show that the sum of two or three dyads cannot always be rearranged to become just a single dyad the sum of dyads is its
Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
... particles suggests the hypothesis that there is a requirement for the processing threshold of the core protein precursors to be achieved before morphogenesis can proceed Taken together, the data ... precursor cleavage and the initiation of core condensation Following this activity, the activation of G1L completes core condensation and allows progression to the formation of intracellular mature ... virus If the activity of the I7L proteinase is blocked, viral morphogenesis arrests prior to core condensation If the activity of G1L proteinase is blocked, viral morphogenesis arrests at a stage...
- 6
- 300
- 0
báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx
... particles suggests the hypothesis that there is a requirement for the processing threshold of the core protein precursors to be achieved before morphogenesis can proceed Taken together, the data ... precursor cleavage and the initiation of core condensation Following this activity, the activation of G1L completes core condensation and allows progression to the formation of intracellular mature ... virus If the activity of the I7L proteinase is blocked, viral morphogenesis arrests prior to core condensation If the activity of G1L proteinase is blocked, viral morphogenesis arrests at a stage...
- 6
- 208
- 0
financial report 1999 holderbank the financial results posted in 1999 demonstrate that the group has further consolidated its position and created real added value
... International Standards on Auditing issued by the International Federation of Accountants (IFAC), which require Arthur Andersen AG that an audit be planned and performed to obtain reasonable assurance ... in prior years is between the purchase price and the fair value of the ac- recorded when there is an indication that the impairment quired net assets at the time of acquisition Goodwill is losses ... based on our audit and on the reports of other auditors, the consolidated financial statements These consolidated financial statements are the respon- give a true and fair view of the financial...
- 74
- 314
- 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
... what part the language is playing, what it is that the participants are expecting the language to for them in that situation, the symbolic organisation of the text, the status that it has, and ... linguistic theory by M .A. K Halliday It is a theory of language centred around the notion of language function Halliday argues that it is the social context for communication that regulates the way the ... grammatical metaphor The main function of the ideational grammatical metaphor is to condense the information as a way to pack more lexical items in one clause at the expense of deleting the participants...
- 53
- 1,013
- 3
Báo cáo y học: "Analysis of infectious virus clones from two HIV-1 superinfection cases suggests that the primary strains have lower fitnesc" ppt
... DQ1 and DQ3 HIV-1 blood plasma viral load measurements were done at the Laboratory of Clinical Virology at the AMC (Amsterdam, The Netherlands) with the Versant HIV-1 RNA 3.0 assay (Bayer Diagnostics ... [55] The nef gene was amplified using 5′ End-env-s primer (5′TAG AAG AAT AAG ACA GGG CTT GG3′) and R-LTR3′FM (5′AGA CCC AGT ACA GGC AAA AAG CAG CTG CTT ATA3′) using Amplitaq (Perkin Elmer units/μl) ... protein activates transcription by binding to the TAR hairpin in the LTR, thereby acting as a potent activator of viral gene expression Mutational analysis of four highly conserved aromatic amino acid...
- 15
- 319
- 0
In this paper, we investigate the relationship between migration and species distribution in multizone environment. We present a discrete model for migration of three competing species over three zones. We prove that the migration tactics of species leads
... are dormant but the failure rate of a dormant (λd ) is lower than the failure rate of the component in operation ( a ) A spare component may be ”cold” if its failure rate is while it is dormant, ... the dormant has the same failure rate as an operating one, and it is called ”warm” otherwise • FDEP The FDEP gate has one main input connected to a component or another gate and it has several ... output of the SEQ gate becomes True when all of its inputs have failed in a pre-assigned order but it is not possible that the failure events occur in another order We assume that all the rates are...
- 8
- 292
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that finally leads to the supercomplex formation ... specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... comparable amounts in both yeast strains Therefore, the reason for the disappearance of the bc1 dimer in the yeast strain in which Qcr10p is missing remains unknown On the basis of all the above reported...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients with AMI and to validate the use of serum DNase I activity as a new diagnostic marker ... diagnostic marker for the early detection of AMI To elucidate the molecular basis of this phenomenon, it is important to understand the regulatory mechanism of the human DNase I gene (DNASE1) expression ... vectors and 0.6 lg of the pSV–b-galactosidase vector (Promega), followed by assay of DNase I and b-galactosidase activities, according to a previously described method [32] Preparation of nuclear...
