Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells Adrian T Coyle, Martina B O’Keeffe and B Therese Kinsella Department of Biochemistry, Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Ireland Keywords thromboxane receptor; promoter; peroxisome proliferator-activated receptor c; 15-deoxy D12,14-prostaglandin J2; isoforms Correspondence B T Kinsella, Department of Biochemistry, Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland Fax: +353 2837211 Tel: +353 7166727 E-mail: Therese.Kinsella@ucd.ie (Received 15 June 2005, revised 28 July 2005, accepted 29 July 2005) doi:10.1111/j.1742-4658.2005.04890.x In humans, thromboxane (TX) A2 signals through two receptor isoforms, thromboxane receptor (TP)a and TPb, which are transcriptionally regulated by distinct promoters, Prm1 and Prm3, respectively, within the single TP gene The aim of the current study was to investigate the ability of the endogenous peroxisome proliferator-activated receptor (PPAR)c ligand 15-deoxy-D12,14-prostaglandin J2 (15d-PGJ2) to regulate expression of the human TP gene and to ascertain its potential effects on the individual TPa and TPb isoforms 15d-PGJ2 suppressed Prm3 transcriptional activity and TPb mRNA expression in the platelet progenitor megakaryocytic human erythroleukemia (HEL) 92.1.7 cell line but had no effect on Prm1 or Prm2 activity or on TPa mRNA expression 15d-PGJ2 also resulted in reductions in the overall level of TP protein expression and TP-mediated intracellular calcium mobilization in HEL cells 15d-PGJ2 suppression of Prm3 transcriptional activity and TPb mRNA expression was found to occur through a novel mechanism involving direct binding of PPARc–retinoic acid X receptor (RXR) heterodimers to a PPARc response element (PPRE) composed of two imperfect hexameric direct repeat (DR) sequences centred at )159 and )148, respectively, spaced by five nucleotides (DR5) These data provide direct evidence for the role of PPARc in the regulation of human TP gene expression within the vasculature and point to further critical differences in the modes of transcriptional regulation of TPa and TPb in humans Moreover, these data highlight a further link between enhanced risk of cardiovascular disease in diabetes mellitus associated with increased synthesis and action of thromboxane A2 (TXA2) The cyclopentanone prostaglandin 15-deoxy-D12,14prostaglandin (PG) J2 (15d-PGJ2), a dehydration product of cyclooxygenase (COX)-derived PGD2 present in inflammatory exudates, is elevated during the resolution phase of inflammation and was initially identified as a high affinity natural ligand for peroxisome prolif- erator-activated receptors (PPAR)c [1,2] although a number of PPARc independent effects have recently been reported [3] The nuclear hormone receptor PPARc classically up-regulates gene expression by binding as a heterodimer with the retinoic X receptor (RXR) to specific response elements consisting of one Abbreviations AP-1, activator protein-1; 15d-PGJ2, 15-deoxy-D12,14-prostaglandin J2; CHIP, chromosomal immunoprecipitation; COX, cyclooxygenase; DR, direct repeat; d ⁄ s, double stranded; EMSA, electromobility shift assay; HEK, human embryonic kidney; HEL, human erythroleukemia; PG, prostaglandin; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator-activated receptor response element; Prm, promoter; RLU, relative luciferase units; RAR, retinoic acid receptor; RXR, retinoic acid X receptor; TZD, thiazolidinedione; TP, thromboxane receptor; TXA2, thromboxane A2; VSMC, vascular smooth muscle cell 4754 FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al or more copies of the hexameric DNA consensus sequence AGGTCA arranged as a direct repeat (DR) spaced by one nucleotide, hence termed DR1 [4,5] PPARc-transcriptional activation may also involve the recruitment of various coactivators to specific target genes such as p300 [6], the SRC-1 coactivators [7–9], PGC-1 and PGC-2 [8,9], ARA70 [10] and DRIP205 (or TRA220) [11] In addition to activating transcription, PPARc can also negatively regulate gene expression through mechanisms involving either the trans-repression (negative cross-talk) of activating transcription factors, e.g NF-jB and activator protein-1 (AP-1) [12,13] or the sequestration of limiting amounts of coactivator molecules such as CBP [14] The beneficial insulin-sensitizing actions of 15d-PGJ2 and the thiazolidinediones (TZDs) as PPARc agonists are widely recognized, such as in the treatment of type II diabetes [15] Moreover, while the inhibitory effects of PPARc play a prominent role in the resolution of inflammation [15], they are also thought to be important within the vasculature where they offer a cardioprotective effect during myocardial ischemia, reperfusion and atherosclerosis and hence it is reasoned that PPARc agonists may help to alleviate the adverse cardiovascular events associated with diabetes mellitus [16,17] For example, PPARc activators inhibit matrix metalloproteinase-9 expression in vascular smooth muscle cells (VSMCs) [18] and thrombin induced endothelin-1 production in endothelial cells [19] Moreover, it has recently been established that the expression of a number of other key vascular genes are suppressed in response to PPARc activation including those encoding the inducible cyclooxgenase (COX)II [20] and nitric oxide synthase [14], the rat thromboxane (TX)A2 synthase [21] and the rat thromboxane A2 (TXA2) receptor (thromboxane receptor, TP) [22] The COX-derived TXA2 is a potent biologically active eicosanoid primarily released from activated platelets, monocytes and damaged vessel walls and plays a central role in the dynamic regulation of vascular haemostasis [23] Alterations in the level of TXA2, TXA2 synthase or the TXA2 receptor (TP) are widely implicated in a variety of vascular diseases including thrombosis, unstable angina, systemic and pregnancyinduced hypertension [24–26] TXA2 is also known to play a pathophysiological role in inflammatory diseases such as in atherosclerosis [27], glomerulonephritis [28] and diabetic nephropathy [29] TXA2 signals through the TXA2 receptor, or TP, a G-protein coupled receptor primarily coupled to phospholipase (PL) Cb activation [23] In humans, but not in other nonprimates, TXA2 signals through two TP isoforms, namely TPa FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS Effect of 15d-PGJ2 action on TP gene expression and TPb, that arise through differential splicing and differ exclusively within their carboxyl terminal domains [30,31] Whilst the biologic significance for the existence of two TP isoforms in humans has not been fully elucidated, there is extensive evidence that they may be physiologically distinct thereby greatly adding to the complexity of TXA2 signalling in humans [32] For example, while both TPa and TPb identically couple to PLCb, they differentially regulate other secondary effectors including adenylyl cyclase and tissue transglutaminase [33,34]; they undergo differential homologous and heterologous desensitization [35–38] and are also differentially expressed in a range of cell ⁄ tissue types [39] Moreover, recent studies have established that TPa and TPb expression are actually transcriptionally regulated by distinct promoters within the single human TP gene located on chromosome 19 [40,41] Whilst the originally identified promoter (Prm) directs TPa expression, a novel promoter (Prm3) was identified within the human TP gene that exclusively directs TPb expression [40] In view of the observations that PPARc activation is associated with suppression of a number of key disease-associated genes within the vasculature including that of the rat TP [22] coupled to the fact that there is no significant sequence homology between the rat TP promoter and human Prm1 or Prm3 sequences [22,41], the aim of the current study was to investigate the effect of 15d-PGJ2 on expression of the human TP gene within the platelet progenitor megakaryocytic human erythroleukemic (HEL) 92.1.7 cell line Moreover, in view of the existence of two independently expressed TP isoforms in humans, it was also sought to investigate whether 15d-PGJ2 regulates TPa and ⁄ or TPb expression in an isoform-dependent manner It was established that 15d-PGJ2 suppresses both Prm3directed luciferase reporter gene expression and TPb mRNA expression without affecting Prm1-directed gene expression or TPa mRNA levels in HEL cells Moreover, we describe a novel mechanism of 15dPGJ2 ⁄ PPARc-mediated suppression of gene expression involving the direct binding of the activated PPARc– RXR heterodimer to a PPARc response element (PPRE)–RXR response element within Prm3 resulting in selective down-regulation of TPb mRNA expression These data provide further evidence for the role of PPARc in the regulation of TP gene expression within the vasculature and point to further critical differences into the modes of regulation of TPa and TPb in humans Moreover, in view of the critical link between the enhanced risk of cardiovascular disease in patients