see notes 5 and 6
Glaciation and surficial deposits(notes 5)
... (i.e., during the Triassic, Jurassic and Cretaceous from 250 m.y to 65 m.y ago), and as shown on the diagram to the right, that warmth continued up until about 50 m.y ago For a variety of reasons—the ... glacial ice in polar and alpine regions, we can see the direct effects of the glacial erosion and deposition on the land around us and we have the means to estimate temperatures and atmospheric characteristics ... plains, and they also left behind glacial deposits and landforms, including features like eskers and drumlins [See figure 17.27.] Eskers are a product of deposition of glacio-fluvial sediments (sand...
- 7
- 59
- 0
unit 5 and 6
... about 00. 15 36 A at B in C from D to 37 A journey B visit C picnic D street 38 A such B or C so D and 39 A on B in C at D for 40 A buses B trains C planes D cars 41 A have B buy C see D take ... will tell b would tell c had told d told 19.If I …………., I would have said hello a had seen b see c saw d would see 20.I………… out if I hadn’t been so tired a will go b went c would have gone d would ... needs correction 26 what would you if you win the lottery? a what b.do c win d lottery 27 If you had been here yesterday, you would have see Jane a had been b if c would d see 28 Either you or...
- 4
- 267
- 0
Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf
... Bax-a5 Buffer 20% TFE 60 % TFE 0 .5 mM SDS mM SDS 23 62 61 63 61 5 15 26 27 19 25 2 3 10 0 1 0 0 1 1 19 4 1 26 11 13 10 6 Bax-a6 Buffer 20% TFE 60 % TFE 0 .5 mM SDS mM SDS 13 27 40 33 42 4 10 15 22 16 ... PtdCho:lysoPtdCho ( 95 : 5) PtdCho:lysoPtdCho (90 : 10) PtdCho:PtdEtn ( 75 : 25) PtdCho:PtdEtn (50 : 50 ) 158 .7 59 .3 37 .6 35. 3 2 15. 1 238.1 198.0 1 75. 4 35. 2 15. 8 13.8 5. 7 53 .1 69 .4 28.3 16. 3 B Fig Calcein ... ⁄ C50 values were 8–12% CL, cardiolipin Activity, ⁄ C50 (lM)1) Lipid composition Bax-a5 Bax-a6 PtdCho PtdCho:PtdSer ( 75 : 25) PtdCho:PtdSer (50 : 50 ) PtdCho:CL (90 : 10) PtdCho:lysoPtdCho (95...
- 11
- 586
- 0
ECG Notes: Interpretation and Management Guide_2 potx
... 800-323 355 5 (US) or 800 -6 65 - 1148 (CAN) A Davis’s Notes Book F A Davis Company • Philadelphia Page 00Rnotes-Myer(p3)-FM 2/14/ 06 12 :55 PM Copyright © 2003, 20 06 by F A Davis F A Davis Company 19 15 Arch ... 978-0-80 36- 1114 -6 PsychNotes: Clinical Pocket Guide ISBN-10: 0-80 36- 12 86- 9 / ISBN-13: 978-0-80 36- 12 86- 0 DermNotes: Dermatology Clinical Pocket Guide ISBN-10: 0-80 36- 14 95- 0 / ISBN-13: 978-0-80 36- 14 95- 6 ... 95 140 DBP Temp 60 —90 *See below 37.0Њ—38.1ЊC (98 .6 —100 .6 F) 36. 4Њ—37 .6 C (97 .6 —99 .6 F) 37.0Њ—38.1ЊC (98 .6 —100 .6 F) 35. 9Њ—37.0ЊC ( 96. 6Њ—98 .6 F) Factors Affecting Vital Signs HR Fever Anxiety...
