shifts and modification of the hydrological regime under climate change in hungary
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... relaced by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR ... and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the ... (K42, M59 and K99) in the mammalian mature IL-11 protein, are in bold and underlined The conserved residues L67 and R169, critical to binding IL-11R, are boxed A, B, C and D indicate the four...
- 12
- 511
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... immunoblotting The major tyrosine-phosphorylated bands appeared in the 35– 60 kDa region and the extent of phosphorylation increased in time, plateauing in % 15 after IL-2 addition The right panel of ... (CD25) in the vicinity of signaling IL-2R b and cc chains, forming a common signaling platform in the membrane, before cytokine stimulation This ÔfocusingÕ effect may enhance the association rate of ... chain in transformed human NK and fibroblast cells Thus, to better understand the role of lipid rafts in cell growth/ viability-signaling of T cells, in general, and in the unregulated growth of...
- 10
- 499
- 0
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
... and clinicians' global impression of change The changes in the sleep problems index were statistically different between groups defined according to the changes in sleep interference score, changes ... http://www.hqlo.com/content/6/1/113 and input into the manuscript IG wrote the manuscript As the developer of the MOS-Sleep, RDH helped in the interpretation of findings and reviewed the manuscript Acknowledgements ... changes in pain score, clinician and patient global impression of change (p < 0.0001) for the 'no change' and 'worse' groups whatever the criterion used to define these groups Changes in the sleep...
- 12
- 553
- 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrassing 14 Injecting insulin is painful ... 6% of the insulintreated agrees to fearing injections compared to 47% of the insulin-naïve participants ingly, post-hoc analyses revealed that both among the insulin treated as well as the insulin-naïve ... of the insulin-treated patients agree to the item that injecting insulin is painful, compared to 43% in the insulin-naïve group This suggests that despite improved injection devices and thinner...
- 7
- 602
- 0
báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf
... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrassing 14 Injecting insulin is painful ... 6% of the insulintreated agrees to fearing injections compared to 47% of the insulin-naïve participants ingly, post-hoc analyses revealed that both among the insulin treated as well as the insulin-naïve ... of the insulin-treated patients agree to the item that injecting insulin is painful, compared to 43% in the insulin-naïve group This suggests that despite improved injection devices and thinner...
- 7
- 485
- 1
characterization of signaling pathways and significance of the axon guidance molecule plexin b3 in glioma progression
... proteins such as talin, vinculin, and ERM (ezrin, radixin, moesin) actin-binding proteins, act as linker proteins to connect the cytoplasmic domains of integrins to the cytoskeleton, resulting in ... domains Additional domains that are present in semaphorins include PSI (plexin, semaphorin and integrin) domains, immunoglobulin (Ig)-like domains, thrombospondin domains and PDZ-domain binding ... Identification of fascin-1 binding regions in the intracellular domain of plexin-B3 122 3.4.4 Identification of CIPP binding regions in the intracellular domain of pleinx-B3 ...
- 286
- 266
- 0
UNDER SECTIONS 318 AND 319 OF THE FAIR AND ACCURATE CREDIT TRANSACTIONS ACT OF 2003 docx
... aware of the importance of credit reports and the need to check their accuracy In the midst of these changes, the market appears to be responding to some of the problems highlighted in the Section ... among other things, placing certain legal obligations on creditors and other furnishers of data to the CRAs with respect to the accuracy of the information they provide In 2003, the FACT Act further ... account information includes the identity of the creditor, the date the account was opened (and closed, if applicable), whether the account is open and in good standing, the balance and credit...
- 120
- 321
- 0
báo cáo hóa học:" Modification of the asthma quality of life questionnaire (standardised) for patients 12 years and older" pdf
... function and environmental stimuli) are the means of the responses to the questions in each of the domains Symptom and Medication Diary Each morning and evening patients scored how much they were bothered ... already included in the symptom domain of the AQLQ There is no environmental stimuli domain in the PAQLQ because children tend to express their problems with the environment in terms of activity ... be the gold standard with which to compare the measurement properties of the AQLQ12+ in adolescents In both studies at baseline, there was no evidence of any differences in the overall or domain...
- 6
- 486
- 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
... diagnostic interviews according to the DSMIV For the qualified subjects, the raters administered the various measures and then interviewed the staff Finally, they obtained the medication regimen of each ... hopelessness, emptiness and fear of intimacy With these concerns in mind, Benjamin and Linehan proposed to measure therapy's efficacy in degrees of reparation of the 'core dysfunction' in complex post ... same training and testing for inter-rater reliability The raters explained the procedure and human rights to the prospective subjects and obtained informed consent Then they administered the structured...