with diabetes mellitus and in animal models of diabetes mellitus associated with increased synthesis and TXA2 4755 Effect of 15d-PGJ2 action on TP gene expression action [42–45], these data point to an added benefit to the current use of PPARc agonists in the treatment of cardiovascular disease-associated diabetes Results Analysis of the effect of 15d-PGJ2 on Prm1-, Prm2- and Prm3-directed gene expression Previous studies have identified the presence of three promoter regions, designated Prm1, Prm2 and Prm3, A T Coyle et al within the single human TXA2 receptor gene located on chromosome 19p13.3 [40,41] A schematic of the human TP gene highlighting the positions of Prm1, Prm2 and Prm3 relative to its translational start site (ATG, designated +1) is presented in Fig Initially the effect of the endogenous PPARc ligand 15d-PGJ2 on Prm1-, Prm2- and Prm3-directed reporter gene expression in transfected human erythroleukemic 92.1.7 (HEL) cells and, as a negative control, human embryonic kidney (HEK) 293 cells was investigated Consistent with previous reports [39], Prm1, Prm2 and A B Fig Effect of 15d-PGJ2 on Prm1, Prm2 and Prm3-directed luciferase expression (A and B) A schematic of the human TXA2 receptor (TP) genomic region spanning nucleotides )8500 to +786 encoding Prm1, Prm2 and Prm3 in addition to exon (E) 1, E1b and E2 are illustrated above each panel where nucleotide +1 corresponds to the translational start site (ATG) and nucleotides 5¢ of that site are given a –designation Recombinant pGL3Basic plasmids encoding Prm1 ()8500 to )5895), Prm2 ()3308 to )1979), Prm3 ()1394 to +1) or, as a control, pGL2Control were transiently cotransfected along with pRL-TK into HEL 92.1.7 (A) and HEK 293 (B) cells Thirty-six h post-transfection, cells were incubated with either 15d-PGJ2 (10 lM) or the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] for 16 h Mean firefly relative to renilla luciferase activity is expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisk (*) indicates that Prm3-directed luciferase activity in HEL cells was significantly reduced in 15d-PGJ2 treated cells relative to vehicle treated cells; *P < 0.05 4756 FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al Effect of 15d-PGJ2 action on TP gene expression A B C D Fig Concentration- and time-dependent effect of 15d-PGJ2 on Prm1 and Prm3-directed luciferase expression HEL 92.1.7 cells were transiently cotransfected with pRL-TK along with pGL3b:Prm1 (A and B) or pGL3b:Prm3 (C and D) Thirty-six hours post-transfection, cells were incubated for 16 h with 0–40 lM 15d-PGJ2 (A and C) or for 0–24 h with 10 lM 15d-PGJ2 (B and D) Mean firefly relative to renilla luciferase activity is expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate the concentration or time that Prm3directed luciferase activity was significantly reduced in 15d-PGJ2 treated HEL cells relative to vehicle treated cells; ***P £ 0.001 Prm3 each directed luciferase activity in both HEL and HEK 293 cells, albeit at significantly different levels relative to each other (Fig 1) Pre-incubation of HEL cells with 10 lm 15d-PGJ2 for 16 h resulted in a 1.5-fold reduction in Prm3-directed luciferase expression (P < 0.05) but had no significant effect on either Prm1- or Prm2-directed luciferase expression (Fig 1A) Moreover, 15d-PGJ2 suppressed Prm3-directed luciferase expression in a concentration- (Fig 2C) and time-dependent (Fig 2D) manner but had no significant effect on Prm1- (Fig 2A,B) or Prm2-directed (data not shown) reporter gene expression regardless of the concentration (0–40 lm) or incubation time (0–24 h) In control HEK 293 cells, 15d-PGJ2 had no significant effect on either Prm1-, Prm2- or Prm3directed luciferase expression (Fig 1B) Effect of 15d-PGJ2 on TPa and TPb mRNA and protein expression in HEL cells As previously stated, the TPa and TPb isoforms of the human TXA2 receptor (TP) are under the transcriptional control of distinct promoters, namely Prm1 and Prm3, respectively [40] Hence, in view of the finding FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS herein that 15d-PGJ2 significantly suppressed Prm3but not Prm1-directed reporter gene expression the effect of 15d-PGJ2 on TPa and TPb mRNA expression in HEL cells was investigated Consistent with previous reports [39], RT-PCR followed by Southern blot analysis confirmed expression of TPa, TPb and glyceraldehyde 3¢phosphate dehydrogenase (GAPDH) mRNA in HEL cells (Fig 3A,B, lanes 1–3, respectively) with an approximately twofold higher level of TPa relative to TPb mRNA expression Pre-incubation with 15d-PGJ2 had no significant effect on the levels of either TPa or GAPDH mRNA expression in HEL cells relative to the vehicle-treated cells (Fig 3A–C) In contrast, preincubation with 15d-PGJ2 resulted in a 1.62-fold reduction in TPb mRNA expression in HEL cells compared to vehicle-treated cells (Fig 3A–C) These data correlate well with the observed effect of 15d-PGJ2 on Prm3 activity and provides further evidence for a distinct role for Prm3 in the regulation of TPb expression To assess the affect of 15d-PGJ2 on the overall level of TP protein expression and function, HEL cells were preincubated with 10 lm 15d-PGJ2 for 24 and 48 h and its affect on TP-radioligand binding and on 4757 Effect of 15d-PGJ2 action on TP gene expression A A T Coyle et al B D C E Fig Effect of 15d-PGJ2 on TPa and TPb mRNA expression and TP-mediated intracellular signalling (A and B) RT-PCR analysis of RNA isolated from HEL cells preincubated for 16 h with the vehicle 0.1% (v ⁄ v) dimethylsulfoxide (lanes 1–3) or 10 lM 15d-PGJ2 (lanes 4–6) using primers to amplify TPa (lanes and 4), TPb (lanes and 5) and GAPDH (lanes and 6) mRNA sequences (B) Southern blot analysis of the RT-PCR products (lanes 1–6) coscreened using 32P-radiolabelled oligonucleotide probes specific for TPa ⁄ TPb mRNA and GAPDH mRNA sequences (C) Mean levels of TPa, TPb and GAPDH mRNA expression in 15d-PGJ2-treated HEL cells were represented as a percentage of their expression in vehicle-treated cells (Relative expression,% ± SEM, n ¼ 4) The asterisks (*) indicate that the level of TPb mRNA expression in HEL cells was significantly reduced in 15d-PGJ2 treated cells relative to vehicle treated cells; **P £ 0.02 (D and E) HEL 92.1.3 cells were preincubated for 24 h with the vehicle 0.1% dimethylsulfoxide (D) or with 10 lM 15d-PGJ2 (E) prior to stimulation with lM U46619, added at the times indicated by the arrows Data presented are representative profiles from at least four independent experiments and are plotted as changes in intracellular Ca2+ mobilization (D[Ca2+]i, nM) as a function of time (second, s) Actual mean changes in U46619-mediated [Ca2+]i mobilization (nM ± SEM) were as follows: D[Ca2+]i ¼ 23.7 ± 4.2 nM for vehicle treated cells (n ¼ 6); D[Ca2+]i ¼ ± 0.82 nM for 10 lM 15d-PGJ2 treated cells (n ¼ 4) TP-mediated intracellular calcium ([Ca2+]i) mobilization, in response to the selective TXA2 mimetic U46619, was investigated In addition, as a control, we also investigated the effect of 10 lm 15d-PGJ2 on signalling by an unrelated receptor, namely the EP1 subtype of the prostaglandin (PG)E2 receptor Preincubation of HEL cells with 15d-PGJ2 for 24 h significantly reduced the overall level of TP expression from 58.8 ± 8.2 fmol [3H]SQ29,548Ỉmg cell protein)1 (n ẳ 8) to 17.0 4.3 fmol [3H]SQ29,548ặmg cell protein)1 (n ¼ 11; P ¼ 0.0001) Moreover, 15d-PGJ2 preincubation significantly reduced the overall level of U46619mediated [Ca2+]i mobilization from 23.7 ± 4.2 nm [Ca2+]i to ± 0.82 nm (P ¼ 0.01), as illustrated in Fig 3D,E Similar data was obtained following 48 h incubation with 15d-PGJ2 (data not shown) On the other hand, 15d-PGJ2 (10 lm, 48 h) did not significantly affect [Ca2+]i mobilization by the control EP1 4758 receptor in response to its agonist 17 phenyl trinor PGE2 (compare D[Ca2+]i ¼ 150.9 ± 21.9 nm, n ¼ vs D[Ca2+]i ¼ 176.0 ± 9.8 nm, n ¼ in vehicle- and 15d-PGJ2-treated cells, respectively; P ¼ 0.255) Examination of the role of PPARc2, PPARc3 and RXRa in 15d-PGJ2 mediated inhibition of Prm3 activity PPARc ⁄ retinoic X receptor (RXR) heterodimerization has been shown to be an important step in mediating the effect of 15d-PGJ2 in a number of cell types Hence, to investigate whether PPARc ⁄ RXR heterodimers might be involved in regulating Prm3, the effect of expression of either PPARc2 (Fig 4A) or PPARc3 (Fig 4B) alone or coexpression of PPARc2 ⁄ PPARc3 along with RXRa on 15d-PGJ2 regulation of Prm3directed reporter gene expression was investigated FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al A B Effect of 15d-PGJ2 action on TP gene expression anova one way comparisons, it was established that relative to cells transfected with the empty vector, expression of either PPARc2 or RXRa alone (Fig 4A), or PPARc3 or RXRa alone (Fig 4B) had no significant effect on the ability of 15d-PGJ2 to suppress Prm3-activity (P ¼ 0.2196 and p ¼ 0.2235; Fig 4, respectively) However, coexpression of PPARc2 with RXRa significantly augmented 