Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

IDENTIFICATION AND CHARACTERIZATION OF A CANDIDA ALBICANS α-1, MANNOSYLTRANSFERASE CaMNN5 THAT SUPPRESSES THE IRON-DEPENDENT GROWTH DEFECT OF SACCHAROMYCES CEREVISIAE aft1Δ MUTANT BAI CHEN NATIONAL UNIVERSITY OF SINGAPORE 2005 ACKNOWLEDGEMENTS My first and sincere gratitude goes to my supervisor, Associate Professor Yue Wang His constant encouragement, scientific guidance and stimulating discussions help me to sustain my interest and effort throughout the entire course of my research project I am grateful to members of my Ph.D supervisor committee, Associate Professor Mingjie Cai and Associate Professor Thomas Dick, for their support, discussions and constructive suggestions in improving my research work I would like to express my gratitude to all the past and present members in WY lab, in particular, Narendrakumar Ramanan, for his teaching me all the techniques when I joined the lab, Zheng Xinde, for his extensive valuable discussions and suggestions to my project, and Chan Fong Yee, for her high-standard technical support Finally, my sincere heartfelt thanks go to my parents, for their constant encouragement and support throughout these years Bai Chen July 2005 ii TABLE OF CONTENTS ACKNOWLEDGEMENTS LIST OF CONTENTS LIST OF FIGURES LIST OF TABLES ABBREVIATIONS SUMMARY ii iii vi viii ix xi CHAPTER Introduction 1.1 The mating system and phenotype switching in C albicans 1.2 Polymorphism and virulence of C albicans 1.2.1 Morphological transition is essential for virulence 1.2.2 The mitogen-activated protein kinase pathway 1.2.3 The cAMP-dependent protein kinase A pathway 1.2.4 Other pathways involved in hyphal growth 1.2.5 Hyphal specific genes and regulation Pathogenesis and host defense systems 1.3.1 Adhesins 1.3.2 Proteinases 1.3.3 Protein glycosylation 1.3.4 Encountering the host defense systems Iron acquisition and microbial infections 3 4 7 12 12 Iron uptake systems of S cerevisiae and C albicans 1.5.1 Uptake of siderophore iron 1.5.2 Reductase-dependent iron uptake 1.5.3 Other pathways in iron homeostasis 15 15 16 20 1.5.4 Iron uptake system of C albicans The aim of the present study 22 24 1.3 1.4 1.5 1.6 CHAPTER Materials and Methods 2.1 Reagents 2.2 Strains and culture conditions 2.3 Oligonucleotide primers 2.3.1 Gene deletion 2.3.2 Primers for cloning work 2.3.3 Probes for Northern Blot 2.3.4 Site-directed Mutagenesis 2.4 Recombinant DNA methods 26 26 28 28 29 30 30 31 iii 2.4.1 2.4.2 2.4.3 2.4.4 2.4.5 2.5 Preparation of electrocompetent E coli cells Plasmid preparation and analysis Preparation of DNA probes Southern blot Northern blot 31 32 33 34 34 C albicans and S cerevisiae manipulations 2.5.1 Transformation 35 35 2.5.2 35 Preparation of C albicans and S cerevisiae genomic DNA 2.10 2.11 S cerevisiae gene deletion 37 2.6.2 2.6.3 2.7 2.8 2.9 36 37 2.6.1 2.6 2.5.3 Preparation of C albicans and S cerevisiae RNA Gene disruption and expression C albicans MNN5 gene deletion Plasmid constructs for GFP tagging 37 38 2.6.4 Constructs in the study of CaMNN5 Microscopy and fluorescence studies Indirect immunofluorescence staining of cells Protein work 2.9.1 Yeast protein preparation 2.9.2 Western blot 2.9.3 Subcellular Fractionation 2.9.4 Expression and purification of GST-fusion protein 2.9.5 Preparation of polyclonal antibodies 38 39 39 40 40 40 41 41 42 59 43 44 Fe Uptake Assay and 55Fe binding assay Lucifer yellow endocytosis assay 2.12 Expression and purification of CaMnn5p in Pichia pastoris 2.13 Assay of CaMnn5p mannosyltransferase activity 2.14 Alcian blue binding assay 44 45 45 2.15 2.16 2.17 2.18 46 46 47 47 O-linked carbohydrate analysis Lactoferrin killing assay Cell wall defects test Virulence test in mice CHAPTER Isolation and functional characterization of a novel Candida albicans gene CaMNN5 that suppresses the irondependent growth defect of Saccharomyces cerevisiae aft1Δ 3.1 Introduction 48 3.2 3.3 Isolation of CaMNN5 49 The Lys-Glu-Xaa-Xaa-Glu motifs of CaMnn5p are functional and required for the growth-promoting function 52 iv 3.4 CaMnn5p functions independent of the known high-affinity iron transporters of S cerevisiae 55 3.5 CaMnn5p has α-1,2-mannosyltransferase activity, which is not required 3.6 for suppressing the growth defect of aft1Δ CaMnn5p enhances a slow process of iron uptake 57 60 3.7 The enhancement of cell growth by CaMNN5 depends on endocytosis 62 3.8 3.9 Subcellular localization of CaMnn5p in S cerevisiae Summary 65 66 CHAPTER Characterization of CaMNN5 in Candida albicans 4.1 Introduction 67 4.2 Expression of CaMNN5 in Candida albicans 69 4.3 CaMNN5 can complement S cerevisiae mnn5Δ mutant, but not mnn2Δ mutant α-1, mannosyltransferase activity of CaMnn5p 4.4.1 Expression and purification of CaMnn5p 4.4.2 Optimum pH for CaMnn5p mannosyltransferase activity 4.4.3 CaMnn5p requires Mn2+ and Fe2+ for its enzyme activity 69 70 70 72 72 4.5 Construction of CaMNN5 deletion mutant 74 4.6 Deletion of CaMNN5 results in an up-regulation of CaFTR1 74 4.7 Camnn5Δ showed significantly reduced mannosylphosphate content 76 4.8 Camnn5Δ exhibits markedly reduced sensitivity to lactoferrin 78 4.9 CaMNN5 has a role in both N-linked and O-linked glycosylation 80 4.10 Camnn5Δ shows defects in cell wall integrity 82 4.11 Camnn5Δ is defective in hyphal morphogenesis 84 4.4 4.12 CaMNN5 is required for C albicans virulence 4.13 Summary 85 86 CHAPTER Discussion 5.1 How does CaMnn5p enhance the growth of S cerevisiae under ironlimiting conditions? 