... dynamic systems as we proposed here are intrinsically stable and each has a steady state T1, T2, M and P are concentrations as indicated in Figure 5a Based on the assumption of a quasi-steady ... which where at least one paralog was a microRNA target; see Materials and methods), expression divergence was calculated for each pair as minus the Pearson correlation of expression across all tissue ... found at the Ensembl database web site We also downloaded all human genes from Ensembl via the BioMart utility After removing redundant paralog pairs (that is, in the case of A- B and B -A, we retained...
... Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation ... sequence aGCAAAtc to aGCAAGtc (core bases shown in uppercase letters) centered at )105 within Prm3 was performed using the mutator primers Kin193 (5¢-dGAATTAATCACAAGC AAGTCTTCTCTCGCCTCCCAG-3¢; ... 16 h Thereafter, firefly and renilla luciferase activity was assayed; results are presented as mean firefly relative to renilla luciferase activity, expressed in arbitrary relative luciferase units...
... Lipase Apolipoprotein AII Enoyl-CoA hydratase 3-Ketoacyl-CoA thiolase Perilipin GGTTGT gtagg AGTTCA AGGACA a AGGTCA AGGTAG a AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT ... (D[Ca2+]i) and were calculated as mean changes in D[Ca2+]i ± SEM (nm) and values are reported at the end of each figure legend, where appropriate Statistical analysis Statistical analyses were analysed ... is reasoned that PPARc agonists may help to alleviate the adverse cardiovascular events associated with diabetes mellitus [16,17] For example, PPARc activators inhibit matrix metalloproteinase-9...
... central direction, and are either attractors or repellers In particular, any C robust attractor with singularities for flows on closed 3-manifolds always has an invariant foliation whose leaves are ... −X Applying Theorem E we have that Λ is an attractor (in the first case) or a repeller (in the second case) We shall prove that Λ is proper in the first case The proof is similar in the second case ... necessary we can assume the first case We can further assume that Y is C ∞ and λ (7) = −Re(ω) By Theorem 2.3, we can assume that there is a homoclinic loop Γ ⊂ ΛY (U ) associated to σ Then Γ is a...
... complementary DNA (cDNA) was normalized against that of actin Statistical analysis 11 Data were analyzed by one-way factorial, 2-way factorial, or 2-way repeated-measures ANOVA, and significant differences ... DNase (TaKaRa, Shiga, Japan), mRNA was reverse transcribed using the PrimeScript RT Regent Kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions and used for analysis Quantitative ... (Fig 3) In the case of addition of only W-7, the result was same as in the case of addition 12 of cAMP, IBMX and W-7 (data not shown), which was already reported by Sakamoto et al (2010) These...
... complementary DNA (cDNA) was normalized against that of actin Statistical analysis Data were analyzed by one-way factorial, 2-way factorial, or 2-way repeated-measures ANOVA, and significant differences ... aaa c a c c Gene name (Figure 3) In the case of addition of only W-7, the result was same as in the case of addition of cAMP, IBMX and W-7 (data not shown), which was already reported by Sakamoto ... Sakamoto et al AMB Express 2012, 2:7 http://www.amb-express.com/content/2/1/7 Page of b b b a c b a b a b c b aaa aa b a c aaaa bc aa b b ab aa c abc c abc abc abc Figure Absolute quantities...
... complementary DNA (cDNA) was normalized against that of actin Statistical analysis Data were analyzed by one-way factorial, 2-way factorial, or 2-way repeated-measures ANOVA, and significant differences ... aaa c a c c Gene name (Figure 3) In the case of addition of only W-7, the result was same as in the case of addition of cAMP, IBMX and W-7 (data not shown), which was already reported by Sakamoto ... Sakamoto et al AMB Express 2012, 2:7 http://www.amb-express.com/content/2/1/7 Page of b b b a c b a b a b c b aaa aa b a c aaaa bc aa b b ab aa c abc c abc abc abc Figure Absolute quantities...
... Table Data analysis Homology searches Pyrosequencing reads matching ribosomal RNA genes were identified in cDNA and DNA datasets by BLASTN searches against a custom database of prokaryotic and ... interpretation of the resulting data can vary based on the analytical method (for example, database-dependent versus -independent analyses, as shown here) and on the availability and biases of ... most abundant taxa per sample Per gene expression level is measured asa ratio - (Transcript abundance in RNA sample)/(Gene abundance in the DNA sample) - with abundance normalized to dataset...
... Actinidia AG cDNA cDNA was amplified from A chinensis ’Hort1 6A , A deliciosa ’Hayward’ and A deliciosa ’Pukekohe dwarf’ flower cDNA The A arguta AG sequence was obtained from the Actinidia EST database ... lemma and palea and is an early-acting regulator of inner floral organs Plant J 2005, 43(6):915-928 74 Prasad K, Sriram P, Kumar CS, Kushalappa K, Vijayraghavan U: Ectopic expression of rice OsMADS1 ... petals, stamens and ovary with a fully developed stigma Arrows indicate small lateral bracts C-D A deliciosa ’Chieftain’ staminate (male) flower with sepals, petals, stamens and a rudimentary...