15d-PGJ2-suppression of Prm3 activity relative to cells cotransfected with the vector alone or vector encoding PPARc2 (P < 0.0014) or encoding RXRa (P < 0.0014) yielding a 2.2-fold reduction in luciferase expression relative to vehicle treated cells (Fig 4A) Similarly, coexpression of PPARc3 with RXRa augmented 15d-PGJ2-suppression of Prm3 activity relative to cells cotransfected with the vector alone or vector encoding PPARc2 (P < 0.0009) or encoding RXRa (P < 0.0005) yielding a 2.4-fold reduction in luciferase expression relative to vehicle treated cells (Fig 4B) Western blot analysis confirmed over-expression of PPARc and RXRa in transfected HEL cells (data no shown) Hence, these data are suggestive that both PPARc and RXRa transcription factors may be required to mediate 15d-PGJ2-inhibition of Prm3-directed gene expression Localization of the site of action of 15d-PGJ2 within Prm3 by 5¢ deletion analysis Fig The effect of co-expression of RXRa with either hPPARc2 or hPPARc3 on 15d-PGJ2-mediated inhibition of Prm3-directed luciferase expression HEL 92.1.7 cells were transiently cotransfected with pGL3b:Prm3 (1 lg) together pSG5-hPPARc2 plus pSG5 (1 lg each), pSG5-mRXRa plus pSG5 (1 lg each), or pSG5-hPPARc2 plus pSG5-mRXRa (1 lg each) in the presence of 200 ng pRL-TK (A) Alternatively, HEL cells were transiently cotransfected with pGL3b:Prm3 (1 lg) together pcDNA3-hPPARc3 plus pcDNA3 (1 lg each), pSG5-mRXRa plus pSG5 (1 lg each), or pcDNA3-hPPARc3 plus pSG5-mRXRa (1 lg each) in the presence of 200 ng pRL-TK (B) Thirty-six hours post-transfection, cells were incubated for 16 h with 10 lM 15d-PGJ2 (Panels A and B) Mean firefly relative to renilla luciferase activity is expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that Prm3-directed luciferase activity in HEL cells was significantly reduced in 15dPGJ2 treated cells relative to vehicle treated cells; *P £ 0.05, **P £ 0.02, ***P £ 0.001, ****P £ 0.0001, respectively ANOVA one way analysis was carried out to determine differences due to overexpression of plasmids encoding hPPARc2 plus RXRa, or hPPARc2 plus RXRa relative to their expression alone or along with the empty vector (Fig 4) Consistent with previous data, preincubation of HEL 92.1.7 cells with 15d-PGJ2 resulted in a 1.5fold suppression of Prm3 activity (Fig 4) Using FEBS Journal 272 (2005) 47544773 ê 2005 FEBS Thereafter, 5Â deletion analysis of Prm3 ()1394 to +1) was used to localize the key regulatory domains directing 15d-PGJ2-inhibition of Prm3 within HEL cells Consistent with previous reports [46], 5¢ deletion of Prm3 to generate a )404 subfragment did not significantly affect the level of basal (nonstimulated) luciferase activity in HEL cells (Fig 5A) However, 5¢ deletion of Prm3 from a )404 to a )320 bp fragment yielded an approximately twofold increase in basal luciferase activity while 5¢ deletion of the )320 bp to a )154 bp fragment did not yield a further alteration in basal luciferase expression These data suggest that the )404 to )320 region contains negative regulatory element(s), the removal of which results in increased basal Prm3 activity whilst nucleotides located between )320 and )154 not significantly affect basal Prm3 activity [46] Pre-incubation with 15d-PGJ2 resulted in approximately 1.4–1.6-fold reductions in luciferase activity directed by Prm3 (P < 0.05) and the )404 (P < 0.05) and )320 (P < 0.01) subfragments (Fig 5A) However, 15d-PGJ2 did not significantly affect luciferase activity directed by the )154 subfragment of Prm3 (Fig 5A) Hence, these data indicate that the )320 bp subfragment contains 15d-PGJ2 regulatory domain(s) 4759 Effect of 15d-PGJ2 action on TP gene expression A T Coyle et al A B C Fig Localization of the site of action of 15d-PGJ2 within Prm3 (A) Recombinant pGL3 basic plasmids encoding Prm3 ()1394 to +1), Prm3a ()404 to +1), Prm3ab ()320 to +1) and Prm3aa ()154 to +1) were transiently cotransfected along with pRL-TK into HEL 92.1.7 cells Thirty-six h post-transfection, cells were incubated with either 15d-PGJ2 (10 lM) or the vehicle (0.1% dimethylsulfoxide) for 16 h Mean firefly relative to renilla luciferase activity is expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that luciferase expression in HEL cells was significantly reduced in 15d-PGJ2 treated cells relative to vehicle treated cells; *P £ 0.05, **P £ 0.02, respectively (B and C) HEL 92.1.7 cells were transiently cotransfected with pRL-TK along with pGL3b:Prm3ab Thirty-six hours post-transfection, cells were incubated for 16 h with 0–40 lM 15d-PGJ2 (B) or for 0–24 h with 10 lM 15d-PGJ2 (C) Mean firefly relative to renilla luciferase activity is expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) and that the site of action of 15d-PGJ2 may be located between )320 and )154 Consistent with the former, the effect of 15d-PGJ2 on luciferase expression directed by the )320 bp subfragment was concentration- and time-dependent (Fig 5B,C) Bioinformatic analysis of Prm3, using the matinspectorTM programme [47], for transcription factor elements between )320 and )154 identified the presence of putative retinoic acid X receptor (RXR) half sites centred at )300, )268, )175 and )148 and two putative PPARc half sites at )182 and )159, respectively (Fig 6A) Hence, further 5¢ deletion analysis was carried out to investigate if any of the latter sites might be involved in mediating 15d-PGJ2-inhibition of Prm3-directed gene expression Progressive 5¢ deletion of Prm3 from the )320 bp fragment to yield )276, )229 and )192 subfragments did not affect their ability to direct basal luciferase expression in HEL cells (Fig 6A) While, consistent with previous data, 15d-PGJ2 did not significantly affect luciferase activity directed by the )154 subfragment of Prm3 4760 (Figs 5A and 6A), it resulted in approximately 1.6 fold reductions in luciferase activity directed by the )276 (P < 0.0009), )229 (P < 0.006) and )192 (P < 0.007) subfragments (Fig 6A) These data indicate that the RXR half sites centred at )300 (RXR I) and )268 (RXR II) not play a role in 15dPGJ2-inhibition of Prm3 and that the functional regulatory element(s) may be located between nucleotides )192 and )154 within Prm3 or the surrounding sequences To investigate whether PPARc ⁄ RXR regulation of Prm3 is mediated by direct nuclear factor binding to cis-acting elements within the )192 to )154 region of Prm3, electromobility shift assays (EMSAs) were carried out using a radiolabelled double stranded (ds) DNA probe spanning nucleotides )198 to )150 (PPARc ⁄ RXR probe A; Kin242) and nuclear extracts prepared from either vehicle and 15d-PGJ2 treated HEL 92.1.7 cells A diffuse protein:DNA complex was observed following incubation of the c32P-radiolabelled double stranded (ds) PPARc ⁄ RXR probe A with either FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al Effect of 15d-PGJ2 action on TP gene expression A B Fig Sub-localization of the site of action of 15d-PGJ2 within Prm3 (A) A schematic of the TP genomic region encoding Prm3 ()1394 to +1) in addition to exon (E) spanning nucleotides )1394 to +786 are illustrated In addition, the relative positions of a two putative PPARcresponsive elements (PPREs), designated PPARc(a) and PPARc(b), respectively, and four putative retinoic acid X receptor (RXR) responsive elements, designated RXR I–RXR IV, respectively, are also illustrated Recombinant pGL2Basic plasmids encoding Prm3ab ()320 to +1), Prm3aba ()276 to +1), Prm3abb ()229 to +1), Prm3abc ()192 to +1) and Prm3aa ()154 to +1) were transiently cotransfected along with pRL-TK into HEL 92.1.7 cells Thirty-six hours post-transfection, cells were incubated with either 15d-PGJ2 (10 lM) or the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] for 16 h Mean firefly relative to renilla luciferase activity are expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that luciferase expression in HEL cells was significantly reduced in 15d-PGJ2 treated cells relative to vehicle treated cells, where *P £ 0.05, **P £ 0.02, ***P £ 0.001, ****P £ 0.0001, respectively (B) A c32P-radiolabelled ds DNA probe corresponding to nucleotides (nucleotides) )198 to )150 of Prm3 (PPARc ⁄ RXR probe A; Kin242 and its complement) was used in EMSAs using nuclear extracts prepared from HEL 92.1.7 cells preincubated with either 15d-PGJ2 (10 lM) or the vehicle (0.1% dimethylsulfoxide) for 16 h, as outlined in Experimental procedures Lane 1, PPARc ⁄ RXR probe A incubated without nuclear extract; lanes and 3, PPARc ⁄ RXR probe A incubated with nuclear extract from vehicle- and 15d-PGJ2-treated HEL cells, respectively; lanes and 5, PPARc ⁄ RXR probe A incubated with nuclear extract from vehicle- and 15d-PGJ2-treated HEL cells, respectively, in the presence of excess nonlabelled specific ds competitor oligonucleotide (Kin242 and its complement); lanes and 7, PPARc ⁄ RXR probe A incubated with nuclear extract from vehicle- and 15dPGJ2-treated HEL cells, respectively, in the presence of excess nonlabelled ds noncompetitor oligonucleotide (Kin189, corresponding