- 261
- 2,849
- 1
ECG Notes: Interpretation and Management Guide_1 pdf
... Clinical Pocket Guide ISBN: 0-80 36- 1288 -5 PsychNotes: Clinical Pocket Guide ISBN: 0-80 36- 12 86- 9 LabNotes: Pocket Guide to Lab & Diagnostic Tests ISBN: 0-80 36- 12 65 - 6 OrthoNotes: A Clinical Examination ... waves: 150 0/10 ϭ 150 bpm Methods and for Calculating Heart Rate Number of Large Boxes 10 11 12 13 14 15 Number of Small Boxes 10 11 12 13 14 15 16 Rate/Min 300 150 100 75 60 50 43 38 33 30 27 25 23 ... Rate/Min 750 50 0 3 75 300 250 214 1 86 167 150 1 36 1 25 1 15 107 100 94 ♥ Clinical Tip: Approximate rate/min is rounded to the nexthighest number 24 Method 3: Six-Second ECG Rhythm Strip 25 The best...
- 207
- 3,081
- 1
Báo cáo " The development of financial systems of ASEAN-5 and Vietnam: A comparative analysis " potx
... 413.3 440.2 489.0 55 4.1 63 6.1 721.9 8 35. 3 1040.4 1019.0 55 1.7 66 69 .6 7111 .57 6 959 .6 55 08 56 31.1 6 155 .7 56 17 58 31 62 74.2 71 85. 1 7 769 87 45. 6 101 26 11 068 1 051 1 7410.9 0.04 0. 05 0. 05 0.07 0.07 0.07 0.07 ... 11. 85 11.43 9. 86 9 .58 9. 85 9.99 9.91 9.34 9.29 9.14 9.19 10 .5 Vietnam 14.99 15. 18 16. 48 17. 15 17 .69 18 . 56 19.78 20 .58 20. 45 20.34 20 .67 21.29 22.30 22 .60 19.1 ASEAN -5 25. 62 25. 91 26. 02 25. 88 26. 80 ... 0.1 9 .5 9.3 8.2 5. 8 4.8 6. 8 6. 9 7.1 7.3 7.8 8.4 8.2 8 .5 6. 2 3.3 7.2 8.0 7 .5 4.8 -6. 6 4.4 7.0 1.1 4.8 5. 3 6. 8 5. 6 6.1 6 .5 3.8 -3 .5 4.1 Vietnam 16. 9 5. 6 3.1 8.1 4.1 -1.8 -0.3 4.1 3.3 9.4 8.4 7 .5 8.3...
- 13
- 505
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... 0.01 – 44 ± 4* hGBP5ta mant-GDP 0. 066 ± 0.004 0.13 ± 0.01 0.23 ± 0.01 3 .5 ± 0.3 mant-GTPcS 0.072 ± 0.0 06 1.4 ± 0.1 1. 15 ± 0.05a 16 ± 0.20 ± 0.03b 2.8 ± 0.7 mant-GTP 0.0 25 ± 0.0 05 0.72 ± 0.07 – 30 ... ª 2010 FEBS 159 9 Biophysical properties of hGBP5a ⁄ b and hGBP5ta M Wehner and C Herrmann Fig Representative isothermal titration calorimetry runs using hGBP5ta at 25 °C hGBP5ta ( 150 lM) was titrated ... GDP and GppNHp [guanosine 5 -(b,c-imino)-triphosphate], with Kd values of 11 and lm for hGBP5ta and 7.2 and 2 .6 lm for hGBP5a ⁄ b, respectively For the non-hydrolysable analog GTPcS [guanosine 5 -O-(c-thio)triphosphate],...
- 9
- 462
- 0
Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc
... pPC97-Rab5, pPC97-Rab5Q79L and pPC97Rab5S34N, the respective cDNAs were excised from pLexA-Rab5, pLexA-Rab5Q79L and pLexA-Rab5S34N FEBS Journal 272 (20 05) 37– 46 ª 2004 FEBS Rabaptin -5 isoform ... regions of Rabaptin -5 and Rabaptin-5d were obtained by cloning of ApaI-EcoRV internal fragments from pRn5 and pRn5d, respectively, into the p53Rn5 plasmid (plasmids pRn5NF and pRn5dNF) Finally, the ... Rabaptin -5 was described previously [23] pPC 86- Rabaptin-5d was constructed in a similar way To obtain pPC97-Rabaptin -5 and pPC97-Rabaptin-5d, the respective cDNAs from pPC 86- Rabaptin -5 and pPC86Rabaptin-5d...