87 5.2 5.3 CaMNN5 deletion impairs a wide range of cellular events in C albicans CaMnn5p regulates cell functions in response to iron? 90 92 5.4 Morphogenesis defects in Camnn5Δ mutant 93 5.5 5.6 CaMNN5 is the first gene identified so far to mediate the LF killing Conclusion 94 95 REFERENCES PUBLICATIONS 98 112 v List of Figures Figure 1.1 Iron transport systems in S cerevisiae 21 Figure 3.1 Nucleotide and amino acid sequence of CaMNN5 50 Figure 3.2 CaMNN5 enhances aft1Δ growth on iron-limiting media 51 Figure 3.3 CaMnn5p contains three potential iron-binding Lys-GluXaa-Xaa-Glu motifs 54 Figure 3.4 CaMNN5 promotes cell growth under iron-limiting conditions by a mechanism independent of the highaffinity iron transporters 56 Figure 3.5 Mannosyltransferase activity of CaMnn5p is not required for promoting cell growth 58 Figure 3.6 CaMnn5p enhances a slow process of iron uptake 61 Figure 3.7 CaMnn5p-mediated iron uptake in mutants defective of the endocytic pathway 64 Figure 3.8 Subcellular localization of CaMnn5p 65 Figure 4.1 The expression of CaMNN5 is iron-independent 68 Figure 4.2 CaMNN5 restores Alcian blue binding in S cerevisiae mnn5Δ mutant 70 Figure 4.3 Expression, purification and enzyme activity of CaMnn5p 71 Figure 4.4 The enzyme activity of CaMnn5p requires Mn2+ and Fe2+ 73 Figure 4.5 Chromosomal deletion of CaMNN5 75 Figure 4.6 Enhanced expression of CaFTR1 in Camnn5Δ strains 76 Figure 4.7 Alcian blue binding assay 77 Figure 4.8 Lactoferrin sensitivity assay 79 Figure 4.9 β–elimination of O-glycans 81 vi Figure 4.10 Camnn5Δ is hypersensitive to lyticase and Congo red 83 Figure 4.11 Camnn5Δ is defective in hyphal growth on some solid inducing media 84 Figure 4.12 Camnn5Δ mutant showed markedly reduced virulence 85 vii TABLE Table 2.1 C albicans and S cerevisiae strains used in this study 27 viii ABBREVIATIONS a.a amino acid 5-FOA 5-fluoro orotic acid Ala (A) alanine Asp (D) aspartic acid BCS 2,9-dimethyl-4,7-diphenyl-1,10phenanthrolinedisulphonic acid bp base pair BPS bathophenanthroline sulfonate DAPI 4',6-diamidino-2-phenylindole DTT dithiothreitol EDTA ethylenediamine tetraacetic acid FAS ferrous ammonium sulphate FC chelator ferrichrome fmol femtomolar g gram GFP green fluorescence protein Glu (E) glutamic acid h hour HA haemagglutinin Kb kilobase kDa kiloDalton LF lactoferrin Lys (K) lysine MAPK mitogen activated protein kinase mCi millicurie mg milligram ix minute ml milliliter ng nanogram OD optical density ORF open reading frame PAGE polyacrylamide gel eletrophoresis PBS phosphate buffered saline PCR polymerase chain reaction s second Ura3- uracil auxotrophy Ura3+ uracil prototrophy UV ultraviolet μl microlitre μM micromolar x Reference References Abe F, Tateyma M, Shibuya H, Azumi N, Ommura Y (1985) Experimental candidiasis in iron overload Mycopathologia 89(1):59-63 Arnold RR, Cole MF, McGhee JR A bactericidal effect for human lactoferrin (1977) Science 197(4300):263-265 Askwith C, Eide D, Van Ho A, Bernard PS, Li L, Davis-Kaplan S, Sipe DM, Kaplan J (1994) The FET3 gene of S cerevisiae encodes a multicopper oxidase required for ferrous iron uptake Cell 76(2):403-410 Askwith C, Kaplan J (1998) Iron and copper transport in yeast and its relevance to human disease Trends Biochem Sci 23(4):135-138 Askwith CC, de Silva D, Kaplan J (1996) Molecular biology of iron acquisition in Saccharomyces cerevisiae Mol Microbiol 20(1):27-34 Babst, M., Sato, T K., Banta, L M and Emr, S D (1997) Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p EMBO J 16, 1820–1831 Bai C, Chan FY, Wang Y (2005) Identification and functional characterization of a novel candida albicans gene CaMNN5 that suppresses the iron-dependent growth defect of Saccharomyces cerevisiae aft1Delta mutant Biochem J 389:27-35 Ballou, C E (1990) Isolation, characterization and properties of Saccharomyces mnn mutants with non-conditional protein glycosylation defects Methods Enzymol 185:440-476 Ballou, L., R E Cohen, and C E Ballou (1980) Saccharomyces cerevisiae mannoprotein mutants that make mannoproteins with a truncated outer chain J Biol Chem 255:5986-5991 Barlow AJ, Aldersley T, Chattaway FW (1974) Factors present in serum and seminal plasma which promote germ-tube formation and mycelial growth of Candida albicans J Gen Microbiol 82(2):261-272 Bates S, Maccallum DM, Bertram G, Munro CA, Hughes HB, Buurman ET, Brown AJ, Odds FC, Gow NA (2005) Candida albicans Pmr1p, a Secretory Pathway P-type Ca2+/Mn2+-ATPase, Is Required for Glycosylation and Virulence J Biol Chem 280: 23408-23415 Becherer, K A., Rieder, S E., Emr, S D and Jones, E W (1996) Novel syntaxin homolog, Pep12p, required for the sorting of lumenal hydrolases to the lysosome-like vacuole in yeast Mol Biol Cell 7, 579–594 Beck-Sague C, Jarvis WR (1993) Secular trends in the epidemiology of nosocomial fungal infections in the United States, 1980-1990 National Nosocomial Infections Surveillance System J Infect Dis 167: 1247-1251 Bergeron RJ, Elliott GT, Kline SJ, Ramphal R, St James L 3rd (1983) Bacteriostatic and fungostatic action of catecholamide iron chelators Antimicrob Agents Chemother 24:725-30 Bezkorovainy A (1981) Antimicrobial properties of iron-binding proteins Adv Exp Med Biol 135:139-154 Birse CE, Irwin MY, Fonzi WA, Sypherd PS (1993) Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans Infect Immun 61, 3648-3655 98 Reference Blaiseau PL, Lesuisse E, Camadro JM (2001) Aft2p, a novel iron-regulated transcription activator that modulates, with Aft1p, intracellular iron use and resistance to oxidative stress in yeast J Biol Chem 276: 34221-34226 Bockmuhl DP, Krishnamurthy S, Gerads M, Sonneborn A, Ernst JF (2001) Distinct and redundant roles of the two protein kinase A isoforms Tpk1p and Tpk2p in morphogenesis and growth of Candida albicans Mol Microbiol 42, 1243-1257 Boken DJ, Swindells S, Rinaldi MG (1993) Fluconazole-resistant Candida albicans Clin Infect Dis 17: 1018-1021 Braun BR, Head WS, Wang MX, Johnson AD (2000a) Identification and characterization of TUP1-regulated genes in Candida albicans Genetics 156, 31-44 Braun BR, Johnson AD (1997) Control of filament formation in Candida albicans by the transcriptional repressor TUP1 Science 277: 105-109 Braun BR, Johnson AD (2000b) TUP1, CPH1 and EFG1 make independent contributions to filamentation in candida albicans Genetics 155: 57-67 Braun BR, Kadosh D, Johnson AD (2001) NRG1, a repressor of filamentous growth in C albicans, is down-regulated during filament induction EMBO J 20, 4753-4761 Brock, J (1995) Lactoferrin: a multifunctional immunoregulatory protein? Immunol Today 16, 417–419 Brown AJ, Gow NA (1999) Regulatory networks controlling Candida albicans morphogenesis Trends Microbiol 7: 333-338 Brown DH