to nucleotides )32 to )10 of Prm3 containing an AP1 consensus element); lanes and 9, PPARc ⁄ RXR probe A incubated with nuclear extract from vehicle- and 15d-PGJ2-treated HEL cells, respectively, in the presence of excess nonlabelled ds noncompetitor oligonucleotide (Kin195, corresponding to nucleotides )115 to )92 of Prm3 containing an Oct1 ⁄ consensus element); lanes 10 and 11, PPARc ⁄ RXR probe A incubated with nuclear extract from vehicle- and 15d-PGJ2-treated HEL cells, respectively, in the presence of excess nonlabelled ds noncompetitor oligonucleotide (Sp1 consensus element, Promega) DNprotein complexes were subject to polyacrylamide gel electrophoresis followed by autoradiography, as outlined in Experimental procedures nuclear extract prepared from vehicle (Fig 6B; lane 2) or 15d-PGJ2-treated HEL cells (Fig 6B; lane 3) The formation of the latter nuclear factor-DNA complex was efficiently competed by an excess of the corresponding nonlabelled ds PPARc ⁄ RXR oligonucleotide using nuclear extracts prepared from both vehicles or 15d-PGJ2 treated-HEL cells (Fig 6B; lanes and 5, FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS respectively) The specificity of nuclear factor binding to the latter PPARc ⁄ RXR probe A (spanning nucleotides )198 to )150) was also verified by the failure of excess ds oligonucleotides based on consensus AP-1, Oct )1 and Sp1 elements to effectively inhibit the formation of the nuclear factor-DNA complex using nuclear extract prepared from either vehicle (Fig 6B; 4761 Effect of 15d-PGJ2 action on TP gene expression lanes 6, and 10, respectively) or 15d-PGJ2 treated HEL cells (Fig 6B; lane 7, and 11, respectively Taken together these data demonstrate the specific binding of nuclear factors within HEL cells to the )198 to )150 region of Prm3 and also show that nuclear factor–DNA complex formation is independent of 15d-PGJ2 stimulation Identification and characterization of a PPARc response element within Prm3 Detailed analysis of the )192 ⁄ )154 region of Prm3 reveals the presence of two putative PPAR response elements (PPREs) The first putative PPRE is composed of the PPARc half site centred at )182 [PPARc(a)] and a RXR half site at )175 (RXR III) while the second corresponds to a PPARc half site centred at )159 [PPARc(b)] and a RXR IV half site at )148 Therefore a combination of site-directed and deletion mutagenesis was employed to investigate the functional importance of these putative elements in directing 15d-PGJ2 regulation of Prm3 activity Initially it was confirmed that neither site-directed mutagenesis nor deletion of nucleotides between )320 and )154 significantly affected basal luciferase gene expression in HEL cells (Fig 7A) Disruption of the PPARc (a) half site centred at )182 by site-directed mutagenesis (mutation of TTGAGC to TTAGGC, mutated nucleotides in bold) within the )320 bp subfragment of Prm3 did not significantly affect the level of 15d-PGJ2-inhibition of Prm3 activity (Fig 7A) Moreover, progressive 5¢deletion of nucleotides surrounding either the PPARc (a) and RXR III half sites to yield the )186 and )175 subfragments did not affect 15d-PGJ2-suppression of luciferase reporter gene expression yielding between 1.5- and 1.7-fold reductions of luciferase expression (Fig 7A) Consistent with the latter, complete deletion of the PPARc (a) and RXR III half sites while retaining the PPARc (b) and RXR IV half sites generated the )170 subfragment that was fully responsive to 15d-PGJ2-suppression of luciferase expression On the other hand, either deletion of the latter PPARc (b) and RXR IV half sites, such as within the )154 subfragment, or disruption of the RXR IV half site centred at )148 by site-directed mutagenesis (sequence AGTTCA to ATTTTA) within the )320 bp subfragment abolished 15d-PGJ2-suppression of Prm3 activity (Fig 7A) Thereafter, EMSAs were carried out to investigate direct nuclear factor binding to the latter cis-acting PPARc ⁄ RXR response elements within the )161 to )148 region of Prm3 using a radiolabelled ds DNA probe spanning )168 to )141 (PPARc ⁄ RXR probe B; 4762 A T Coyle et al Kin281) and nuclear extracts prepared from either vehicle- and 15d-PGJ2-treated HEL 92.1.7 cells A diffuse protein:DNA complex was observed following incubation of the c32P-radiolabelled PPARc ⁄ RXR probe B with either nuclear extracts prepared from vehicle- (Fig 7B; lane 2) or 15d-PGJ2-treated (Fig 7B; lane 6) HEL cells Nuclear factor-DNA complex formation using nuclear extracts prepared from both vehicle-treated (Fig 7B; lane 3) or 15d-PGJ2 treated(Fig 7B; lane 7) HEL cells was competed by a 50-fold excess of the corresponding nonlabelled ds PPARc ⁄ RXR oligonucleotide, respectively, and by a ds oligonucleotide containing a consensus PPARc response element derived from the acyl-CoA oxidase gene (Fig 7B; lanes and 8) On the other hand, nuclear factor binding to the PPARc ⁄ RXR probe B (spanning nucleotides )168 to )141) was not competed by an excess of ds oligonucleotides in which both the PPARc(b) plus RXR IV sites were mutated, using nuclear extract prepared from either vehicle- (Fig 7B; lane 5) or 15d-PGJ2-treated (Fig 7B; lane 9) HEL cells, respectively Taken together these data demonstrate that either mutation or deletion of the PPARc (a) ⁄ RXR IV half sites centred at )159 and )148, respectively, abolishes 15d-PGJ2 –suppression of Prm3 directed gene expression Moreover, data from EMSAs have confirmed the specific binding of nuclear factors from HEL cells to the )168 to )141 region of Prm3 and, consistent with previous data (Fig 6B), confirm that nuclear factor-DNA complex formation is largely independent of 15d-PGJ2 stimulation Examination of PPARc ⁄ RXRa interactions within the PPRE To further investigate the identity and specificity of the DNA ⁄ protein interactions within the PPRE centred at )159 and )148 of Prm3, we examined the ability of recombinant human (h) PPARc2 and ⁄ or mouse (m) RXRa to directly bind to the latter cis-acting PPARc ⁄ RXR response elements Hence, the PPARc2 and ⁄ or RXRa transcription factors were transcribed and translated in vitro in a rabbit reticulocyte lysate cell free system and proteins of approximately 53–54 kDa corresponding to PPARc2 and RXRa were readily detectable by SDS ⁄ PAGE following translation in the presence of [35S]methionine (Fig 8A, lanes and 3) Thereafter, the ability of the translated PPARc2 and ⁄ or RXRa factors to bind to the c32Pradiolabelled ds DNA probe spanning )168 to )141 (PPARc ⁄ RXR probe B; Kin281) was investigated The recombinant PPARc2 or RXRa transcription factors exhibited weak, though detectable, binding to FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al Effect of 15d-PGJ2 action on TP gene expression A B Fig Identification of the site of action 15d-PGJ2 site of action within Prm3 by site-directed and deletion mutagenesis (A) Recombinant pGL3Basic plasmids encoding Prm3ab ()320 to +1), Prm3abc ()192 to +1), Prm3abe ()186 to +1), Prm3abf ()175 to +1), Prm3abd ()170 to +1), Prm3aa ()154 to +1) or the site-directed variants Prm3abPPARc(a)* or Prm3abRXRIV*, where the PPARc(a) and RXR IV half sites within Prm3ab were mutated, were transiently cotransfected along with pRL-TK into HEL 92.1.7 Thirty-six hours post-transfection, cells were incubated with either 15d-PGJ2 (10 lM) or the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] for 16 h Mean firefly relative to renilla luciferase activity is expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that luciferase expression in HEL cells was significantly reduced in 15d-PGJ2 treated cells relative to vehicle treated cells; **P £ 0.02 (B) EMSAs were carried out using a c32P-radiolabelled ds DNA probe (Kin281 and its complement corresponding to nucleotides )168 to )141 of Prm3)and nuclear extract (4 lg) prepared from vehicle- (lanes 2–5) or 15d-PGJ2 – (10 lM; lanes 6–9) preincubated HEL 92.1.7 cells as described in the Experimental procedures section The c32P-radiolabelled probe was incubated: without nuclear extract (lane 1); with nuclear extract (lanes and 6); with nuclear extract in the presence of a 50-fold excess of: nonlabelled ds specific competitor oligonucleotide (Kin281 and its complement, lanes and 7); nonlabelled ds oligonucleotide containing a consensus acyl coA oxidase PPARc response element (Kin342 and its complement, lanes and 8); nonlabelled ds noncompetitor oligonucleotide (Kin289 and its complement, corresponding to nucleotides )168 to )141 of Prm3 in which both the PPREPPARc(b)* and RXRIV half-site half-sites were disrupted by site-directed mutagenesis (lanes and 9) DNA ⁄ nuclear factor complexes were subject to polyacrylamide gel electroporesis followed by autoradiography, as outlined in Experimental procedures section the radiolabelled PPARc ⁄ RXR probe B (Fig 8B, lanes and 3, respectively) However, coincubation of PPARc2 with RXRa significantly augmented transcription factor binding to the PPARc ⁄ RXR probe B (Fig 8B, lane 4) indicating that both PPARc2 and RXRa are required for