Bombyx mori, and comparative analysis with other insect sHSP genes BMC Evol Biol 9, 215, doi:10.1186/1471-2148-9-215 62 Hoffmann AA & Shirriffs J (2002) Geographic variation for wing shape in Drosophila serrata Evolution 56, 1068–1073 63 Nilson TL, Sinclair BJ & Roberts SP (2006) The effects of carbon dioxide anesthesia and anoxia on rapid cold-hardening and chill coma recovery in Drosophila melanogaster J Insect Physiol 52, 1027–1033 64 Hoffmann AA, Anderson A & Hallas R (2002) Opposing clines for high and low temperature resistance in Drosophila melanogaster Ecol Lett 5, 614–618 65 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR Nucleic Acids Res 29, 2002–2007 66 Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB & Wergeland HI (2006) Expression profiling and valida- FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS H Colinet et al tion of reference gene candidates in immune relevant tissues and cells from Atlantic salmon (Salmo salar L.) Mol Immunol 43, 1194–1201 67 Sitzler S, Oldenburg I, Petersen G & Bautz EKF (1991) Analysis of the promoter region of the housekeeping gene DmRP140 by sequence comparison of Drosophila melanogaster and Drosophila virilis Gene 100, 155–162 Heat shock response to cold stress 68 Zhao S & Fernald RD (2005) Comprehensive algorithm for quantitative real-time polymerase chain reaction J Comput Biol 12, 1047–1064 69 Rulli SJ, Arikawa E & Yang J (2008) Cross-platform comparisons of algorithms for calculating real-time PCR amplification efficiencies FASEB J 22, 621– 625 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 185 ... processes involve expression of some Hsps in Drosophila [40,57] Finally, it has been suggested that expression of Hsps during recovery from cold might result from the thermal stress experienced during. .. (1988) Heat shock protection against cold stress of Drosophila melanogaster Mol Cell Biol 8, 3550–3552 Joplin KH, Yocum GD & Denlinger DL (1990) Cold shock elicits expression of heat shock proteins... regulation Heat shock response to cold stress tions match that reported in Bettencourt et al [23], in the context of heat stress induction in D melanogaster This suggests that thermal stress (heat or cold)