Jr, Giusani AD, Chen X, Kumamoto CA (1999) Filamentous growth of Candida albicans in response to physical environmental cues and its regulation by the unique CZF1 gene Mol Microbiol 34: 651-662 Buffo J, Herman MA, Soll DR (1984) A characterization of pH-regulated dimorphism in Candida albicans Mycopathologia 85: 21-30 Bullen JJ, Cushnie GH, Rogers HJ (1967) The abolition of the protective effect of Clostridium welchii type A antiserum by ferric iron Immunology 12: 303-312 Bullen JJ, Rogers HJ, Griffiths E (1972) Iron binding proteins and infection Br J Haematol 23: 389-392 Bullen JJ, Rogers HJ, Lewin JE (1971) The bacteriostatic effect of serum on Pasteurella septica and its abolition by iron compounds Immunology 20: 391-406 Bullen JJ, Ward CG, Wallis SN (1974) Virulence and the role of iron in Pseudomonas aeruginosa infection Infect Immun 10: 443-450 Bullen, J J (1981) The significance of iron in infection Rev Infect Dis 3: 1127-1138 Burda, P., and M Aebi (1999) The dolichol pathway of N-linked glycosylation Biochim Biophys Acta 1426: 239-257 Buurman, E T., C Westwater, B Hube, A J Brown, F C Odds, and N A Gow (1998) Molecular analysis of CaMnt1p, a mannosyl transferase important for adhesion and virulence of Candida albicans Proc Natl Acad Sci USA 95:7670-7675 Byers BR, Arceneaux JE (1998) Microbial iron transport: iron acquisition by pathogenic microorganisms Met Ions Biol 35: 37-66 Calderone RA, Braun PC (1991) Adherence and receptor relationships of Candida albicans Microbiol Rev 55: 1-20 99 Reference Calderone, R A (1993) Recognition between Candida albicans and host cells Trends Microbiol 1, 55-58 Caroline, L, Taschdjian, C L., Kozinn, P J., Schade, A L (1964) Reversal of serum fungistasis by addition of iron J Invest Dermatol 42: 415-419 Casanova M, Cervera AM, Gozalbo D, Martinez JP (1997) Hemin induces germ tube formation in Candida albicans Infect Immun 65: 4360-4364 Casanova, M., J L Lopez-Ribot, C Monteagudo, A Llombart-Bosch, R Sentandreu, and J P Martinez (1992) Identification of a 58-kilodalton cell surface fibrinogen-binding mannoprotein from Candida albicans Infect Immun 60:4221-4229 Chen OS, Crisp RJ, Valachovic M, Bard M, Winge DR, Kaplan J (2004) Transcription of the yeast iron regulon does not respond directly to iron but rather to iron-sulfur cluster biosynthesis J Biol Chem 279: 29513-29518 Chen XZ, Peng JB, Cohen A, Nelson H, Nelson N, Hediger MA (1999) Yeast SMF1 mediates H(+)-coupled iron uptake with concomitant uncoupled cation currents J Biol Chem 274: 35089-35094 Cohen, R E., Ballou, L., and Ballou, C E (1980) Saccharomyces cerevisiae mannoprotein mutants Isolation of the mnn5 mutant and comparison with the mnn3 strain J Biol Chem 255, 7700-7707 Cormack, B P., G Bertram, M Egerton, N A Gow, S Falkow, and A J Brown (1997) Yeast-enhanced green fluorescent protein (yEGFP), a reporter of gene expression in Candida albicans Microbiology 143:303–311 Crane FL, Roberts H, Linnane AW, Low H (1982) Transmembrane ferricyanide reduction by cells of the yeast Saccharomyces cerevisiae J Bioenerg Biomembr 14: 191-205 Crichton RR, Charloteaux-Wauters M (1987) Iron transport and storage Eur J Biochem 164: 485-506 Crisp RJ, Pollington A, Galea C, Jaron S, Yamaguchi-Iwai Y, Kaplan J (2003) Inhibition of heme biosynthesis prevents transcription of iron uptake genes in yeast J Biol Chem 278:45499-45506 Csank C, Makris C, Meloche S, Schroppel K, Rollinghoff M, Dignard D, Thomas DY, Whiteway M (1997) Derepressed hyphal growth and reduced virulence in a VH1 family-related protein phosphatase mutant of the human pathogen Candida albicans Mol Biol Cell 8: 2539-2551 Csank C, Schroppel K, Leberer E, Harcus D, Mohamed O, Meloche S, Thomas DY, Whiteway M (1998) Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis Infect Immun 66: 2713-2721 Cutler JE (1991) Putative virulence factors of Candida albicans Annu Rev Microbiol 45:187-218 Dancis A, Klausner RD, Hinnebusch AG, Barriocanal JG (1990) Genetic evidence that ferric reductase is required for iron uptake in Saccharomyces cerevisiae Mol Cell Biol 10: 2294-2301 Dancis A, Roman DG, Anderson GJ, Hinnebusch AG, Klausner RD (1992) Ferric reductase of Saccharomyces cerevisiae: molecular characterization, role in iron uptake, and transcriptional control by iron Proc Natl Acad Sci USA 89: 3869-3873 Dancis A, Yuan DS, Haile D, Askwith C, Eide D, Moehle C, Kaplan J, Klausner RD (1994) Molecular characterization of a copper transport protein in S cerevisiae: an unexpected role for copper in iron transport Cell 76: 393-402 100 Reference De Silva DM, Askwith CC, Eide D, Kaplan J (1995) The FET3 gene product required for high affinity iron transport in yeast is a cell surface ferroxidase J Biol Chem 270: 1098-1101 de Silva DM, Askwith CC, Kaplan J (1996) Molecular mechanisms of iron uptake in eukaryotes Physiol Rev 76: 31-47 Dean, N (1999) Asparagine-linked glycosylation in the yeast Golgi Biochim Biophys Acta 1426, 309-322 Dix DR, Bridgham JT, Broderius MA, Byersdorfer CA, Eide DJ (1994) The FET4 gene encodes the low affinity Fe(II) transport protein of Saccharomyces cerevisiae J Biol Chem 269: 26092-26099 Eck R, Hundt S, Hartl A, Roemer E, Kunkel W (1999) A multicopper oxidase gene from Candida albicans: cloning, characterization and disruption Microbiology 145: 24152422 Eide D, Davis-Kaplan S, Jordan I, Sipe D, Kaplan J (1992) Regulation of iron uptake in Saccharomyces cerevisiae The ferrireductase and Fe(II) transporter are regulated independently J Biol Chem 267: 20774-20781 Emery T (1980) Iron deprivation as a biological defence mechanism Nature 287: 776-777 Esterly NB, Brammer SR, Crounse RG (1967) The relationship of transferrin and iron to serum inhibition of Candida albicans J Invest Dermatol 49: 437-442 Fang, H M and Wang, Y (2002) Characterization of iron-binding motifs in Candida albicans high-affinity iron permease CaFtr1p by site-directed mutagenesis Biochem J 368, 641–647 Feeny R E , Nagy, D A (1952) The antibacterial activity of the egg white protein conalbumin J Bacteriol 64: 629-643 Fonzi WA (1999) PHR1 and PHR2 of Candida albicans encode putative glycosidases