efficient transcription factor FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS binding Moreover, PPARc:RXR complex binding to the latter probe was efficiently competed by an excess of the corresponding nonlabelled ds PPARc ⁄ RXR oligonucleotide (Fig 8B, lane 5) but was not competed by an excess of ds oligonucleotides in which the PPARc(b) site, the RXR IV site or the PPARc(b) plus 4763 Effect of 15d-PGJ2 action on TP gene expression A B A T Coyle et al C Fig Investigation of PPARc ⁄ RXRa interactions within the putative PPARPPARc(b) ⁄ RARIV site within Prm3 (A) in vitro transcripts of hPPARc2 (lane 2) and mRXRa (lane 3) were translated in vitro in the presence of [35S]methionine, where translations carried out in the absence of exogenous RNA acted as a control (lane 1) The arrow to the right of (A) indicates the position of the hPPARc2 (lane 2) and mRXRa (lane 3) in vitro translated products (B and C) for EMSAs, parallel in vitro translations of either hPPARc2, mRXRa, hPPARc2 plus mRXRa transcripts or, as controls, without added exogenous RNA were carried out where [35S]methionine was replaced with an equivalent concentration of methionine, as outlined in Experimental procedures Thereafter, c32P-radiolabelled ds DNA probes corresponding to PPARc ⁄ RXR probe B (Kin281 and its complement; B) or, as a control, PPARc ⁄ RXR probe C (Kin289 and its complement in which the both the PPARc(b) and RXR IV half sites were mutated; (C) were used in EMSAs using in vitro translations carried out without added RNA (B and C; lane 1); with hPPARc2 RNA (B and C, lane 2); with mRXRa RNA (B and C, lane 3); with hPPARc2 plus mRXRa RNA (B and C, lane 4); with hPPARc2 plus mRXRa RNA in the presence of excess nonlabelled specific competitor ds Kin281 and its complement (B, lane 5) or Kin289 and its complement (C, lane 5); with hPPARc2 plus mRXRa RNA in the presence of excess nonlabelled ds Kin285 and its complement (corresponding to nucleotides )168 to )141 of Prm3 in which the PPARc(b) half-site was disrupted; B and C, lane 6; with hPPARc2 plus mRXRa RNA in the presence of excess nonlabelled ds Kin283 and its complement (corresponding to nucleotides )168 to )141 of Prm3 in which the RXR IV half-site was disrupted; Panels B and C, lane 7); with hPPARc2 plus mRXRa RNA in the presence of excess nonlabelled ds Kin289 and its complement (corresponding to nucleotides )168 to )141 of Prm3 in which the PPARc(b) and RXR IV half-sites were disrupted; B and C, lane (8) DNprotein complexes were subject to polyacrylamide gel electrophoresis followed by autoradiography, as outlined in Experimental procedures RXR IV sites were mutated (Fig 8B; lanes 6–8, respectively) The fidelity of PPARc:RXRa binding to the PPRE was further demonstrated by examining their binding to a c32P-labelled ds oligonucleotide spanning the )168 ⁄ )141 region of Prm3 in which both the PPARc(b) (sequence GGTTGT to TTCTGT) and RXR IV (sequence AGTTCA to ATTTTA) sites are disrupted by mutagenesis (PPARc ⁄ RXR probe C; Kin289) No DNA ⁄ protein binding or complex formation was observed between either PPARc, RXRa alone or PPARc plus RXRa to the radiolabelled PPARc ⁄ RXR probe C (Fig 8C) These data confirm that PPARc binds to the PPRE within Prm3 as a heterodimer with RXR and that both the PPARc(b) and RXR IV half sites centred at )159 and )148, respectively, are required for binding Discussion TXA2 is a potent mediator of platelet activation and aggregation and a constrictor of vascular and bronchial smooth muscle and together with prostacyclin, for example, it plays a key role in the maintenance of haemostasis [23] TXA2 also induces a diversity of other actions and is widely implicated as a mediator in 4764 a range of vascular, thrombotic and inflammatory diseases [24–29] In humans, the actions of TXA2 are mediated by two receptor isoforms termed TPa and TPb [30,31,41] Whilst the significance of two receptors for TXA2 in humans but not in other species is currently unknown, there is increasing evidence that they are physiologically distinct displaying differences in their basic mechanisms of intracellular signalling, modes of desensitization and patterns of expression [32–39] Moreover, recent studies established that expression of TPa and TPb are under the transcriptional control of two distinct promoters within the single TP gene whereby the originally described promoter (Prm)1 regulates TPa expression and the recently identified Prm3 regulates TPb expression [40,41] In the present study we have demonstrated that the cyclopentanone prostaglandin 15d-PGJ2 inhibits the activity of Prm3 in the platelet-like megakaryocytic human erythroleukemic (HEL) 92.1.7 cell line in a concentration and time dependent manner but had no effect on Prm1- or Prm2-directed reporter gene expression in HEL cells Moreover, the effect of 15d-PGJ2 on Prm1 and Prm3 correlated with its effect on TPa and TPb mRNA expression in HEL 92.1.7 cells yielding 1.5-fold reductions in both Prm3-directed reporter gene expression and TPb mRNA expression while FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al Effect of 15d-PGJ2 action on TP gene expression showing no reduction in Prm1 activity or TPa mRNA expression The reduction in TPb mRNA expression in response to 15d-PGJ2 in HEL cells was reflected in a corresponding reduction in the overall level of TP expression, as assessed by radioligand binding studies, and in reductions in TP-mediated [Ca2+]i mobilization, in response to the TXA2 mimetic U46619 On the other hand, 15d-PGJ2 having no significant effect on signalling by the control EP1 receptor in response to its agonist 17 phenyl trinor PGE2 Furthermore, in human embryonic kidney (HEK) 293 cells 15d-PGJ2 had no effect on Prm1, Prm2 or indeed Prm3-activity or TPa or TPb mRNA expression (data not shown) The latter observation is consistent with previous reports that HEK 293 cells not express significant levels of functional PPARc [48] and thereby implies that PPARc isoforms may have a role in mediating the 15d-PGJ2 –inhibition of Prm3 activity The involvement of both PPARc and the retinoic acid X receptor (RXR) in the regulation of Prm3 was explored through coexpression studies whereby transfection of either PPARc2 or PPARc3 along with the RXRa isoform significantly augmented 15d-PGJ2-inhibition of Prm3 activity while expression of either PPARc2, PPARc3 or RXRa alone had no effect Hence, these data established that TPb, but not TPa, expression may be down-regulated by the endogenous PPARc agonist 15d-PGJ2 through suppression of Prm3-directed gene expression The specific inhibition of TPb mRNA expression mediated by PPARc is further evidence that TPa and TPb are under the control of distinct transcriptional regulatory mechanisms It was noteworthy that 10 lm 15d-PGJ2 was required for maximum inhibition of Prm3 activity, a concentration that is likely to be considerably higher that its circulating plasma concentration However, it is indeed likely that local concentration of the autocoid 15d-PGJ2, such as in inflammatory exudates, may be substantially higher than circulatory levels and may vary significantly depending on the (patho)physiologic state In addition, a number of PG transport systems exist that may raise intracellular concentrations of 15d-PGJ2 under certain conditions [49–51] Interestingly the highest in vivo concentrations of 15d-PGJ2 is present during the resolution phase of inflammation [1], suggesting that TPb expression may be down-regulated in inflammation or following vascular injury As stated, the majority of nuclear hormone receptors up-regulate gene expression through heterodimerization with the common retinoic acid X receptor (RXR) and binding to specific response elements within target gene promoters The PPARc–RXR heterodimer is reported to preferentially bind to the PPRE consisting of a direct repeat of the sequence AGGTCA spaced by one nucleotide (DR1) [52,53] For example, the rat acyl Co oxidase gene contains the first characterized PPRE and has the sequence AGGACA a AGGTCA [4] However, in general PPREs are poorly conserved exhibiting considerable sequence variation such as in the case of previously characterized PPREs within the lipoprotein lipase, apolipoprotein AII, enoyl-CoA hydratase and 3-ketoacyl-CoA thiolase genes, as illustrated in Table In this study to locate the PPARc responsive region(s) within Prm3 ()1394 to +1), progressive 5¢ deletions of sequences 5¢ of )320 had no significant effect while further deletion to the )154 bp subfragment abolished 15d-PGJ2-suppression of Prm3 matinspectortm analysis [47] identified putative retinoic acid X receptor (RXR I–IV) and two putative PPARc [PPARc (a) and PPARc(b)] half sites between )320 and )154 Additional 5¢deletion analysis established that the RXR half sites centred at )300 (RXR I) and )268 (RXR II) not play a role in 15d-PGJ2-inhibition of Prm3 and implied that the functional PPARc response element(s) (PPREs) may be located between nucleotides )192 and )154 within Prm3 or the surrounding sequences Specific nuclear factor binding to the latter region was confirmed by EMSA using the radiolabelled PPARc ⁄ RXR probe A spanning nucleo- Table PPARc responsive gene 5¢ PPARc and 3¢ RXR direct repeat hexameric sequences are in uppercase separated by 1–5 nucleotides (DR1–DR5) given in lowercase PPARc regulated gene PPARc response element Reference h.TPb receptor (Prm3) Acyl-CoA oxidase A Acyl-CoA oxidase B Lipoprotein Lipase Apolipoprotein AII Enoyl-CoA hydratase 3-Ketoacyl-CoA thiolase Perilipin GGTTGT gtagg AGTTCA AGGACA a AGGTCA AGGTAG a AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS 4765 Effect of 15d-PGJ2 action on TP gene expression tides )198 to )150 and nuclear extracts from vehicleand 15d-PGJ2-treated HEL 92.1.7 cells and this binding was shown to be independent of 15d-PGJ2 stimulation Thereafter, the precise site of action of 15d-PGJ2 was identified by further 5¢ deletion analysis dissecting the )192 to )154 region of Prm3 Deletion of the PPARc (a) and RXR III half sites to generate the )170 subfragment retained 15d-PGJ2-suppression of Prm3 activity On the other hand, either deletion of the PPARc (b) and RXR IV half sites, such as in the )154 subfragment, or site-directed mutagenesis of the RXR IV within the )320 bp subfragment abolished 15d-PGJ2-suppression of Prm3 activity Sequence analysis of the latter PPRE within Prm3 indicates that it consists of two imperfect hexameric half sites including the 5¢ PPARc(b) (sequence GGTTGT) and 3¢ RXR IV (sequence AGTTCA) half site centred at )159 and at )148, respectively, separated by five (DR5) nucleotides (Table 1) Specific nuclear factor binding to the latter PPRE was verified by EMSAs using the radiolabelled ds PPARc ⁄ RXR probe B spanning )168 to )141 and nuclear extracts prepared from either vehicle and 15dPGJ2 treated HEL 92.1.7 cells Furthermore, these experiments showed that nuclear factor binding to probe B was competed using excess unlabelled ds oligonucleotide containing a conserved PPRE derived from the acyl CoA gene [54] Therefore, these data suggest that despite the sequence divergence between the PPREs derived from Prm3 and the acyl CoA gene, both sequences are bound by PPARc ⁄ RXR heterodimers in vitro Similar to the EMSAs involving the extended PPARc ⁄ RXR probe A, nuclear factor binding was independent of 15d-PGJ2 stimulation The ligand independent nature of the nuclear factor binding to Prm3 is consistent with the general model of Dussault and Froman, 2000 [55] whereby it is proposed that PPARc–RXR heterodimers bind to PPREs in the absence or presence of ligand and that transcriptional activation results from a ligand dependent conformational change in PPARc possibly leading to recruitment of coactivator molecules [55] The fact that in the case of Prm3 that nuclear factor:DNA complex formation was independent of ligand and did not display a substantially altered mobility shift in the presence ⁄ absence of ligand suggests that an altered conformation, rather than recruitment of cofactors, may be involved in mediating the ligand-dependent transcriptional repression As previously stated, the interdependent nature of PPARc:RXRa binding to the PPRE within Prm3 was suggested by over-expression of PPARc2, PPARc3 and RXRa whereby the inhibitory effect of 15d-PGJ2 4766 A T Coyle et al on Prm3 activity was augmented by the coexpression of either hPPARc2 or hPPARc3 along with RXRa in HEL 92.1.7 cells but not by over-expression of the PPARc2 ⁄ or RXRa factors alone However, overexpression studies alone cannot definitively establish the PPARc ⁄ RXRa heterdimers are actually required to regulate Prm3 in response to 15d-PGJ2 Other approaches such as functional knock-out through the use of RNAinterference (RNAi) to disrupt PPARc or RXRa expression or chromosomal immunoprecipitation (CHIP) analysis are also possible but have proven technically difficult owing to the inability to transfect HEL cells to high efficiency for RNAi and due to the failure of CHIP analysis to discriminate between the PPARc ⁄ RXR site located between )159–148 and the adjacent site located between )182–175 (data not shown) Hence, to extend these studies, the direct binding of and the specific requirement for both PPARc and RXRa for efficient complex formation with the PPRE centred at )159 and )148 within Prm3 was verified by examining the ability of in vitro translated PPARc2 and ⁄ or RXRa factors to bind to the radiolabelled PPARc ⁄ RXR probe B Although some weak binding was observed following incubation with either the individual PPARc2 or RXRa proteins, binding was substantially increased following coincubation with both the PPARc and RXRa proteins with the radiolabelled PPARc ⁄ RXR probe B On the other hand, neither the individual PPARc2 or RXRa proteins nor the PPARc–RXRa heterodimer bound to the radiolabelled PPARc ⁄ RXR probe C spanning the )168 ⁄ )141 region of Prm3 in which both the PPARc(b) and RXR IV sites were disrupted by mutagenesis Collectively, these data confirm that PPARc binds to the PPRE within Prm3 as a heterodimer with RXR and that both the PPARc(b) and RXR IV half sites centred at )159 and )148, respectively, are required for binding and for 15d-PGJ2-inhibition of Prm3 activity and TPb expression Although reports of PPARc-mediated inhibition, as opposed to activation, of gene expression are becoming increasingly common [16,56], transcriptional inhibition is mainly documented to involve PPARc-mediated trans-repression of a host of transcription factors including NF-jB, AP-1, STAT1, SP1 or sequestration of coactivators CBP and ⁄ or p300 rather than involving direct binding of the PPARc–RXR heterodimer to the PPRE [12–14,19,22] For example, PPARc activation suppresses expression of the rat TXA2 receptor (TP) through direct interaction between PPARc and SP1 [22] Hence, the study herein involving Prm3 of the human TP gene represents the first reported study in which the inhibitory effects of PPARc are mediated by FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al direct binding of the PPARc–RXRa heterodimer to a PPRE An extensive investigation of the interactions of retinoic acid receptor (RAR)–RXR and PPAR–RXR heterodimers with RAR response elements (RREs) and PPREs, respectively, was carried out by DiRenzo et al [5] They found that the ability of the RAR–RXR heterodimer to either activate or suppress transcription was dependent on the spacing (so-called ‘DR spacing’) between the hexameric half sites within the RRE itself Briefly, binding of RAR–RXR heterodimers to DR5 elements resulted in transcriptional activation, whereas binding to DR1 elements resulted in transcriptional repression [5,57] In contrast, it is reported that transcriptional activation mediated by the PPARc–RXR heterodimer occurs following binding to DR1 containing PPREs [58] Although the binding of PPARc– RXR heterodimers to DR5 containing elements has yet to be characterized, it is evident that the spacing between the hexanucleotide motifs within nuclear hormone response elements, such as the RREs, dramatically influence the transcriptional response mediated by these elements and their specific transcription factor complex [5] Therefore, we propose that the ligand activation of PPARc–RXR heterodimer bound to the DR5 element centred at )159 and )148 within Prm3 results in transcriptional repression rather than the transcriptional activation typically observed within the classical DR1 containing PPREs Whether transcriptional repression of Prm3 by the PPARc–RXR also involves recruitment of corepressors, such as such as N-CoR [59], requires further investigation Epidemiological studies have shown that atherosclerosis accounts for some 80% of all deaths associated with type diabetes mellitus, of which roughly 75% are attributable to coronary artery disease and the remainder to cerebrovascular or peripheral vascular complications [60] Consistent with this, the enhanced risk of cardiovascular disease in patients with diabetes mellitus and in animal models of diabetes is associated with both the increased synthesis and action of TXA2, most likely due to increased TP expression [42–45] The thiazolidinedione (TZD) class of insulin-sensitizing drugs have proven to be a major therapeutic advance in the treatment of type II diabetes These drugs act as potent agonists of PPARc and activation of this receptor is central to the insulin sensitizing actions of TZDs [61] Recently an antiatherosclerotic role for PPARc has been suggested due to the inhibitory effects of PPARc activation on the expression of a number of pro-atherosclerotic, pro-thrombotic and a range of other critical vascular-related genes [16,17] This is supported by clinical data whereby PPARc agonists have been shown to lower blood pressure [62], prevent FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS Effect of 15d-PGJ2 action on TP gene expression cardiac mass increase and cardiac functional impairment in diabetic patients [63] Moreover, PPARc ligands suppress gene expression of the