... homology search method based on HMM profile vs profile comparisons [19] A Pox _A4 6 family multiple sequence alignment from Pfam database was used as input to run HHpred against a database of all Pfam ... strain W-848-83; MYXV-LAU, myxoma virus strain Lausanne; RFV-KAS, rabbit fibroma virus strain Kasza; VACV-WR, vaccinia virus strain Western Reserve; YLDV-Davis, yaba-like disease virus strain Davis; ... these families, an iterative HMM search was started with the Pox _A4 6 HMM profile from Pfam database against a poxvirus protein sequence database This search detected with significant e-values...
... CTC ATA GAG ATG CTC CG 3’ 5’ TCA AAG ACG ACG GCA TCC TCT ACC 3’ 5’ GTT CTC ATA GAG ATG CTC CG 3’ 5’ GCG GTG CAT GCC TTT AAT CTC A 3’ 5’ GAG GAG ATG GGG TGA GGA TT 3’ 5’ CAC ATC CTC CTG ACC TAC ... pathway BCR stimulation also leads to the activation of Ras, which in turn activates the classical mitogen-activated protein kinase (MAPK) pathway The MAPK cascades constitute a group of signal ... Pharmingen 553393 Rat 1:1000 BD Pharmingen Research Biolabs 553401 NA Rat Rabbit 1:1000 1:500 Santa Cruz Santa Cruz Santa Cruz Santa Cruz Santa Cruz Santa Cruz Santa Cruz Santa Cruz Cell Signaling...
... Lck/yes-related novel tyrosine kinase Mitogen activated protein kinase Mitogen activated protein kinase kinase Mitogen activated protein kinase kinase kinase Major histocompatibility complex Macrophage ... exhibited increased IκBα degradation accompanied by enhanced NF-κB DNA binding SHIP-1 is an important candidate to investigate as it is a pivotal negative regulator in B cell and was shown to bind ... Valerie, Ann Teck, Jianxin and Koon Guan for sharing reagents and meaningful discussion about science and the companionship for the past years Weng Keong, thanks for managing our laboratory and...
... male contained mainly eosinophilic material and the nuclear membrane was weakly basophilic after H&E staining in contrast with the increased basophilia in cytoplasm and nucleoli after E2 treatment ... protocol All samples were analyzed in duplicate The relative level of ERα mRNA was determined based on a RNA standard curve, which was generated by RT-PCR amplification of serially diluted total RNAs ... final wash was conducted with a low salt washing solution (0.2 x SET, 0.5% SDS) at 65 ºC for 30 If a high stringent wash was necessary, an additional wash will be carried out in 0.2 x SET at...
... 2003 Marino et al 2000 Marino et al 2000 Marino et al 2003 Dannenberg et al 2004 Dannenberg et al 2004 Robanus-Maandag et al 1994; Williams et al 1994 Robanus Maandag et al 1994; Williams et al ... binds to p53 and blocks its transcriptional activity, acts as an E3 ubiquitin ligase to target p53 for degradation in cytoplasmic proteasomes and accelerates p53 nuclear export p19ARF is able to block ... between lack of p130 expression in retinoblastomas and poor differentiation and low apoptotic index (Bellan et al 2002) Second, mutational analysis of p130 in primary nasopharyngeal carcinoma (Claudio...
... TACCCTTTCCAAGACGAAAACAACAGACAGACCTT TTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCT CATTTATTTTGTTCAAAACAATAAGTCATTTTCCCC TTAGAGTGCTTGAAGAA and CATGAATGTTACCC AAAAAGCTGTGTTTTCTTTGGTCAGCAAAACAAAT TTATGAAAAACAAAATGCTGTATGAATGGAAATCA ... TTTTGTATTAAAAAAGTAGGGATCCACACAAATAT CAAAAACACAA The two mutations in Luc-Per23¢UTR-Mut were established using the following primers: GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAA CAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTT ... ATTCTGGGACCATCTCC; Per1 rev, AGATCTGGCGT TTTTATCTTTTTGTATT; Per2 forw, GAATTCTTAAC AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GGA TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw, GAATTCTTAAGTGACTGTGAGGATGAACCTTC;...
... 11bhydroxylase activity of CYP11B1 was strongly reduced (Fig 5), whereas that of the aldosterone synthase was basically unaffected, while the 18-hydroxlase and oxidase activity was also greatly diminished ... with a NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer...
... [33]) was used for database search and for pair wise alignments, whereas the LASERGENE MEGALIGN program (Dnastar, Madison, WI, USA) was used for multiple alignments RESULTS Amino-acid analyses and ... LOX sequence (Pfam LOX; Fig 3) Plant and mammalian LOX contain a small N-terminal b-barrel domain and a large C-terminal and catalytic domain, as revealed by three-dimensional analysis [11,15] ... thus contained 618 amino acids and had a molecular mass of 67.7 kDa The gene was isolated from a library of Gga, whereas peptide information was obtained from Mn-LOX-Ggt We also partially sequenced...