- 12
- 477
- 0
Báo cáo khoa học: "Effects of needle clumping in shoots and crowns on the radiative regime of a Norway spruce canopy Alessandro Cescatti" ppsx
... Kuuluvainen and Pauline Stenberg of the University of Helsinki for financial support and assistance in the description of the stand architecture and to two anonymous referees for the critical revision of ... used to correct the LAI estimates in the (S) scenarios Finally, the actual data and the PCA estimates of the vertical LAI profiles were compared, and the errors pertaining to individual architectural ... resolution from each of the 056 investigated points) to calculate the canopy transmittance in the five concentric rings of the sensor [32] Estimates of LAI were obtained from the values of canopy transmittance...
- 14
- 417
- 0
Globalization and liberalization of higher education services under world trade law a study on WTO GATS and free trade agreements in the context of international trade in higher education services
... an overview of the thesis and discusses the meaning and importance of higher education and of international trade in services generally It explains the four modes of supply under the GATS framework ... Treatment and WTO) 44 28 phrase was given in the GATS context and the panel had held that the ordinary meaning of the term “affecting,” in Art I: of GATS, did not convey any notion of limiting the ... through the four modes, and the impact of liberalizing each of these modes under GATS is examined The chapter also suggests methodology and ideas that could be used in the xii drafting of commitments...
- 302
- 1,196
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... AC in the other twin (twin B), when the concerned parents took him to our department Brain CT and MRI of twin B who did not have any com- 403 plaints revealed a mirror-imaging of the AC in the ... case of MZ with mirror-imaging of AC in the literature In this case, we describe the second case of MZ with mirror-imaging of AC and discuss the possible clinical implications First, Helland and ... Neuroimaging of the twins (a) Cerebral CT of twin A shows a vast lesion of cerebrospinal fluid intensity in the left temporal lobe with a maximum diameter of 63×40×26 mm (b) & (c) MRI of twin A shows...
- 4
- 652
- 0
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... recesses and sinuses, although there is only one frontal sinus ostium The size of the sinus and, therefore, its anatomic relationships also depend upon the extent of pneumatization [11] The extent of ... pneumatization results in the individual size and shape of the frontal sinus An absence of pneumatization in the frontal bone results in frontal sinus aplasia [1] This kind of variation should make ... higher in some populations, including Alaskan Eskimos (25% in males and 36% in female) and Canadian Eskimos (43% in males and 40% in female) [21,22] According to the literature, the frequency of...
- 5
- 577
- 0
Báo cáo y học: " Post-traumatic glioma: Report of one case and review of the literature"
... (3) the location of the impact and the occurrence of the tumor corresponded exactly one to the other; and (4) there was a more than one year interval between trauma and the appearance of the ... as a cocarcinogen in the presence of an initiating carcinogen It was hypothesized that cells damaged by the initiating carcinogen proliferated as a natural result of the trauma, leading to tumor ... other There should be a time interval between trauma and the appearance of the tumor of at least year, a longer latent period increasing the likelihood of a causal relationship The presence of...
- 3
- 550
- 0
. Scope and Limitations of the Study
... the following responsibilities: - In charge of designing and improving the training objectives, the curricula, the disciplines of his/her branch - In charge of heading or taking part in writing ... by the MOET a) Principal teachers They play a leading role in teaching, educating, training and researching into the application of new techniques to teaching They must be in charge of compiling ... resources and infrastructure for education and training, and low efficiency in their utilization • The inappropriate nature of the organization and management of the education and training system and...
- 71
- 1,157
- 0
Scope and Limitations of the Study
... degree of freedom remains Thus, making it possible to change the company’s course in case the changes in the environment so demand Putting the strategy into writing and communicating it to the employees ... by the Minister of the Ministry of Heavy Industry and has changed its old name to Hanoi Mechanical Company Registered lines of business in HAMECO include manufacturing of metal cutting machine ... make the civil service more professional, and they structured Ministries into more logical groups by, for example combining the ministries of Light and Heavy industry, and the Ministries of Forestry...
- 88
- 820
- 1
Methodology and framework of the study
... the determination of the basic long-term goals and objectives of a enterprise, and the adoption of course of action and the allocation of resources necessary for carrying out these goals” The ... number of factors including: the additional capacity which they bring with them, their attempts to build market share, or increased costs due to the building up of the costs of the factors of production ... to apply the Porter model for examining the pipe industry environment, the main business that BPC is being involved Finally, the chapter is ended with the findings on opportunities and threats...
- 71
- 668
- 3
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells
... opening are present under the outer skin layer of the membranes, and the sponge-like structures appear in the inner part of the membranes As shown in Figure 4e, many big aggregates appear in the ... membrane initially increases and then decreases, and there is a peak in the curve at 60 h The PVDF-SPS membrane continuously swells and decomposes The swelling is due to the degradation of the cross-linking ... Plant (Shanghai, China) The PVDF composite membrane was made in our laboratory using a combination technique of thermally induced polymerization and phase inversion, and all of the other reagents...
- 14
- 596
- 1
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu