saturation values of dissolved oxygen in fresh and seawater exposed to an atmosphere containing 20 9 oxygen under a pressure of 760 mm of mercury
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt
... encoding intercellular adhesion molecule Proc Natl Acad Sci USA 91 , 11641–11645 Roebuck KA, Rahman A, Lakshminarayanan V, Janakidevi K & Malik AB ( 199 5) H2O2 and tumor necrosis factor-alpha activate ... Marlin SD, Rothlein R, Toman C & Anderson DC ( 198 9) Cooperative interactions of LFA-1 and Mac-1 with intercellular adhesion molecule1 in facilitating adherence and transendothelial migration of ... demyelinating neuropathies such as ´ Guillain–Barre syndrome and chronic in ammatory demyelinating polyneuropathy [31] In experimental autoimmune neuritis, an animal model of demyelinating disease...
- 11
- 519
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG...
- 12
- 772
- 0
Báo cáo lâm nghiệp: "Variations in seed and seedling responses to water stress in three provenances of Eucalyptus camaldulensis Dehnh" pptx
... several instances, it appeared the most adaptable provenance It occurs naturally on well-drained, sandy, infertile soils and is developing a reputation as an outstandingly successful provenance in ... to lanceolate) in shape Principal component analysis (Cooley and Lohnes, lings (Fig 3) Water stress reduced leaf area most in Katherine seedlings (Fig 4), and the provenances also differed in ... in many plantations outside Australia Speciwere ETFORD interesting, as although NT A TENN CREEK References Andrew LA ( 197 3) Variation in leaf morphology among provenances of Eucalyptus camaldulensis...
- 5
- 233
- 0
Báo cáo lâm nghiệp: "Changes of partitioning and increased root lengths of spruce and beech exposed to ambient pollution concentrations in southern England" pdf
... April 198 8 Plants were rooted into compost Measurements of gas exchange (photosynthesis, transpiration and stomatal conductance) were made using a laboratory system (Taylor and Dobson, 198 9) During ... experimental Acknowledgments We thank W.J Davies and T .A Mansfield for guidance, the D.O.E for financial support, A Willson, D.W.H Durrant and other staff at the Forestry Commission and P Hutchinson ... photosynthesis, stomatal responses and water relations of Fagus sylvatica: impact of air quality at a site in southern Britain New Phyof tol in press U.K Terrestrial Effects Review Group ( 198 8)...
- 4
- 187
- 0
Báo cáo y học: "Reduced rates of primary joint replacement for osteoarthritis in Italian and Greek migrants to Australia: the Melbourne Collaborative Cohort Study" doc
... Australian population in the 200 5 census [22] Italian and Greek immigration increased dramatically after World War II Italian and Greek migrants arrived at Australia in the largest numbers in the ... Italian and Greek migrants to Australia have a lower rate of joint replacement compared with Australian-born individuals and that this discrepancy is not explained by differences in risk factors ... interpretation of data, and drafted the manuscript JAS participated in the acquisition of data, helped to perform the statistical analysis, and reviewed the manuscript AEW and DMU helped in the interpretation...
- 8
- 318
- 0
Báo cáo thú y: "The distribution of four trace elements (Fe, Mn, Cu, Zn) in forage and the relation to scrapie in Iceland" pptx
... concentration was significantly higher in Area VII than in Areas I, III and V It was also significantly higher in Areas II and VI than in Area V Table 3: The means of Fe, Mn, Cu and Zn analyses in forage ... 200 0 (incl.) are located in Area II (16 farms), Area VI (11 farms) and in Area III (2 farms) Scrapie has not been diagnosed in Areas I and VII for 20- 25 years and not after about 199 0 in Area V ... 0. 095 0.27 0 .99 *The total number of samples was 1308 and the farms were located in Areas II, III, V and VI SED: Standard error of difference Eiríksson et al Acta Veterinaria Scandinavica 201 0,...
- 10
- 202
- 0
Báo cáo y học: "The mental health of populations directly and indirectly exposed to violent conflict in Indonesia" pot
... Involved in data analysis and in writing the manuscript EH: Involved in data collection, data analysis and writing the manuscript All authors read and approved the final version of the manuscript ... and Saparua Islands A: Kayeli village in Buru Island B: Ambon city in Ambon Island C: Booi village in Saparua Island Turnip et al Conflict and Health 201 0, 4:14 http://www.conflictandhealth.com/content/4/1/14 ... Nepali speaking Bhutanese refugees Transcult Psychiatry 199 9, 36:285-301 Latuconsina AG: Menggagas Masa Depan Maluku Yogyakarta: Intan Cendekia 200 7 Survei sosial ekonomi nasional Indonesia’s national...
- 9
- 347
- 0
Báo cáo sinh học: "Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens" potx
... and helped revise the manuscript AK gained access to the dataset, participated in preparing and editing data, discussions and helped revise the manuscript All authors read and approved the final ... Wasserman L: All of Non-parametric Statistics New York: Springer; 200 6:55-56 Wahba G, Lin Y, Lee Y, Zhang H: Optimal properties and adaptive tuning of standard and non-standard support vector machines ... with shrinkage of estimates of non-informative markers to zero This is done naturally in a Bayesian context, where all unknowns are treated as random variables (e.g., Gianola and Fernando, [4])...
- 10
- 371
- 0
Báo cáo khoa học: Cold exposure and associated metabolic changes in adult tropical beetles exposed to fluctuating thermal regimes ppt
... accumulation in overwintering adults of a lady beetle, Harmonia axyridis (Coleoptera: Coccinellidae) Eur J Entomol 99 , 5 9 40 Watanabe M & Tanaka K ( 199 8) Adult diapause and cold hardiness in Aulacophora ... can be oxidized to Glu Transamination gave rise to Ala and a- ketoglutarate Such an increase in Ala contents is necessary to shuttle the amino group derived from the conversion of Pro to alpha-Ketoglutarate ... 357, 8 49 862 Danks HV (200 6) Insect adaptations to cold and changing environments Can Entomol 138, 1–23 ` Hane Z & Nedvı` d O ( 199 9) Chill injury at alternating temperaturesin Orchesella cincta (Collembola:...
- 9
- 376
- 0
Hazards in paper and pulp industries – from an engineering insurance perspective. pptx
... last years been built in Asia There has been an increase of 37 000 000 tons paper production capacity in Asia between 199 5 and 200 4 /2/ Between 199 0 and 200 5 a consolidation within the pulp and ... philosophy and a system for choosing the risks, - a pro-active in- service inspection programme and, - a working and committed maintenance organisation The question of what kind of a maintenance philosophy ... a longer time scale, s can be handled by an agreement between the factory and the maintenance organisation of a guaranteed availability This availability dependency is apt to apply the best loss...
- 39
- 418
- 0
Báo cáo lâm nghiệp: "Differences in morphological and physiological responses to water-logging between two sympatric oak species" doc
... during hypoxia, Ann Bot London 79 ( 199 7) 21–31 [20] Drew M.C., Oxygen deficiency and root metabolism: injury and acclimation under hypoxia and anoxia, Annu Rev Plant Phys Plant Mol Biol 48 ( 199 7) ... significantly larger main stem high and larger root biomass than Q petraea (Fig and Tab II) In response to water-logging, the number of seedlings displaying total shoot dieback increased with time to ... fermentative pathway [55], and as its transcription and activity are known to be modulated by O2 availability [16] Hexokinases (HK) and, to a lesser extent, neutral invertases (INV-7.5), are known to...
- 11
- 373
- 0
Báo cáo y học: "Synthesis of acute phase proteins in rats with cirrhosis exposed to lipopolysaccharide" pptx
... aspartate aminotransferase Alfa-1AGP, haptoglobin and albumin concentrations in serum were determined using an ELISA kit specific for the rat proteins (Alpha Diagnostic, San Antonio, Texas and Page ... was undertaken in accordance with prevailing local and national guidelines for animal welfare and approved by the Experimental Animal Inspectorate Twenty-five to 30 days after operation, the animals ... limit of detection was 1.56 ng/ml for α1AGP, 0 .98 ng/ml for haptoglobin and 50 ng/ml for albumin Analyses for α2M and thiostatin are not commercially available Serum albumin and haptoglobin were also...
- 7
- 372
- 0
economics in one lesson the shortest and surest way to understand basic economics phần 9 ppt
... brought to a halt after a few years, the final result will be, say, an average increase of 25 per cent in money incomes, and an average increase in prices of an equal amount, both of which are fairly ... uncertainty is created Profits are not reinvested Firms and individuals allow cash balances to accumulate in their banis They keep larger reserves against contingencies This hoarding of cash may ... because of his investments, the national wealth and income are greater; there are more factories and more production So many fallacies have grown up about saving in recent years that they cannot...
- 23
- 245
- 0
Giáo án Anh văn lớp 9 - Unit 1 A visit from a pen pal - Period 1 - Lesson 1 : Getting started Listen and read ppsx
... Peaceful atmosphere ( n) : Translation and repeat in chorus - Keep in touch (v) and individually + Used to + V infi - Copy down Example : Lan used to walk past the mosque on the way to her primary ... Museum of History One pillar Pagoda - Repeat and copy Explain the meanings of them to Students if they not know II / Pre reading : Introduce the topic of the lesson and set the scene “ Imagine that ... the statements are true or false : - Play games in the Guess whole class Read - Work in group to predict Lan ,s penpal comes from Malaysia Kualar Lumber is a small city The girls visited Hang...
- 5
- 1,466
- 0
Giáo án Anh văn lớp 9 - Unit 3 A trip to the countryside - Period 15 - Lesson 1 : getting started listen and read ppt
... river bank ) T F ( Liz took a lot of photos to show the trip to her parents ) - Read the text again T and answer the - Ask Ss to read the text again and answer thequestions : questions - Ask Ss to ... - Read their answers aloud - Call on Ss to read their answers aloud - Remark and correct mistakes if any - Give correct answers : 1.F ( Ban ad his family had a day trip to their home village ... lot of photo to show the trip to her parents - Ask Ss to read all the answers again and copy - Repeat all the correct - Call on some Ss to read the text aloud answers aloud - Correct mistakes...
- 6
- 5,982
- 7
Giáo án Anh văn lớp 9 - Unit 1: A VISIT FROM A PEN PAL - Getting started-Listen and read pptx
... To keep in touch * Check : giữ liên lạc R.O.R III/ While reading : Open prediction : Ask Ss to guess where Maryam went and what she did during the visit Ask Ss to lislen to the tape and read ... prediction and add some more information Ask Ss to read the text again (silent) to choose the correct option to complete the sentences on page 1C 2B 3D 4B IV/ Post – reading : Speaking : Asking Ss to ... you had a longer vacation V.Homework:Ask students to write a short paragraph about what they have just discussed with their partner -Write a passage telling what you should take your pen pal to...
- 3
- 6,473
- 5
Chapter 101. Hemolytic Anemias and Anemia Due to Acute Blood Loss (Part 9) ppsx
... via reduced glutathione (GSH), defends these cells against oxidative stress G6PD deficiency is a prime example of an HA due to interaction between an intracorpuscular and an extracorpuscular cause, ... abnormalities of red cells characteristically seen in membrane disorders are absent A definitive diagnosis can be made only by demonstrating the deficiency of an individual enzyme by quantitative ... of severe neonatal jaundice, which may require exchange transfusion; if the anemia is less severe, it may present later in life or may even remain asymptomatic and be detected incidentally...
- 5
- 364
- 0
Báo cáo khoa học: " Combined treatment with lexatumumab and irradiation leads to strongly increased long term tumour control under normoxic and hypoxic conditions" potx
... Ashkenazi A, Holland P, Eckhardt SG: Ligand-based targeting of apoptosis in cancer: The potential of recombinant human apoptosis ligand 2/tumor necrosis factor-related apoptosisinducing ligand (rhapo2l/trail) ... published data on a high efficacy of a combined treatment with another proapoptotic antibody (mapatumumab, anti-DR4) and irradiation Both models are in line with in vitro data from our and other labs ... and drafted the manuscript DJ and SS carried out the animal experiments to the same portion WB performed the statistical analysis MN participated in the statistical analysis and in the drafting...
- 8
- 419
- 0
Dysfunctional signaling pathway for nitric oxide production in endothelial cells chronically exposed to high glucose or high fatty acids
... vWF, microalbuminuria and the transcapillary escape rate of albumin are increased in individuals with type diabetes and in animal models in both in vivo and in vitro studies 26-37 Many of the endothelial ... relaxing factor as NO in 198 7 and the ensuing cloning of eNOS in 199 2, exhaustive efforts have been put forth to understand the regulatory mechanisms related to changes in eNOS abundance and ... endothelial NADPH-oxidase, and other pathways Oxidative stress may also activate PKC and mitogen activated protein-kinase signaling pathways On the other hand, an increase of PKC activity can affect...
- 171
- 323
- 0
Effect of dissolved organic matter (DOM) and biofilm on the adsorption capacity of powdered activated carbon in activated sludge
... organic matters (DOM) and biofilm attached onto PAC However, it is not clear that the effect of DOM and biofilm attached onto PAC were decrease in adsorption capacity of PAC in the aeration tank ... sedimentation tank The two tanks are separated by a partition wall that has an opening at the bottom to ensure effluent from the aeration tank into the sediment tank and the return of activated ... capacity of PAC increased with increase in the amount of organic carbon on PAC The adsorption capacity of PAC after 4th incubation was almost the same as that in the aeration tank - 254 - Journal of...
- 10
- 557
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25