required for proper cross-linking of beta-1,3- and beta-1,6-glucans J Bacteriol 181: 7070-7079 Fonzi, W A., and Irwin, M Y (1993) Isogenic strain construction and gene mapping in Candida albicans Genetics 134, 717-728 Forbes JR, Gros P (2001) Divalent-metal transport by NRAMP proteins at the interface of host-pathogen interactions Trends Microbiol 9: 397-403 Foury F, Talibi D (2001) Mitochondrial control of iron homeostasis A genome wide analysis of gene expression in a yeast frataxin-deficient strain J Biol Chem 276:7762-7768 Frangioni JV, Neel BG (1993) Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins Anal Biochem 210: 179-187 Fu Y, Ibrahim AS, Sheppard DC, Chen YC, French SW, Cutler JE, Filler SG, Edwards JE Jr (2002) Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway Mol Microbiol 44: 61-72 Fu, Y (1998) Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces adherence to endothelial and epithelial cells Infect Immun 66, 1783–1786 Gale C, Finkel D, Tao N, Meinke M, McClellan M, Olson J, Kendrick K, Hostetter M (1996) Cloning and expression of a gene encoding an integrin-like protein in Candida albicans Proc Natl Acad Sci U S A 93: 357-361 101 Reference Gale CA, Bendel CM, McClellan M, Hauser M, Becker JM, Berman J, Hostetter MK (1998) Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1 Science 279: 1355-1358 Gaur, N.K (1999) Overexpression of the Candida albicans ALA1 gene in Saccharomyces cerevisiae results in aggregation following attachment of yeast cells to extracellular matrix proteins, adherence properties similar to Candida albicans Infect Immun 67, 6040–6047 Gaur, N.K and Klotz, S.A (1997) Expression, cloning and characterization of a Candida albicans ALA1, that confers adherence properties upon Saccharomyces cerevisiae for extracellular matrix proteins Infect Immun 65, 5289–5294 Gemmill, T R., and R B Trimble (1999) Overview of N- and O-linked oligosaccharide structures found in various yeast species Biochim Biophys Acta 1426:227-237 Georgatsou E, Alexandraki D (1994) Two distinctly regulated genes are required for ferric reduction, the first step of iron uptake in Saccharomyces cerevisiae Mol Cell Biol 14: 3065-3073 Gilmore BJ, Retsinas EM, Lorenz JS, Hostetter MK (1988) An iC3b receptor on Candida albicans: structure, function, and correlates for pathogenicity J Infect Dis 157: 3846 Guerinot ML, Yi Y (1994) Iron: Nutritious, Noxious, and Not Readily Available Plant Physiol 104: 815-820 Hammacott JE, Williams PH, Cashmore AM (2000) Candida albicans CFL1 encodes a functional ferric reductase activity that can rescue a Saccharomyces cerevisiae fre1 mutant Microbiology 146: 869-876 Haselbeck, A., and W Tanner (1983) O-glycosylation in Saccharomyces cerevisiae is initiated at the endoplasmic reticulum FEBS Lett 158:335-338 Hassett RF, Yuan DS, Kosman DJ (1998) Spectral and kinetic properties of the Fet3 protein from Saccharomyces cerevisiae, a multinuclear copper ferroxidase enzyme J Biol Chem 273: 23274-23282 Herrero, A B., Daniela Uccelletti, Carlos B Hirschberg, Angel Dominguez, and Claudia Abeijon (2002) The Golgi GDPase of the Fungal Pathogen Candida albicans Affects Morphogenesis, Glycosylation, and Cell Wall Properties Eukaryotic Cell 1, 420-431 Heymann, P., Ernst, , J.F., and Winkelmann, , G (2000a) A gene of the major facilitator superfamily encodes a transporter for enterobactin (Enb1p) in Saccharomyces cerevisiae Biometals 13: 65-72 Heymann, P., Ernst, , J.F., and Winkelmann, G (1999) Identification of a fungal triacetylfusarinine C siderophore transport gene (TAF1) in Saccharomyces cerevisiae as a member of the major facilitator superfamily Biometals 12: 301-306 Heymann, P., Ernst, , J.F., and Winkelmann, G (2000b) Identification and substrate specificity of a ferrichrome-type siderophore transporter (Arn1p) in Saccharomyces cerevisiae FEMS Microbiol Lett 186: 221-227 Hill, H A O (1982) The biological chemistry of iron (Dunford, H B., Dolphin, D., Raymond, K N and Seiker, L., Eds.) pp 1-12 Reidel, Dordrecht Hobson RP, Munro CA, Bates S, MacCallum DM, Cutler JE, Heinsbroek SE, Brown GD, Odds FC, Gow NA (2004) Loss of cell wall mannosylphosphate in Candida albicans does not influence macrophage recognition J Biol Chem 279: 3962839635 102 Reference Hoek, K S., J M Milne, P A Grieve, D A Dionysius, and R Smith (1997) Antibacterial activity in bovine lactoferrin-derived peptides Antimicrob Agents Chemother 41: 54-59 Hu CJ, Bai C, Zheng XD, Wang YM, Wang Y (2002) Characterization and functional analysis of the siderophore-iron transporter CaArn1p in Candida albicans J Biol Chem 277: 30598-30605 Hull CM, Johnson AD (1999) Identification of a mating type-like locus in the asexual pathogenic yeast Candida albicans Science 285: 1271-1215 Hull CM, Raisner RM, Johnson AD (2000) Evidence for mating of the "asexual" yeast Candida albicans in a mammalian host Science 289: 307-310 Ibrahim AS, Mirbod F, Filler SG, Banno Y, Cole GT, Kitajima Y, Edwards JE Jr, Nozawa Y, Ghannoum MA (1995) Evidence implicating phospholipase as a virulence factor of Candida albicans Infect Immun 63: 1993-1998 Ismail A, Bedell GW (1986) Effect of elevated temperatures and low levels of trace metals on the growth and phenotypic development of Candida albicans Mycopathologia 94:45-51 Ismail A, Bedell GW, Lupan DM (1985) Siderophore production by the pathogenic yeast, Candida albicans Biochem Biophys Res Commun 130:885-891 Jackson, S and Morris, B C (1961) Enhancement of growth of Pasteurella pestis and other bacteria in serum by the addition of iron Brit J Exp Med 42: 363-368 Janbon G, Sherman F, Rustchenko E (1998) Monosomy of a specific chromosome determines L-sorbose utilization: a novel regulatory mechanism in Candida albicans Proc Natl Acad Sci USA 95: 5150-5155 Kadosh D, Johnson AD (2001) Rfg1, a protein related to the Saccharomyces cerevisiae hypoxic regulator Rox1, controls filamentous growth and virulence in Candida albicans Mol Cell Biol 2001 21, 2496-2505 Karlin KD (1993) Metalloenzymes, structural motifs, and inorganic models Science 261: 701-708 Kaufman RJ, Swaroop M, Murtha-Riel P (1994) Depletion