- 12
- 609
- 0
Walt Disney: The Mouse That Roared (Legends of Animation)
... downfall Like his overdemanding father, Walt had become “an overbearing boss,” alienating many of his animators who had become so disgusted they were ready to jump ship Walt became intolerable as ... for drawing was about to start him on a whole new trek toward his destiny 21 The Unrepentant Animator D eciding to become a successful cartoonist, Walt applied for a job at the Kansas City Star, ... eating “beans from a can and scraps of bread from a picnic.” He considered giving it all up and heading to New York to work as an animator on the Felix the Cat cartoons Walt was much like his...
- 145
- 438
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as ... nuclear extracts were incubated with avidin–agarose beads (Sigma) at °C for 30 to eliminate materials in the extracts that bind nonspecifically to the beads After removing the beads by filtration, ... cells It has been proposed that the WD protein acts as a copperspecific pump that mediates the export of copper from the cytosol, similar to the P-type ATPase [14] On the basis of the fact that MREs...
- 11
- 628
- 0
ELA, Promissory Notes and All That: The Fiscal Costs of Anglo Irish Bank pdf
... of its balance sheet, marking down both the value of its ELA asset and the value of its liabilities. This is the scenario that actually occurs. The graph below shows what has happened over the past few years with the “Other Assets” ... Executive Board) at its monthly monetary policy meeting. Haircuts are applied to the collateral so that the amount that is loaned to the borrowing bank is less than the value of the asset, ... Liquidity Assistance”—either way it’s ELA. This assistance takes the form of loans that are provided to banks who pledge collateral that it is not acceptable for Eurosystem operations. To understand the legal basis for ELA, one has to start with the observation that all of the national ...
- 28
- 322
- 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx
... system of Waters Co (Milford, MA, USA) Chromatographic media were supplied by Amersham Pharmacia Biotech AB Rabbit antisera pAb against the intracellular domain of human nephrin has been described ... which further supports a role for IQGAP1 as a biological ligand of nephrin It is apparent that the slit-diaphragm is connected to the actin cytoskeleton that has a well-documented and critical role ... a colocalization of S100B and IQGAP1 was evident at plasma membrane and in the growing processes However, maybe the most notable issue is that IQGAP1 is involved in the formation and maintenance...
- 16
- 333
- 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... heteronuclear two- dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal-(1fi3) -a- D-GalNAc configuration Taken together, these data demonstrate that two Conus ... secretory pathway of the contulakin family, but a different set of enzymes may be packaged into the secretory pathway for the T-superfamily of peptides to which tx 5a belongs It is also feasible that ... it being glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the glycopeptide side-chain atoms of...
- 11
- 563
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... chromatography on a Sephadex G-50 column gave a major O-polysaccharide peak at the void volume (O-polysaccharide) and a minor peak just after The material in the major peak was devoid of neuraminic ... in the upper phase and the pellet showed identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, ... repeating unit of the polysaccharide thus contains a terminal NeuAc, and the above mentioned residues A comparison to the methylation analysis data on the O-polysaccharide, indicates that the...
- 7
- 463
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC ... AAACTCGAGAGTCCCTGATAAAACTGTGAGATG AAAGCGGCCGCTTAGCATGTGCCTTCCCGTAG AAAGGATCCTGCAAGCCTGTGAAGTGG AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA ... AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA...
- 10
- 308
- 0
Báo cáo hóa học: " Evidence that the Nijmegen breakage syndrome protein, an early sensor of double-strand DNA breaks (DSB), is involved in HIV-1 post-integration repair by recruiting the ataxia telangiectasia-mutated kinase in a " pptx
... Tauchi H, Kobayashi J, Morishima K, Matsuura S, Nakamura A, Shiraishi T, Ito E, Masnada D, Delia D, Komatsu K: The forkhead-associated domain of NBS1 is essential for nuclear foci formation after ... observed that phosphorylation of the histone H2AX isoform, which is mediated by both the ATM and ATR kinases and is required for DSB repair, appears to be dispensable for PIR, although it can be detected ... recently shown that ATM phosphorylates the DNA repair protein Artemis, and ATM is required for Artemis-dependent processing of damaged ends of DNA [41] Artemis is a critical component of the cellular...
- 12
- 398
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008