0

short term investment mr hoang quan ceo of a i capital claimed his research has showed that 10 investors with more than 10 billions vnd there are at least 7 people don t have the intendance to invest long term at vietnam securities market1

Application of mathematics models in short - term investment decisions

Application of mathematics models in short - term investment decisions

Quản trị kinh doanh

... estimates that its variable production, administrative, and marketing costs (including credit department costs) are approximately 75 percent of total sales; that is, the variable cost ratio is ... is what the firm gives up with this strategy Notice that the opportunity costs increase as the initial (and average) cash balance rises b The Trading Costs To determine the total trading costs ... following: The time a customer takes to repay the credit obligation, given that it is repaid The probability that a customer will fail to repay the credit extended to it The average collection period...
  • 118
  • 199
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mid-term results and factors affecting outcome of a metal-backed unicompartmental knee design: a case series" pptx

Hóa học - Dầu khí

... revision to total knee arthroplasty (TKA) In our center we not treat symptomatic aseptic loosening with implantation of a new UKA prosthesis; all these patients are revised to a TKA The Kaplan-Meier ... was used to examine whether any of these factors were associated with the risk of failure of UKA, with a hazard ratio over one indicating that the factor was an independent predictor of a higher ... Patients were additionally evaluated for the presence of patellar osteophytes as an indicator of patellofemoral arthritis that is easily identifiable on most standard follow-up radiographs Radiolucencies...
  • 7
  • 272
  • 0
Báo cáo y học:

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Y học thưởng thức

... organization is better able to identify patients in a life-threatening situation, even though there is no statistical significance This result is in concordance with a previous study which showed ... to evaluate the organization changes The EMD has an essential and important role in the early management of patients, and there are some difficulties in evaluating quality and effectiveness of ... The Risk Ratio for underestimation was higher (RR 1.46) for the new EMCC compared to the municipality-based centers In relation to the EMD ability to detect patients in life-threatening situations,...
  • 5
  • 495
  • 0
Campaigns of a Non-Combatant, and His Romaunt Abroad During the War ppt

Campaigns of a Non-Combatant, and His Romaunt Abroad During the War ppt

Cao đẳng - Đại học

... deserters took the first tidings of the retreat to the astonished Federals, and they raised the national flag within the fortifications, in the gray of the morning of the 4th of May Many negroes also ... said the same man, after a little silence "The Bucktails cut their throats the first day that they encamped at the mill," said Miss Priscilla "Them Bucktails great fellers," said the tall man; ... on the thirteenth day The husband said that his name was "Jeems," and that his wife was called "Kitty;" that his youngest boy had passed the mature age of eight months, and that the "big girl,...
  • 175
  • 443
  • 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Báo cáo khoa học

... when quantitative estimates of activity were compared to results of the gel analysis, it was apparent that cleavage alone was not sufficient for activation After 20 digestion by trypsin, all of the ... B activity could be detected in the same material To confirm that the digestive carboxypeptidases in this insect did include enzymes with activity towards substrates with C-terminal glutamate ... reducing agent dithiothreitol also inhibits activity of the recombinant HaCA42 carboxypeptidase at concentrations above 10) 5 M, resulting in 45% inhibition at 10) 4 M and 86% inhibition at 10) 3 M The...
  • 12
  • 458
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

Hóa học - Dầu khí

... of curvature [31], was calculated as the ratio of the actual arm trajectory length to the shortest path to the target A ratio of indicates no arm deviation from the shortest path, while a ratio ... cognitive assessment with the MiniMental State Examination scale [29] indicated that no participant exhibited severe abnormalities that might significantly restrict game performance The participants ... mild -to- moderate ataxia, and the score 35 indicating the most severe manifestations Gait Assessment Test [25], with 22 points indicating a high fall risk; and c) 5-12 points on the Ataxia Test according...
  • 11
  • 793
  • 0
báo cáo hóa học:

báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx

Điện - Điện tử

... elements that may allow for quantification of the relative contribution of each, to the effectiveness of rehabilitation activities Competing interests The authors declare that they have no competing ... suggest that manipulating the rate at which task parameters change may affect the rate at which a particular subject learned to perform a task The algorithm experiment also suggests that the rate of ... fractionation achieved for each finger during that trial If the average fractionation score is greater than 90% of the set target, the target fractionation will increase by 0.005 radians If the average...
  • 10
  • 506
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Characterization of a Reconfigurable Free-Space Optical Channel for Embedded Computer Applications with Experimental Validation Using Rapid Prototyping Technology" pptx