- 10
- 411
- 0
Báo cáo khoa học: Structures of the O-polysaccharides and classification of Proteus genomospecies 4, 5 and 6 into respective Proteus serogroups ppt
... 3.27 73 .5 3 .69 56 .6 3 .54 77.2 4. 36 49.0 3 .53 72.9 4. 05 58.0 3 .54 74.9 3.71 74.1 4. 25 77 .5 3.74 74.1 3 .52 77 .5 3 . 56 70.7 3.80 81.8 4.23 68 .8 3. 45 70 .6 3 .68 73 .5 3 .59 75. 7 3. 85 76 .5 4.29 72.4 4.20 ... and 1 05. 1 (d 99 .6, 100.0, 102 .5 and 1 05. 3 in P vulgaris O8), two OCH2-C groups at d 62 .2 and 63 .3 (d 62 .4 and 63 .4 in P vulgaris O8), two nitrogen-bearing carbons at d 50 .4 and 55 .4 (d 50 .6 and ... 102.9 and 104.1 (d 101.9, 102.0, 102.7 and 104.0 in P penneri 25) , two OCH2-C groups at d 61 .8 and 68 .7 (d 61 .9 and 68 .8 in P penneri 25) , two nitrogenbearing carbons at d 55 .4 and 56 .1 (d 55 .3 and...
- 8
- 349
- 0
UP TO SPEED ON HTML 5 and CSS3: Short Guide
... canvas.getContext("2d"); ctx.fillStyle = "rgb(200,0,0)"; ctx.fillRect (10, 10, 55 , 50 ); ctx.fillStyle = "rgba(0, 0, 200, 0 .5) "; ctx.fillRect (30, 30, 55 , 50 ); } } canvas Sunday, July 19, 2009 Browser Support: The ... is a degree on a color wheel (0- 360 ), saturation is a percentage, and lightness is a percentage div { color: hsl(240 ,50 % ,50 %); } div { color: hsla(240 ,50 % ,50 %,0 .5) ; } HSLA is like HSL color, but ... the color being applied div { color: rgb(0, 255 ,0); } div { color: rgba(0, 255 ,0,0 .5) ; } Like opacity, the alpha value is between 0.0 (fully transparent) and 1.0 (fully opaque) RGBA color Sunday,...
- 67
- 276
- 0
GRAMMAR 2 - Chapter 5 and 6 pdf
... GRAMMAR: CHAPTER BE GOING TO, WILL, and THE PRESENT CONTINUOUS Be going to and the Present Continuous as FUTURE: A INTENTIONS AND PLANS: Use BE GOING TO and THE PRESENT CONTINUOUS to talk about ... FUTURE with WILL and BE GOING TO: A Predictions with WILL and BE GOING TO + Use WILL or BE GOING TO to make predictions You can also use PROBABLY and other adverbs with WILL and BE GOING TO to ... statements and YES/NO questions It comes at the end of a sentence For example: They haven’t arrived yet / Have you met him yet? + STILL means “UP TO NOW” STILL is used in negative statements and comes...