of manganese within the secretory pathway inhibits O-linked glycosylation in mammalian cells Biochemistry 3: 9813-9819 Khalaf RA, Zitomer RS (2001) The DNA binding protein Rfg1 is a repressor of filamentation in Candida albicans Genetics 157, 1503-1512 King RD, Khan HA, Foye JC, Greenberg JH, Jones HE (1975) Transferrin, iron, and dermatophytes I Serum dematophyte inhibitory component definitively identified as unsaturated transferrin J Lab Clin Med 86: 204-212 Kispal G, Csere P, Prohl C, Lill R (1999) The mitochondrial proteins Atm1p and Nfs1p are essential for biogenesis of cytosolic Fe/S proteins EMBO J 18: 3981-3989 Kleene R, Berger EG (1993) The molecular and cell biology of glycosyltransferases Biochim Biophys Acta 1154: 283-325 Klis, F M., de Groot, P., and Hellingwerf, K (2001) Molecular organization of the cell wall of Candida albicans Med Mycol 39, Suppl 1, 1-8 Knauer, R., and Lehle, L (1999) The oligosaccharyltransferase complex from yeast Biochim Biophys Acta 1426, 259-273 103 Reference Kobayashi SD, Cutler JE (1998) Candida albicans hyphal formation and virulence: is there a clearly defined role? Trends Microbiol 6: 92-94 Kohler JR, Fink GR (1996) Candida albicans strains heterozygous and homozygous for mutations in mitogen-activated protein kinase signaling components have defects in hyphal development Proc Natl Acad Sci U S A 93: 13223-13228 Kosman DJ (2003) Molecular mechanisms of iron uptake in fungi Mol Microbiol 47: 1185-1197 Kuipers ME, de Vries HG, Eikelboom MC, Meijer DK, Swart PJ (1999) Synergistic fungistatic effects of lactoferrin in combination with antifungal drugs against clinical Candida isolates Antimicrob Agents Chemother 43: 2635-2641 Leberer E, Harcus D, Broadbent ID, Clark KL, Dignard D, Ziegelbauer K, Schmidt A, Gow NA, Brown AJ, Thomas DY (1996) Signal transduction through homologs of the Ste20p and Ste7p protein kinases can trigger hyphal formation in the pathogenic fungus Candida albicans Proc Natl Acad Sci U S A 93: 13217-13222 Leberer E, Ziegelbauer K, Schmidt A, Harcus D, Dignard D, Ash J, Johnson L, Thomas DY (1997) Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p Curr Biol 7: 539-546 Lee BC (1995) Quelling the red menace: haem capture by bacteria Mol Microbiol 18:383390 Lesuisse E, Labbe P (1989) Reductive and non-reductive mechanisms of iron assimilation by the yeast Saccharomyces cerevisiae J Gen Microbiol 135:.257-263 Lesuisse E, Raguzzi F, Crichton RR (1987) Iron uptake by the yeast Saccharomyces cerevisiae: involvement of a reduction step J Gen Microbiol 133: 3229-3236 Lesuisse, E., Blaiseau, P.L., Dancis, A., and Camadro, , J M (2001) Siderophore uptake and use by the yeast Saccharomyces cerevisiae Microbiol 147: 289-298 Lesuisse, E., Simon-Casteras, M., and Labbe, P (1998) Siderophore-mediated iron uptake in Saccharomyces cerevisiae: the SIT1 gene encodes a ferrioxamine B permease that belongs to the major facilitator superfamily Microbiol 144: 3455-3462 Li L, Chen OS, McVey Ward D, Kaplan J (2001) CCC1 is a transporter that mediates vacuolar iron storage in yeast J Biol Chem 276: 29515-29519 Li L, Kaplan J (1998) Defects in the yeast high affinity iron transport system result in increased metal sensitivity because of the increased expression of transporters with a broad transition metal specificity J Biol Chem 273: 22181-22187 Li L, Kaplan J (2004) A mitochondrial-vacuolar signaling pathway in yeast that affects iron and copper metabolism J Biol Chem 279: 33653-33661 Li L, Vulpe CD, Kaplan J (2003) Functional studies of hephaestin in yeast: evidence for multicopper oxidase activity in the endocytic pathway Biochem J 375: 793-798 Lin SJ, Culotta VC (1995) The ATX1 gene of Saccharomyces cerevisiae encodes a small metal homeostasis factor that protects cells against reactive oxygen toxicity Proc Natl Acad Sci U S A 92: 3784-3788 Lin SJ, Pufahl RA, Dancis A, O'Halloran TV, Culotta VC (1997) A role for the Saccharomyces cerevisiae ATX1 gene in copper trafficking and iron transport J Biol Chem 272: 9215-9220 Liu H, Kohler J, Fink GR (1994) Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog Science 266: 1723-1726 104 Reference Lo, H J., J R Kohler, B DiDomenico, D Loebenberg, A Cacciapuoti, and G R Fink (1997) Nonfilamentous Candida albicans mutants are avirulent Cell 90:939-949 Lockhart SR, Pujol C, Daniels KJ, Miller MG, Johnson AD, Pfaller MA, Soll DR (2002) In Candida albicans, white-opaque switchers are homozygous for mating type Genetics 162:737-745 Lupetti A, Paulusma-Annema A, Senesi S, Campa M, Van Dissel JT, Nibbering PH (2002) Internal thiols and reactive oxygen species in candidacidal activity exerted by an Nterminal peptide of human lactoferrin Antimicrob Agents Chemother 46: 16341639 Lussier, M., A M Sdicu, S Shahinian, and H Bussey (1998) The Candida albicans KRE9 gene is required for cell wall beta-1, 6-glucan synthesis and is essential for growth on glucose Proc Natl Acad Sci USA 95:9825-9830 Lussier, M., Sdicu, A M., and Bussey, H (1999) The KTR and MNN1 mannosyltransferase families of Saccharomyces cerevisiae Biochim Biophys Acta 1426, 323-334 Magee BB, Magee PT (2000) Induction of mating in Candida albicans by construction of MTLa and MTLalpha strains Science 289: 310-313 Malathi K, Ganesan K, Datta A (1994) Identification of a putative transcription factor in Candida albicans that can complement the mating defect of Saccharomyces cerevisiae ste12 mutants J Biol Chem 269: 22945-22951 Manns JM, Mosser DM, Buckley HR (1994) Production of a hemolytic factor by Candida albicans Infect Immun 62: 5154-5156 Martin, C M., Jandl, J.H and Finland, M (1963) Enhancement of acute bacterial infections in rats and mice by iron and their inhibition by human transferrin J Infect Dis 112, 158-163 Masuoka, J., and K C Hazen (1999) Differences in the acid-labile component of Candida albicans mannan from hydrophobic and hydrophilic yeast cells Glycobiology 9:1281-1286 Mencacci A, Cenci E, Boelaert JR, Bucci P, Mosci P, Fe d'Ostiani C, Bistoni F, Romani L (1997) Iron overload alters innate and T helper cell responses to Candida albicans in mice J Infect Dis 