Báo cáo khoa học

... the attenuation per stage is a limiting factor and optimization is also required in this case It can be seen that for example by decreasing the attenuation from 0 .74 to 0.80 that the maximum ... to compare the value of the misdirected signal at any output with the value of the digital “0” at any output It also has been analyzed how the optical signal is a ected in terms of polarization ... Pcrosstalk at each output is lower than P0 at the same output In fact, the extinction ratio of the optical signal defined as re = P1/P0 = 8.8 at the first output is lower than the extinction ratio of...
  • 7
  • 394
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Utilization of a dynamometric pendulum to estimate cutting forces involved during routing. Comparison with actual calculated values" pdf

Báo cáo khoa học

... angle obtained idle (without sample); ω = angle obtained after cutting At the beginning of this study, the aim was to take into account the influence of wood material in the estimation of cutting ... elasticity in compression), and SG (specific gravity) (in order to know if each factor was significantly separate in the correlation, a student test t was carried out) Fc is total cutting forces ... at that state of the study, the question was: is it possible to obtain the same precision more easily, without expensive material (piezo-electric sensors, router, etc.), and maybe with more information...
  • 7
  • 323
  • 0
Báo cáo y học:

Báo cáo y học: " Disrupting the rhythm of depression: design and protocol of a randomized controlled trial on preventing relapse using brief cognitive therapy with or without antidepressants" pptx

Báo cáo khoa học

... informing the patient through their therapist: if a therapist wants to inform the patient themselves, the patient then receives the information via the therapist and is given a letter containing all ... psychiatrists will be advised to taper AD in weeks to prevent withdrawal symptoms In this arm patients will be asked for an intention to taper AD The patient is allowed to start AD again at any time ... residual difficulty to disengage and residual dysfunctional implicit attitudes are related to the return of depressive symptoms an Implicit Association Test (IAT; [ 47] ) that is also used in the Netherlands...
  • 9
  • 350
  • 0
Báo cáo y học:

Báo cáo y học: "The Autism - Tics, AD/HD and other Comorbidities inventory (A-TAC): further validation of a telephone interview for epidemiological research" docx

Báo cáo khoa học

... the patients who gave consent to the studies; it was hard to get in contact with many of these parents and to conduct a telephone interview with them The clinical diagnoses are state of the art ... included in the additional material to this paper (Additional file 2) The A- TAC modules are: Communication, Social interaction, Flexibility (corresponding to the problem domains of ASD), Attention, ... and (c) in that it has been validated as a telephone interview There are today several instruments that are frequently used as telephone interviewing tools, but are not validated as such In the...
  • 11
  • 377
  • 0
The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province

The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province

Tổng hợp

... Keywords Tiếng Anh; Kỹ vi t; Lớp 10; Phương pháp giảng dạy Content TABLE OF CONTENTS CONTENTS PAGE Acknowledgements i Abstract ii Table of contents iii,iv,v,vi Lists of abbreviations vii Lists of tables ... after the experiment 27- 28 2.4.1.3 The experimental groups’ improvement in writing proficiency 29-30 2.4.2 Data Analysis of Questionnaires 2.4.2.1 Students’ attitude to writing before and after ... Questions 35 3.1.1 Benefits of G.B .A on students’ writing proficiency 35-36- 37 3.1.2 Limitations of G.B .A to teaching writing 37- 38 3.2 Summary 38-39 CONCLUSION 1 .The benefits and limitations of...
  • 9
  • 863
  • 7
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Kỹ thuật - Công nghệ

... GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following ... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCTTCAAACAAGTAATG ... CGCGTCGACCCGCTTCAAATTGAAGAAG 3' CCGGGATCCGGCGGGAAGTATATGTGTG 3' CGCGTCGACCTTCTTGACACGTTTGTG 3' CCGGGATCCTGTTAATGTTTATTTTTT 3' CGCTCTAGAGGAATCACAGTTAC 3' CCGAGATCTTGTTAATGTTTATTTTTT 3' 2.3.3 Probes for Northern...
  • 124
  • 400
  • 0
Development and realization of a distributed control algorithm for an inverted rotary pendulum using freeRTOS with TTCAN communication

Development and realization of a distributed control algorithm for an inverted rotary pendulum using freeRTOS with TTCAN communication

Kinh tế

... system in steady state, the system states must go to zero as the time run to infinity It is obvious that the opened IRP was impossible to hold itself at the upright position To hold the IRP at the ... for-condition braces can be initialized, test, and an action that leads to the satisfaction of that test The format of the for-loop statement is as follows: for (expr1; expr2; expr3) { statement; statement1; ... space for the communication among the nodes In order to deal with that issue, the TTCAN specification allows using more than one basic cycle to build the communication matrix or system matrix The...
  • 103
  • 327
  • 0
Short term generation scheduling of cascaded hydro electric system using time varying acceleration coefficients PSO

Short term generation scheduling of cascaded hydro electric system using time varying acceleration coefficients PSO

Môi trường

... (i ) Best position of particle i until iteration k G _ best Best position of the group until iteration k Initial value of inertia weight ω ω max Final value of inertia weight iter Current iteration ... particles associated with position and velocity vector At each iteration particle moves towards an optimum solution through its present velocity and their individual best solution obtained by themselves ... discretized into one hour periods 2.2.1 Equality constraints a) Water balance equation This equation relates the previous interval water storage in reservoirs with current storage including delay in water...
  • 14
  • 544
  • 0
Developing a system of games to enhance short term memory for interpreter students at vinh university

Developing a system of games to enhance short term memory for interpreter students at vinh university

Khoa học xã hội

... interpretation This is the phase that the interpreter receives the input of information It is impossible for him to the next phases in the consecutive interpreting process without listening There ... to the limitation of time and capability, investigating all students would be difficult Thus, the survey is applied to only 4th year English students at Vinh university with the total of fifty-one ... first type of STM games is Auditory Games STM auditory games are the ones that require the player to encode, store and retrieve the information within a short period of time with the aid of the...
  • 64
  • 541
  • 0
Mechanical properties of solid polymers Constitutive modelling of long and short term behaviour pptx

Mechanical properties of solid polymers Constitutive modelling of long and short term behaviour pptx

Kĩ thuật Viễn thông

... not seem to affect the shape of the curve, it clearly changes the position on the (logarithmic) time axis This indicates that all relaxation times associated with the relaxation mechanism are ... conditions the secondary transition gives a substantial contribution to the deformation in this material In addition, we included isotactic polypropylene (i- PP) to investigate separate relaxation ... against the logarithm of time After an initial elastic response, the material shows time dependent creep until gradually a constant rate of deformation is established, that is, the material is...
  • 155
  • 570
  • 0
Báo cáo khoa học: Photosynthetic acclimation: State transitions and adjustment of photosystem stoichiometry – functional relationships between short-term and long-term light quality acclimation in plants ppt

Báo cáo khoa học: Photosynthetic acclimation: State transitions and adjustment of photosystem stoichiometry – functional relationships between short-term and long-term light quality acclimation in plants ppt

Báo cáo khoa học

... metabolism and signaling [13] Inhibitor treatments indicate that at least 54 genes are regulated directly by the redox state of the photosynthetic electron transport chain Thus, the data confirm that, as ... PSIIlight The stn7 mutant of Arabidopsis did not show such differences, indicating that this mutant lacks not only the state transition but also the LTR [40] Thus, it appears that the STN7 kinase ... Arabidopsis These first data suggest that light quality acclimation under low light conditions is very important for plants and that state transitions and the LTR both provide a significant bene t to a...
  • 9
  • 603
  • 0
Báo cáo khoa học: The multifarious short-term regulation of ammonium assimilation of Escherichia coli: dissection using an in silico replica pdf

Báo cáo khoa học: The multifarious short-term regulation of ammonium assimilation of Escherichia coli: dissection using an in silico replica pdf

Báo cáo khoa học

... for the regulatory contribution of Xi on the Xi rate of GS) at time t has the highest contribution to the change in the rate of GS at that moment in time After integrating over the entire steady-state ... apparent maximal rate of GS (VAPPGS) and the adenylylation state of glutamine synthetase (nAMP); GH, the concentration of PII with one a- KG attached to it (PIIKG1), of PII saturated with both ... regulation through ATase, GS contributed 44% to the ammonium assimilation rate mins after the addition of ammonium Similarly, in order to investigate the role of UTase in regulating the maximal rate...
  • 21
  • 398
  • 0
THE ECONOMI INTEGRATION OF IMMIGRANTS IN THE UNITED STATES: LONG-AND SHORT-TERM PERSPECTIVES potx

THE ECONOMI INTEGRATION OF IMMIGRANTS IN THE UNITED STATES: LONG-AND SHORT-TERM PERSPECTIVES potx

Cao đẳng - Đại học

... The age at which immigrants arrive in the United States is a critical determinant of how they fare in the Hispanic immigrants tend to arrive slightly earlier than other immigrants The median age ... immigrant-integrating institutions in the United States In contrast to other immigrant-receiving countries across the advanced industrial world, immigrants in the United States are strongly attached ... of Immigrants in the United States 13 MIGRATION POLICY INSTITUTE Works Cited Akresh, Ilana Redstone 2006 Occupational Mobility Among Legal Immigrants to the United States International Migration...
  • 21
  • 411
  • 1

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008