- 3
- 184
- 0
Báo cáo toán học: "Constructing Hypohamiltonian Snarks with Cyclic Connectivity 5 and 6" pot
... 13 15 16 17 11 23 24 25 26 22 18 16 17 19 20 21 15 13 12 14 10 6 359 87 12 10 14 18 16 15 13 11 17 19 25 24 26 22 20 21 23 23 21 15 16 17 19 20 22 18 14 12 26 24 25 11 10 23 24 25 26 22 18 16 17 ... 15 16 17 19 25 24 26 22 18 14 10 11 12 13 23 24 25 26 22 20 19 17 11 12 13 15 16 18 14 10 6 359 87 23 21 20 19 17 11 12 13 15 16 18 26 24 25 14 10 1 453 10 14 12 13 11 17 19 20 21 15 16 18 22 26 ... 18 16 15 13 12 11 17 19 25 24 26 22 20 21 23 12 26 22 20 21 23 24 25 19 17 11 12 13 15 16 18 14 10 23 21 15 16 18 22 20 19 17 11 26 24 25 13 12 14 10 23 21 15 16 17 19 20 22 18 14 10 26 24 25 13...
- 21
- 302
- 0
Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx
... sense 5' -GATGTGTGGAGCACGCTTACT-3' and antisense 5' -CACAATGTCACTCCTCTCCGAATTA-3', Catalase ( 763 bp): sense 5' -TTACTTTCTTGTTCAGCGAC CGA-3' and antisense 5' -C ACCTTCGTATAGAATGTCCG CA-3', Cu/Zn-SOD (54 1 ... DNA and PM10treated DNA (P
- 8
- 442
- 1
Báo cáo toán học: "The Loebl–Koml´s–S´s conjecture for trees of o o diameter 5 and for certain caterpillars" pptx
... contradiction to (1) and thus establishes ( 16) We shall finally bring ( 16) to a contradiction We use (5) , (9), (10) and ( 16) to obtain that the electronic journal of combinatorics 15 (2008), #R1 06 |D| k ≥ ... vertex v ∈ N has degree degL (v) < k (6) Then, (5) and (6) together imply that |B| k k ≤ e(N, B) ≤ |N | , and hence, |N | ≥ 2|B| (7) In order to see (6) , suppose otherwise, i e., suppose that ... deg(v) ≥ k} and set S := V (G) \ L We may assume that S is independent, and that that a, e = Because of Theorem 5, we may moreover assume that b, d > (and thus ≥ 2), and by Lemma 6, that c is...
- 11
- 271
- 0
Báo cáo khoa học: "Phylogenetic characterization of genes encoding for glycoprotein 5 and membrane protein of PRRSV isolate HH08" docx
... 20 06 2007 2007 2008 20 06 2004 2009 1999 2008 2007 GQ184822 AY03 262 6 EF 153 4 86 FJ 5 56 871 EU0977 06 AF331831 EF112447 AY 262 352 EU0 866 04 EU144079 FJ89 7 56 7 FJ5 361 65 DQ2 46 451 EU200 961 EF517 962 EF0 759 45 ... 1999 DQ 355 7 96 AY881994 EU0 767 04 U89392 M 962 62 AY3 950 79 AY3 950 81 AY3 950 80 EF5233 46 DQ1 760 20 AY 569 974 AF1 763 48 U 754 43 DQ 864 7 05 DQ 0 56 373 AY0 359 44 AY0 359 43 FJ194 950 FJ349 261 AB288 3 56 AB023782 AF 159 149 ... EF112447 AY 262 352 AY74 759 6 Dq2 65 7 39 AY737282 DQ 355 7 96 GQ128443 AY 450 301 EU480 753 EU480 754 EU880443 DQ2 46 451 EF517 962 EF0 759 45 AY74 759 5 FJ947000 FJ919342 DQ379479 AY51 361 1 FJ 361 891 FJ8 953 29 EF398 052 EU480749...
- 7
- 384
- 0
Báo cáo y học: "Divergent expression of claudin -1, -3, -4, -5 and -7 in developing human lung" potx
... 13 16 16 20 20 20 22 23 24 26 26 28 28 30 30 35 35 35 39 40 41 42 A dult* 13 13 16 16 20 20 20 22 23 24 26 26 28 28 30 30 35 35 35 39 40 41 42 Adult* W eeks 13 13 16 16 20 20 20 22 23 24 26 26 ... 3. 65 , SD 2 .61 ) and alveolar (mean 3. 65 , SD 2 .61 ) periods RNA level of claudin-4 appeared to increase from pseudoglandular period (mean 2.21, SD 1.04) to canalicular period (mean 4.17, SD 2. 85) ... Cycling conditions were: at 95 C for three minutes, 40 cycles of amplification (each 95 C for 10 seconds and 56 °C for 30 seconds), one minute at 95 C, one minute at 55 °C and melt data acquisition...