175: 1467-1476 Miller MG, Johnson AD (2002) White-opaque switching in Candida albicans is controlled by mating-type locus homeodomain proteins and allows efficient mating Cell 110: 293-302 Mitchell AP (1998) Dimorphism and virulence in Candida albicans Curr Opin Microbiol 1: 687-692 Moors, M.A., Stull, T.L., Blank, K.J., Buckley, H.R., and Mosser, D.M (1992) A role for complement receptor-like molecules in iron acquisition by Candida albicans J Exp Med 175: 1643–1651 Munno CA, Bates S, Buurman ET, Hughes HB, Maccallum DM, Bertram G, Atrih A, Ferguson MA, Bain JM, Brand A, Hamilton S, Westwater C, Thomson LM, Brown AJ, Odds FC, Gow NA (2005) Mnt1p and Mnt2p of Candida albicans are partially redundant alpha-1,2-mannosyltransferases that participate in O-linked mannosylation and are required for adhesion and virulence J Biol Chem 280:1051-1060 Nakayama K, Nagasu T, Shimma Y, Kuromitsu J, Jigami Y (1992) OCH1 encodes a novel membrane bound mannosyltransferase: outer chain elongation of asparagine-linked oligosaccharides EMBO J 11:2511-2519 105 Reference Nishikawa A, Poster JB, Jigami Y, Dean N (2002) Molecular and phenotypic analysis of CaVRG4, encoding an essential Golgi apparatus GDP-mannose transporter J Bacteriol 184: 29-42 Odani, T., Y Shimma, X H Wang, and Y Jigami (1997) Mannosylphosphate transfer to cell wall mannan is regulated by the transcriptional level of the MNN4 gene in Saccharomyces cerevisiae FEBS Lett 420:186-190 Odds, F C (1996) Resistance of clinically important yeasts to antifungal agents Int J Antimicrob Agents 6, 145-147 Odds, F C (1993) Resistance of yeasts to azole-derivative antifungals J Antimicrob Chemother 31:463-471 Odds, F C (Ed.,) (1988) Candida and Candidosis Bailliere Tindall, London Osaki S, Johnson DA, Frieden E (1966) The possible significance of the ferrous oxidase activity of ceruloplasmin in normal human serum J Biol Chem 241: 2746-2751 Otto BR, Verweij-van Vught AM, MacLaren DM (1992) Transferrins and heme-compounds as iron sources for pathogenic bacteria Crit Rev Microbiol.18: 217-233 Pan X, Harashima T, Heitman J (2000) Signal transduction cascades regulating pseudohyphal differentiation of Saccharomyces cerevisiae Curr Opin Microbiol 3, 567-72 Pendrak ML, Chao MP, Yan SS, Roberts DD (2004) Heme oxygenase in Candida albicans is regulated by hemoglobin and is necessary for metabolism of exogenous heme and hemoglobin to alpha-biliverdin J Biol Chem 279: 3426-3433 Perepnikhatka V, Fischer FJ, Niimi M, Baker RA, Cannon RD, Wang YK, Sherman F, Rustchenko E (1999) Specific chromosome alterations in fluconazole-resistant mutants of Candida albicans J.Bacteriol 181(13): 4041-4049 Pinner E, Gruenheid S, Raymond M, Gros P (1997) Functional complementation of the yeast divalent cation transporter family SMF by NRAMP2, a member of the mammalian natural resistance-associated macrophage protein family J Biol Chem 272: 28933-28938 Portnoy ME, Liu XF, Culotta VC (2000) Saccharomyces cerevisiae expresses three functionally distinct homologues of the nramp family of metal transporters Mol Cell Biol 20: 7893-7902 Prill, SK, Klinkert B, Timpel C, Gale CA, Schroppel K, Ernst JF (2005) PMT family of Candida albicans: five protein mannosyltransferase isoforms affect growth, morphogenesis and antifungal resistance Mol Microbiol 55: 546-560 Puschmann M, Ganzoni AM (1977) Increased resistance of iron-deficient mice to salmonella infection Infect Immun 17: 663-664 Rabkin JM, Oroloff SL, Corless CL, Benner KG, Flora KD, Rosen HR, Olyaei AJ (2000) Association of fungal infection and increased mortality in liver transplant recipients Am J Surg 179:426-430 Raguzzi F, Lesuisse E, Crichton RR (1988) Iron storage in Saccharomyces cerevisiae FEBS Lett 231: 253-258 Ramanan N, Wang Y (2000) A high-affinity iron permease essential for Candida albicans virulence Science 288: 1062-1064 Rayner JC, Munro S (1998) Identification of the MNN2 and MNN5 mannosyltransferases required for forming and extending the mannose branches of the outer chain mannans of Saccharomyces cerevisiae J Biol Chem 273: 26836-26843 106 Reference Richards MJ, Edwards JR, Culver DH, Gaynes RP (1999) Nosocomial infections in medical intensive care units in the United States National Nosocomial Infections Surveillance System Crit Care Med 27: 887-8892 Richardson MD (1991) Opportunistic and pathogenic fungi J Antimicrob Chemother 28:1-11 Riggle PJ, Andrutis KA, Chen X, Tzipori SR, Kumamoto CA (1999) Invasive lesions containing filamentous forms produced by a Candida albicans mutant that is defective in filamentous growth in culture Infect Immun 67: 3649-3652 Rocha CR, Schroppel K, Harcus D, Marcil A, Dignard D, Taylor BN, Thomas DY, Whiteway M, Leberer E (2001) Signaling through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic fungus Candida albicans Mol Biol Cell 12, 3631-3643 Roth FJ Jr, Boyd CC, Sagami S, Blank H (1959) An evaluation of the fungistatic activity of serum J Invest Dermatol 32: 549-556 Rouabhia M, Schaller M, Corbucci C, Vecchiarelli A, Prill SK, Giasson L, Ernst JF (2005) Virulence of the Fungal Pathogen Candida albicans Requires the Five Isoforms of Protein Mannosyltransferases Infect Immun 73: 4571-4580 Rouault TA, Tong WH (2005) Iron-sulphur cluster biogenesis and mitochondrial iron homeostasis Nat Rev Mol Cell Biol 6: 345-351 Rubin, G (1973) The Nucleotide Sequence of Saccharomyces cerevisiae 5.8 S Ribosomal Ribonucleic Acid J Biol Chem 248, 3860-3875 Ruhnke M (2004) Mucosal and systemic fungal infections in patients with AIDS: prophylaxis and treatment Drugs 64: 1163-1180 Rutherford JC, Jaron S, Ray E, Brown PO, Winge DR (2001) A second iron-regulatory system in yeast independent of Aft1p Proc Natl Acad Sci U S A 98: 1432214327 Sanchez L, Calvo M, Brock JH (1992) Biological role of lactoferrin Arch Dis Child 67: 657-661 Sanglard D, Kuchler K, Ischer F, Pagani JL, Monod M, Bille J (1995) Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters Antimicrob Agents Chemother 39: 23782386 Santos R, Buisson N, Knight S, Dancis A, Camadro JM, Lesuisse E (2003) Haemin uptake and use as an iron source by Candida albicans: role of CaHMX1-encoded haem oxygenase Microbiology 149(Pt 3):579-88 Schade, A.L and Caroline, L (1944) Raw agg white and the role of iron in the growth inhibiton of Shigella dysenteriae, Staphylococcus aureus, Escherischia coli, and Saccharomyces cerevisiae Science 100: 14-15 Schade, A.L and Caroline, L (1946) An iron-binding compenent in human blood plasma Science 104: 340-341 Schaible UE, Kaufmann SH (2004) Iron and microbial infection Nat Rev Microbiol 2: 946-953 Schaller M, Korting HC, Schafer W, Bastert J, Chen W, Hube B (1999) Secreted aspartic proteinase (Sap) activity contributes to tissue damage in a model of human oral candidosis Mol Microbiol 34: 169-180 107 Reference Schaller M, Schackert C, Korting HC, Januschke E, Hube B (2000) Invasion of Candida albicans correlates with expression of secreted aspartic proteinases during experimental infection of human epidermis J Invest Dermatol 114:712-717 Schaller M, Schafer W, Korting HC, Hube B (1998) Differential expression of secreted aspartyl proteinases in a model of human oral candidosis and in patient samples from the oral cavity Mol Microbiol 29: 605-615 Sharkey, L L., M D McNemar, S M Saporito-Irwin, P S Sypherd, and W A Fonzi (1999) HWP1 functions in the morphological development of Candida albicans downstream of EFG1, TUP1, and RBF1 J Bacteriol 181, 5273-5279 Shepherd MG, Yin CY, Ram SP, Sullivan PA (1980) Germ tube induction in Candida albicans Can J Microbiol 26: 21-26 Sikorski,R.S and Hieter,P (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae Genetics 122, 19-27 Silva, M and Buckley, H R (1962) Activity of egg white against fungi pathogenic to man Chapter XIX In: Fungi and Fungous Diseases Ed G Dalldorf, Springfield, III Charles C Thomas Simonetti N, Strippoli V, Cassone A (1974) Yeast-mycelial conversion induced by Nacetyl-D-glucosamine in Candida albicans Nature 250: 344-346 Smith RL, Johnson AD (2000) Turning genes off by Ssn6-Tup1: a conserved system of transcriptional repression in eukaryotes Trends Biochem Sci 25, 325-330 Sobel JD, Muller G, Buckley HR (1984) Critical role of germ tube formation in the pathogenesis of candidal vaginitis Infect Immun 44: 576-580 Soll DR, Langtimm CJ, McDowell J, Hicks J, Galask R (1987) High-frequency switching in Candida strains isolated from vaginitis patients J Clin Microbiol 25: 1611-1622 Sonneborn A, Bockmuhl DP, Gerads M, Kurpanek K, Sanglard D, Ernst JF (2000) Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans Mol Microbiol 35, 386-396 Soukka T, Tenovuo J, Lenander-Lumikari M (1992) Fungicidal effect of human lactoferrin against Candida albicans FEMS Microbiol Lett 69: 223-228 Southard SB, Specht CA, Mishra C, Chen-Weiner J, Robbins PW (1999) Molecular analysis of the Candida albicans homolog of Saccharomyces cerevisiae MNN9, required for glycosylation of cell wall mannoproteins J Bacteriol 181: 7439-7448 Spiro, T G and Saltman, P (1974) Inorganic chemistry In Iron in Biochemistry and Medicine Jacobs, A and Worwood, M (eds) New York: Academic Press, pp 1-28 Spizzo T, Byersdorfer C, Duesterhoeft S, Eide D (1997) The yeast FET5 gene encodes a FET3-related multicopper oxidase implicated in iron transport Mol Gen Genet 256: 547-556 Staab JF, Bradway SD, Fidel PL, Sundstrom P (1999) Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1 Science 283, 15351538 Staab JF, Sundstrom P (1998) Genetic organization and sequence analysis of the hyphaspecific cell wall protein gene HWP1 of Candida albicans Yeast 14, 681-6 Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner RD, Dancis A (1996) A permeaseoxidase complex involved in high-affinity iron uptake in yeast Science 271: 15521557 108 Reference Stoldt VR, Sonneborn A, Leuker CE, Ernst JF (1997) Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi EMBO J 16, 1982-1991 Strahl-Bolsinger, S., Gentzsch, M., and Tanner, W (1999) Protein O-mannosylation Biochim Biophys Acta 1426, 297-307 Sundstrom, P (1999) Adhesins in Candida albicans Curr Opin Microbiol 2:353-357 Sundstrom, P (2002) Adhesion in Candida spp Cell Microbiol 4, 461-469 Sweet SP, Douglas LJ (1991) Effect of iron concentration on siderophore synthesis and pigment production by Candida albicans FEMS Microbiol Lett 64: 87-91 Sword CP (1966) Mechanisms of pathogenesis in Listeria monocytogenes infection I Influence of iron J Bacteriol 92: 536-542 Szilagyi G, Reiss F, Smith JC (1966) The anticryptococcal factor of blood serum A preliminary report J Invest Dermatol 46: 306-308 Tanaka WT, Nakao N, Mikami T, Matsumoto T (1997) Hemoglobin is utilized by Candida albicans in the hyphal form but not yeast form Biochem Biophys Res Commun 232:350-353 Timpel, C., S Strahl-Bolsinger, K Ziegelbauer, and J F Ernst (1998) Multiple functions of Pmt1p-mediated protein O-mannosylation in the fungal pathogen Candida albicans J Biol Chem 273:20837-20846 Timpel, C., S Zink, S Strahl-Bolsinger, K Schroppel, and J Ernst (2000) Morphogenesis, adhesive properties, and antifungal resistance depend on the Pmt6 protein mannosyltransferase in the fungal pathogen Candida albicans J Bacteriol 182:3063-3071 Tkacz JS, Herscovics A, Warren CD, Jeanloz RW (1974) Mannosyltransferase activity in calf pancreas microsomes Formation from guanosine diphosphate-D-(14C)mannose of a 14C-labeled mannolipid with properties of dolichyl mannopyranosyl phosphate J Biol Chem 249: 6372-6381 Tomita, M., Wakabayashi, H., Yamauchi, K., Teraguchi, S & Hayasawa, H (2002) Bovine lactoferrin and lactoferricin derived from milk: production and applications Biochem Cell Biol 80, 109–112 Tomita, M., Wakabayashi, H., Yamauchi, K., Teraguchi, S & Hayasawa, H (2002) Bovine lactoferrin and lactoferricin derived from milk: production and applications Biochem Cell Biol 80, 109–112 Trikha, J., Theil, E C and Allewell, N M (1995) High resolution crystal structures of amphibian red-cell L ferritin: potential roles for structural plasticity and solvation in function J Mol Biol 248, 949–967 Tsai, P K., P Frevert, and C E Ballou (1984) Carbohydrate structure of Saccharomyces cerevisiae mnn9 mannoprotein J Biol Chem 259:3805-3811 Urbanowski JL, Piper RC (1999) The