- 10
- 319
- 0
Báo cáo y học: " Impact on respiratory tract infections of heptavalent pneumococcal conjugate vaccine administered at 3, 5 and 11 months of age" potx
... 744) 63 7 39.2 1 56 38.4 1 95 48.0 144 35. 5 142 35. 0 69 8 46. 9 1 56 41.9 220 59 ,1 162 43 .5 160 43.0 RR 95% CI P 0.83 0 .61 –1.02 0.02 0.91 0. 75 1.20 0. 06 0.81 0. 76 1.02 0.04 0.82 0 .62 –1.24 0.04 0.81 0 .61 –1.20 ... 340 (328– 361 ) 55 1 (67 .9) 82 ( 76 103) 143 (130– 158 ) 343 (331– 364 ) 4 76 (64 .1) 0. 96 0.93 0.92 0.11 52 7 ( 65 . 0) 33 (24–49) 35 (21 50 ) (2–4) 498 (66 .9) 33 (20– 46) 35 (21 51 ) (2–4) 0.44 0. 96 0.99 1.00 ... 239.0 1,0 35 255 .2 1,1 85 292.2 998 2 46. 1 65 9 162 .5 3, 460 232 .5 928 249.4 9 86 2 65 . 0 872 234.4 67 4 181.1 Total number of RTIs during follow-up Episodes/100 child-years RTIs in children aged 6 12 months...
- 9
- 284
- 0
Báo cáo y học: "Human defensins 5 and 6 enhance HIV-1 infectivity through promoting HIV attachment" ppsx
... Immunol 1991, 1 46( 8): 257 8- 258 7 35 Szyk A, Wu Z, Tucker K, Yang D, Lu W, Lubkowski J: Crystal structures of human alpha-defensins HNP4, HD5, and HD6 Protein Sci 20 06, 15( 12):2749-2 760 36 Ericksen B, ... of HD5 and HD6, [Abu]HD5 and [Abu]HD6 [24] We have previously shown that [Abu]HD5 and [Abu]HD6 not exert any HIV enhancing effect [17] The virus-defensin mixture was added to HeLa-CD4-CCR5 cells ... structures and electrostatic surface potentials ([ 35] and Figure 7) The electrostatic surface potentials of HD5 and HD6 monomers were previously described [ 35] We note that the HD5 and HD6 homodimers...
- 10
- 236
- 0
Báo cáo y học: " Comparison of the McGrath® Series 5 and GlideScope® Ranger with the Macintosh laryngoscope by paramedics" pptx
... 21 81 .5 ± 24 .5 68 .5 ± 22.9 87.2 ± 22.9 85. 0 ± 19.7 76. 7 ± 19.9 68 .7 ± 23 .6 96. 3 ± 6. 1 90 .5 ± 16 .5 83 .5 ± 20.3 84 ± 18.2 62 .7 ± 27.2 92.7 ± 10.8 79 .5 ± 28 .6 59 .2 ± 24 .5 92.7 ± 10.7 80 ± 25. 2 Mean ... Resuscitation 1999, 41 :63 -69 Russi CS, Wilcox CL, House HR: The laryngeal tube device: a simple and timely adjunct to airway management Am J Emerg Med 2007, 25: 263 - 267 Wackett A, Anderson K, Thode ... Med 20 05, 29: 253 - 257 doi:10.11 86/ 1 757 -7241-19-4 Cite this article as: Piepho et al.: Comparison of the McGrath® Series and GlideScope® Ranger with the Macintosh laryngoscope by paramedics Scandinavian...
- 5
- 327
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25