iron transporter Fth1p forms a complex with the Fet5 iron oxidase and resides on the vacuolar membrane J Biol Chem 274: 3806138070 Viejo-Diaz M, Andres MT, Fierro JF (2004) Effects of human lactoferrin on the cytoplasmic membrane of Candida albicans cells related with its candidacidal activity FEMS Immunol Med Microbiol 42: 181-185 109 Reference Vorland, L H (1999) Lactoferrin: a multifunctional glycoprotein APMIS 107, 971–981 Wakabayashi H, Abe S, Okutomi T, Tansho S, Kawase K, Yamaguchi H (1996) Cooperative anti-Candida effects of lactoferrin or its peptides in combination with azole antifungal agents Microbiol Immunol 40: 821-825 Watanabe T, Takano M, Murakami M, Tanaka H, Matsuhisa A, Nakao N, Mikami T, Suzuki M, Matsumoto T (1999) Characterization of a haemolytic factor from Candida albicans Microbiology 145: 689-694 Wang XH, Nakayama K, Shimma Y, Tanaka A, Jigami Y (1997) MNN6, a member of the KRE2/MNT1 family, is the gene for mannosylphosphate transfer in Saccharomyces cerevisiae J Biol Chem 272: 18117-18124 Wang, Y., Li, S P., Moser, S A., Bost, K L., and Domer, J E (1998) Cytokine involvement in immunomodulatory activity affected by Candida albicans mannan Infect Immun 66, 1384-1391 Warit S, Zhang N, Short A, Walmsley RM, Oliver SG, Stateva LI (2000) Glycosylation deficiency phenotypes resulting from depletion of GDP-mannose pyrophosphorylase in two yeast species Mol Microbiol 36: 1156-1166 Watanabe T, Tanaka H, Nakao N, Mikami T, Suzuki M, Matsumoto T (1997) Anti Candida activity of induced transferrin in mice immunized with inactivated Candida albicans Biol Pharm Bull 20: 637-640 Watts HJ, Cheah FS, Hube B, Sanglard D, Gow NA (1998) Altered adherence in strains of Candida albicans harbouring null mutations in secreted aspartic proteinase genes FEMS Microbiol Lett 159: 129-135 Weinberg ED (1966) Roles of metallic ions in host-parasite interactions Bacteriol Rev 30:136-151 Weinberg ED (1978) Iron and infection Microbiol Rev 42: 45-66 Weissman Z, Kornitzer D (2004) A family of Candida cell surface haem-binding proteins involved in haemin and haemoglobin-iron utilization Mol Microbiol 53: 1209-1220 Weissman Z, Shemer R, Kornitzer D (2002) Deletion of the copper transporter CaCCC2 reveals two distinct pathways for iron acquisition in Candida albicans Mol Microbiol 44: 1551-1560 Wiggins CA, Munro S (1998) Activity of the yeast MNN1 alpha-1,3-mannosyltransferase requires a motif conserved in many other families of glycosyltransferases Proc Natl Acad Sci U S A 95: 7945-7950 Wooldridge KG, Williams PH (1993) Iron uptake mechanisms of pathogenic bacteria FEMS Microbiol Rev 12: 325-348 Wosten, M M., Kox, L F., Chamnongpol, S., Soncini, F C and Groisman, E A (2000) A signal transduction system that responds to extracellular iron Cell 103, 113–125 Yamaguchi-Iwai Y, Dancis A, Klausner RD (1995) AFT1: a mediator of iron regulated transcriptional control in Saccharomyces cerevisiae EMBO J 14: 1231-1239 Yamaguchi-Iwai Y, Stearman R, Dancis A, Klausner RD (1996) Iron-regulated DNA binding by the AFT1 protein controls the iron regulon in yeast EMBO J 15: 33773384 Yamaguchi-Iwai Y, Ueta R, Fukunaka A, Sasaki R (2002) Subcellular localization of Aft1 transcription factor responds to iron status in Saccharomyces cerevisiae J Biol Chem 277:18914-18918 110 Reference Yip, C L., S K Welch, F Klebel, T Gilbert, P Seidel, F J Grant, P J O'Hara, and V L MacKay (1994) Cloning and analysis of the S cerevisiae MNN9 and MNN1 genes required for complex glycosylation of secreted proteins Proc Natl Acad Sci USA 91:2723-2727 Yuan DS, Dancis A, Klausner RD (1997) Restriction of copper export in Saccharomyces cerevisiae to a late Golgi or post-Golgi compartment in the secretory pathway J Biol Chem 272: 25787-25793 Yuan DS, Stearman R, Dancis A, Dunn T, Beeler T, Klausner RD (1995) The Menkes/Wilson disease gene homologue in yeast provides copper to a ceruloplasmin-like oxidase required for iron uptake Proc Natl Acad Sci U S A 92: 2632-2636 Yun, C W., Ferea, T., Rashford, J., Ardon, O., Brown, P.O., Botstein, D., (2000a) Desferrioxamine-mediated iron uptake in Saccharomyces cerevisiae Evidence for two pathways of iron uptake J Biol Chem 275: 10709-10715 Yun, C W., Tiedeman, J., Moore, R.E., and Philpott, C C (2000b) Siderophore-iron uptake in Saccharomyces cerevisiae Identification of ferrichrome and fusarinine transporters J Biol Chem 275: 16354-16359 Zahn, R., Stevenson, B J., Schroder-Kohne, S., Zanolari, B., Riezman, H and Munn, A L (2001) End13p/Vps4p is required for efficient transport from early to late endosomes in Saccharomyces cerevisiae J Cell Sci 114, 1935–1947 Zheng, X., Wang, Y., Wang, Y (2004) Hgc1, a novel hypha-specific G1 cyclin-related protein regulates Candida albicans hyphal morphogenesis EMBO J 23:1845-1856 111 Publications PUBLICATIONS Bai C, Xu XL, Chan FY, Lee TH, Wang Y (2006) CaMNN5 encodes an ironregulated α-1, 2-mannosyltransferase important for protein glycosylation, cell wall integrity, morphogenesis and virulence in Candida albicans Eukaryotic Cell (in press) Bai C, Chan FY, Wang Y (2005) Identification and functional characterization of a novel candida albicans gene CaMNN5 that suppresses the iron-dependent growth defect of Saccharomyces cerevisiae aft1Delta mutant Biochem J 389:27-35 Hu CJ, Bai C, Zheng XD, Wang YM, Wang Y (2002) Characterization and functional analysis of the siderophore-iron transporter CaArn1p in Candida albicans J Biol Chem 277: 30598-30605 Bai C, Ramanan N, Wang YM, Wang Y (2002) Spindle assembly checkpoint component CaMad2p is indispensable for Candida albicans survival and virulence in mice Mol Microbiol 45: 31-44 112 ... 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3'' M2-R: 5'' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3'' M3-F: 5'' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3'' M3-R: 5'' CGAAGACAACAGCTTCTGCAGTTTCCTTCAAACAAGTAATG... GGATCCCGGCGAATGATTATGAGA 3'' CGCCCAAAGAGGTTTATG 3'' ScAFT1 deletion AFT1 ABf: 5'' TGAAGTATAAACCGCTAC 3'' 28 Chapter Materials and methods AFT1 ABr: AFT1 CDf: AFT1 CDr: 5'' GGATCCAGATGAATCAAATTGTTT 3'' 5'' GGATCCGGAAGAGTGGGATCGG