human cyclooxygenase (COX) II in epithelial cells [20], the rat TXA2 synthase in macrophages [21] and the rat TP gene in VSMC [22] In addition, troglitazone reduced TXA2 production and action in human platelets and HEL cells [22,64] Taken together, these findings have led to the proposal that clinically PPARc ligands may attenuate the synthesis and action of TXA2 and, in turn, may exert a beneficial effect on cardiovascular complications in patients with diabetes mellitus Hence, the observed inhibitory effect of the endogenous PPARc agonist 15d-PGJ2 on TPb expression reported herein may account for some of the observed beneficial effects of PPARc agonists in the treatment of cardiovascular disease associated with diabetes mellitus and is entirely consistent with the growing recognition of the importance of PPARc and its agonists in the regulation of those events In addition, these data point to further differences in the modes of transcriptional regulation of the individual TPa and TPb isoforms in humans and imply potentially important physiologic differences between TPa and TPb such as during inflammation, diabetes mellitus and associated cardiovascular disease Experimental procedures Materials pGL3Basic, pGL3Enhancer, pRL-Thymidine Kinase (pRLTK) and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation (Madison, WI, USA) [c32P]ATP (6000 CiỈmmol)1 at 10 mCiỈmL)1) was from Valeant Pharmaceuticals (ICN) (Costa Mesa, CA, USA) Anti-PPARc (sc-7273x) antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) 15-deoxy-D12,14-PGJ2 was from Calbiochem-Novabiochem (Nottingham, UK) All other reagents were molecular biology grade Mammalian plasmids encoding human PPARc2 (pSG5-hPPARc2), human PPARc3 (pcDNA3-hPPARc3) and mouse retinoic acid X receptor a (pSG5-mRXRa) were a kind gift from C Haby (CNRS Inserm, France) Construction of luciferase-based genetic reporter plasmids The plasmids pGL3b:Prm1, pGL3b:Prm2 and pGL3b:Prm3 containing promoter (Prm)1, Prm2 and Prm3 sequences from the human TXA2 receptor (TP) gene in pGL3Basic reporter vector have been previously described [40] In addition, pGL3b:Prm3a, pGL3b:Prm3ab and pGL3b:Prm3aa 4767 Effect of 15d-PGJ2 action on TP gene expression containing subdeletions of Prm3 have been described [46] To identify the PPARc responsive site within Prm3, a range of 5¢ deletions were generated Specifically, for all 5¢ deletions, PCR fragments were generated using pGL3b:Prm3 as template and the antisense primer Kin113 (5¢-dAGAG ACGCGTGGCTCCGGAGCCCTGAGGGATC-3¢, complementary to nucleotides )19 to +3 where the underlined sequence corresponds to an Mlu1 cloning site) in combination with specific sense primers The following lists the identities of the Prm3 gene fragments and the corresponding plasmids generated in the vector pGL3Basic (annotated pGL3b) and the identity of the specific sense primer, its sequence and corresponding nucleotides where – designations indicate nucleotides 5¢ of the translational ATG start codon which is designated +1 and the Kpn1 cloning site is underlined Prm3aba; pGL3b:Prm3aba (Primer Kin211, 5¢-dGAG AGGTACCGCTGCAGTGAGCCTTGATTG-3¢, nucleotides )276 to )257) Prm3abb; pGL3b:Prm3abb (Primer Kin212, 5¢-dGAG AGGTACCGAGCAAGACTCTGTCTCAAA-3¢, nucleotides )229 to )209) Prm3abc; pGL3b:Prm3abc (Primer Kin236, 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG-3¢, nucleotides )192 to )171) Prm3abe; pGL3b:Prm3abe (Primer Kin240, 5¢-dGA GAGGTACCAGGATATTTGAGCTGGGGCATTG-3¢, nucleotides )186 to )163) Prm3abf; pGL3b:Prm3abf (Primer Kin241, 5¢-dGA GAGGTACCGCTGGGGCATTGAAGGTTGTGT-3¢, nucleotides )175 to )153) Prm3abd; pGL3b:Prm3abd (Primer Kin237, 5¢-dGA GAGGTACCGGCATTGAAGGTTGTGTAGG-3¢, nucleotides )170 to )150) Each of the latter recombinant plasmids was verified by double stranded DNA sequencing Site-directed mutagenesis Site-directed mutagenesis was carried out using the QuikChangeTM (Stratagene) method Mutation of the consensus PPARc-responsive elements (PPRE) half site, designated PPREPPARc(a) with the sequence TGAGCT to TAGGCT centred at )182, within Prm3 was performed using the plasmid pGL3b:Prm3ab as template and mutator primers Kin250 (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG-3¢; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT-3¢; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the consensus retinoic acid X responsive element (RXR) half site with the sequence AGTTCA to ATTTTA centred at )148 within Prm3 was performed using the template pGL3b:Prm3ab in combination with the primers Kin275 (5¢-dGAAGGTTGTGTAGG ATTTTACCAGAGCTACTTACACTG-3¢; sense primer) 4768 A T Coyle et al vs Kin276 (5¢-dCAGTGTAAGTAGCTCTGGTAAA ATCCT ACACAACCTTC-3¢; antisense primer to generate pGL3b:Prm3abRXRIV* Sequences corresponding to the mutated bases are in bold Each of the latter plasmids was verified by double stranded DNA sequencing Cell culture All mammalian cells were grown at 37 °C in a humid environment with 5% (v ⁄ v) CO2 Human erythroleukemic 92.1.7 (HEL) cells and human embryonic kidney (HEK) 293 cells were cultured in RPMI 1640, 10% (v ⁄ v) foetal bovine serum and in Eagle’s minimal essential medium (MEM), 10% (v ⁄ v) foetal bovine serum, respectively Throughout the various assays, HEL cells were treated with either the drug vehicle ([0.1% (v ⁄ v) dimethylsulfoxide] or with 15d-PGJ2 (0–40 lm; 0–24 h) and it was determined that 80% of cells remained viable following treament under maximum conditions For all assays, only viable cells were used Assay of luciferase activity Genetic reporter assays were carried out using the Dual Luciferase Assay SystemTM HEK 293 cells were plated in MEM, 10% (v ⁄ v) foetal bovine serum in six well dishes at · 105 cells per well At 70–80% confluence, cells were cotransfected with pGL3Basic control vector, encoding firefly luciferase, or its recombinant derivatives (0.4 lgỈwell)1) along with pRL-TK (50 ngỈwell)1), encoding renilla luciferase, using Effectene (Qiagen, Valencia, CA, USA) as recommended by the supplier Approximately 36 h post transfection, the medium was replaced with fresh MEM, 10% foetal bovine serum and supplemented with 15d-PGJ2 (10 lm) or vehicle [0.1% (v ⁄ v) dimethylsulfoxide] After 16 h, cells were washed in phosphate buffered saline (NaCl ⁄ Pi), were lysed and harvested by scraping in 350 lL Reporter Lysis Buffer (Promega) and centrifuged at 14 000 g for at R.T HEL cells were transfected using the DMRIE-C transfection reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) Briefly, 0.5 mL of serum free RPMI 1640 medium was dispensed into a six well dish and lL of DMRIE-C reagent was added Thereafter, 0.5 mL of serum free RPMI 1640 medium containing lg of recombinant pGL3 Basic vector and 200 ng of pRL-TK was added and DNA ⁄ DMRIE-C reagent was complexed by incubation at room temperature for 30 Thereafter, 0.2 mL of serum free RPMI 1640 medium containing · 106 HEL cells were added and were incubated for h (37 °C in a CO2 incubator) after which mL of RPMI 1640 medium containing 15% (v ⁄ v) foetal bovine serum was added Approximately 36 h post transfection, the medium was replaced with fresh RPMI, 10% foetal bovine serum and supplemented with FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al 15d-PGJ2 (10 lm) or, for concentration response studies, with 0–40 lm 15d-PGJ2 or, as controls, with vehicle [0.1% (v ⁄ v) dimethylsulfoxide] After 16 h, cells were washed in ice-cold NaCl ⁄ Pi and harvested by centrifugation at 1200 g for at °C Cell pellets were resuspended in Reporter Lysis Buffer (100 lL), were lysed by repeated trituration Cell lysates were prepared by centrifugation at 14 000 g for at R.T To investigate the effect of over-expression of PPARc2, PPARc3 and ⁄ or RXRa on 15d-PGJ2-induced inhibition of Prm3 activity, HEL cells were cotransfected with the specific pGL3b:Prm3 reporter (1 lg) plus 200 ng of pRL-TK along with lg of either pSG5-hPPARc2, pcDNA3hPPARc3 and ⁄ or pSG5-mRXRa coding for PPARc2, PPARc3 and RXRa, respectively For the latter transfections, the total amount of transfected DNA (3.2 lg) was kept constant by using a corresponding amount of empty vector (pSG5 or pcDNA3) DNA Approximately 36 h post-transfection, the medium was replaced with fresh RPMI, 10% foetal bovine serum and was supplemented with the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] or with 10 lm 15d-PGJ2 After 16 h, cell lysates were prepared as previously described above HEK 293 and HEL cell supernatants were assayed for both firefly and renilla luciferase activity using the Dual Luciferase Assay SystemTM, essentially as previously described [46] Relative firefly to renilla luciferase activities were calculated as a ratio and were expressed in relative luciferase units (RLU) In vitro transcription ⁄ translation Linearized pSG5-hPPARc2 and pSG5-mRXRa plasmids (4 lg) were transcribed in vitro at 38 °C for h in the presence of I X in vitro transcription buffer (40 mm Tris ⁄ HCl, pH 7.5, mm MgCl2, mm spermidine, 10 mm NaCl), 10 mm dithiothreitol, 100 l RNAsin, 0.5 mm rNTPs, T7 RNA polymerase (15–20 mL)1; lL) in a reaction volume of 100 lL Thereafter, the reaction products were treated with DNase (RQ RNase-free DNase I, lỈlL)1; lL) for 10 at 37 °C followed phenol ⁄ chloroform [65] In vitro translation reactions (25 lL) contained rabbit reticulocyte lysate (nuclease treated; 14 lL), mm amino acids mix (–methionine; lL), [35S]methionine (1175 CiỈ mmol)1, 10 mCỈmL)1; 1.6 lL), RNasin (16 l) and primed with the in vitro transcribed RNA template (2 lg) or, as controls with an equivalent volume of H2O Parallel in vitro translations were carried out where the radiolabelled [35S]methionine was replaced with an equivalent concentration of cold methionine (8.5 lm; 1.6 lL) In vitro translation reactions were incubated for h at 30 °C followed by h at 37 °C The identity and size of the [35S]methionine labelled translation products was confirmed by SDS ⁄ polyacrylamide gel electrophoresis (12% gels) followed by autoradiography FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS Effect of 15d-PGJ2 action on TP gene expression Electrophoretic mobility shift assay Oligonucleotides corresponding to the sense and antisense strands of each probe (0.35 lm of each) were annealed and 32 P end-labelled as previously described [46] Nuclear extracts were prepared from either vehicle [0.1% (v ⁄ v) dimethylsulfoxide]- or 15d-PGJ2(10 lm for 16 h)treated HEL cells essentially as previously described [46] Nuclear extract (4 lg total protein) or in vitro translated PPARc2 and ⁄ or RXRa protein lysates (2 lL) or in vitro translation reactions from the unprogrammed reticulocyte lysates (2 lL), acting as a negative control, were incubated for 15 at R.T with ⁄ without a 50-fold molar excess of unlabelled d ⁄ s competitor or noncompetitor oligonucleotide (2 lm) in · binding buffer [20 mm Hepes, pH 7.9., 50 mm KCl, 0.1 mm EDTA, 0.1 mm EGTA, 0.5 mm dithiothreitol, 4% (w ⁄ v) Ficoll, 0.5 lg poly(dI-dC) (Sigma, St Louis, MO, USA)] The appropriate 32P-radiolabelled d ⁄ s oligonucleotide was then added to each reaction and incubated for 20 at room temperature Following incubation, binding reactions were subjected to electrophoresis through a 4% polyacrylamide gel (20 cm · 20 cm) in 89 mm Tris ⁄ borate and mm EDTA for h at RT Thereafter, gels were dried and analysed by autoradiography The sequences of the competitor ⁄ noncompetitor oligonucleotides used were as follows: (a) PPARc ⁄ RXR probe A (Kin242; 5¢-dCCGGAGAGGATATTTGAGCTGGGGCA TTGAAGGTTGTGTAGGAGTTC-3¢; corresponding to nucleotides )198 to )150 of Prm3) (b) PPARc ⁄ RXR probe B (Kin281; 5¢-dCATTGAAGGTTGTGTAGGA GTTCACCA-3¢; corresponding to nucleotides )168 to )141 of Prm3) (c) PPREPPARc (b)* mutant, (Kin285; 5¢-d CATTGAATTC TGTGTAGGAGTTCACCA-3¢; corresponding to nucleotides )168 to )141 of Prm3 where bases mutated from the wild type Prm3 sequence are in bold face italics) (d) PPRERXRIV* mutant (Kin283; 5¢-dCATT GAAGGTTGTGTAGGAT TTTACCA-3¢; corresponding to nucleotides )168 to )141 of Prm3 where bases mutated from the wild type Prm3 sequence are in bold face italics) (e) PPREPPARc (b)*,RXRIV* double mutant or PPARc ⁄ RXR probe C (Kin289; 5¢-dCATTGAATTC TGTGTAGGAT TT TACCA-3¢; corresponding to nucleotides )168 to )141 of Prm3 where bases mutated from the wild type Prm3 sequence are in bold face italics) (f) Consensus PPARc response element derived from the acyl-CoA oxidase gene (Kin342; 5¢-dAGCTGGACCAGGACAAAGGTCACGTT-3¢ (g) AP-1 (Kin189; 5¢-dGGTGGTGACTGATCCCTCAGG GC-3¢; corresponding to nucleotides )32 to )10 of Prm3) (h) October ⁄ (Kin195; 5¢-dTAATCACAAGCAAA TCTTCTCTC-3¢ corresponding to nucleotides )115 to )92 of Prm3) (i) SP-1 consensus element (Promega) with the sequence, 5¢-dATTCGATCGGGGCGGGGCGAG-3¢ Note, only sequences of the forward oligonucleotides are given and sequences of the corresponding complementary strands are omitted 4769 Effect of 15d-PGJ2 action on TP gene expression Reverse transcriptase-polymerase chain reaction HEL 92.1.7 cells (5 · 106 cells approximately) were preincubated for 16 h with 10 lm 15d-PGJ2 or, as a control, with the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] Total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies) DNase 1-treatment and RT-PCR was carried out using oligonucleotide primers to specifically amplify TPa, TPb and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA sequences were previously described [40] Southern blot analysis of the RT-PCR products were carried out using 32P-radiolabelled oligonucleotides probes specific for TPa ⁄ TPb and GAPDH mRNA sequences as previously described [40] Images were captured and quantified by using a Typhoon PhosphorImage Analyser (Amersham) Radioligand binding studies HEL cells were preincubated with 10 lm 15d-PGJ2 or, as controls, in the presence of an equivalent volume of the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] for 24 or 48 h; cells were harvested at 500 g at °C for and washed three times with ice-cold Ca2+ ⁄ Mg2+-free NaCl ⁄ Pi TP radioligand binding assays were carried out at 30 °C for 30 in 100 lL reactions in the presence of 20 nm [3H]SQ29,548, as previously described [66] Protein determinations were carried out using the Bradford assay [67] Measurement of intracellular calcium mobilization HEL cells were preincubated with 10 lm 15d-PGJ2 or, as controls, in the presence of an equivalent volume of the vehicle [0.1% (v ⁄ v) dimethylsulfoxide] for 24 or 48 h Measurements of intracellular calcium ([Ca2+]i) mobilization in FURA2 ⁄ AM preloaded cells in response to the TP agonist U46619 (1 lm) or the EP1 agonist 17 phenyl trinor PGE2 (1 lm) was carried as previously described [66] The results presented in the figures are representative profiles from at least four independent experiments and are plotted as changes [Ca2+]i mobilized [D[Ca2+]i (nm)] as a function of time (s) upon ligand stimulation Changes in [Ca2+]i mobilization were determined by measuring peak rises in intracellular [Ca2+]i mobilized (D[Ca2+]i) and were calculated as mean changes in D[Ca2+]i ± SEM (nm) and values are reported at the end of each figure legend, where appropriate Statistical analysis Statistical analyses were analysed using the one-way analysis of variance (anova; Fig 4) or using two-tailed Students’ unpaired t-test using the graphprism3 Software (Graphpad Software, San Diego, CA, USA) analysis package All 4770 A T Coyle et al values are expressed as mean ± standard error of the mean (SEM) P-values of less than or equal to (£) 0.05 were considered to indicate statistically significance differences using both t-tests and anova one-way comparisons Acknowledgements This work was supported by grants from The Wellcome Trust and The Health Research Board References Gilroy DW, Colville-Nash PR, Willis D, Chivers J, Paul-Clark MJ & Willoughby DA (1999) Inducible cyclooxygenase may have anti-inflammatory properties Nat Med 5, 698–701 Colville-Nash PR & Gilroy DW (2000) COX-2 and the cyclopentenone prostaglandins – a new the book of inflammation? Prostaglandins Other Lipid Mediat 62, 33–43 Perez-Sala D, Cernuda-Morollon E & Canada FJ (2003) Molecular basis for the direct inhibition of AP-1 DNA binding by 15-deoxy-Delta 12,14-prostaglandin J2 J Biol Chem 278, 51251–51260 Tugwood JD, Issemann I, Anderson RG, Bundell KR, McPheat WL & Green S (1992) The mouse peroxisome proliferator activated receptor recognizes a response element in the 5¢ flanking sequence of the rat acyl CoA oxidase gene EMBO J 11, 433–439 DiRenzo J, Soderstrom M, Kurokawa R, Ogliastro MH, Ricote M, Ingrey S, Horlein A, Rosenfeld MG & Glass CK (1997) Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid X receptor heterodimers with ligands, coactivators, and corepressors Mol Cell Biol 17, 2166–2176 Gelman L, Zhou G, Fajas L, Raspe E, Fruchart JC & Auwerx J (1999) p300 interacts with the N- and C-terminal part of PPARgamma2 in a ligand-independent and -dependent manner, respectively J Biol Chem 274, 7681–7688 Zhu Y, Qi C, Calandra C, Rao MS & Reddy JK (1996) Cloning and identification of mouse steroid receptor coactivator-1 (mSRC-1), as a coactivator of peroxisome proliferator-activated receptor gamma Gene Expr 6, 185–195 Puigserver P, Wu Z, Park CW, Graves R, Wright M & Spiegelman BM (1998) A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis Cell 92, 829–839 Castillo G, Brun RP, Rosenfield JK, Hauser S, Park CW, Troy AE, Wright ME & Spiegelman BM (1999) An adipogenic cofactor bound by the differentiation domain of PPARgamma EMBO J 18, 3676–3687 FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al 10 Heinlein CA, Ting HJ, Yeh S & Chang C (1999) Identification of ARA70 as a ligand-enhanced coactivator for the peroxisome proliferator-activated receptor gamma J Biol Chem 274, 16147–16152 11 Yang W, Rachez C & Freedman LP (2000) Discrete roles for peroxisome proliferator-activated receptor gamma and retinoid X receptor in recruiting nuclear receptor coactivators, Mol Cell Biol 20, 8008–8017 12 Rossi A, Kapahi P, Natoli G, Takahashi T, Chen Y, Karin M & Santoro MG (2000) Anti-inflammatory cyclopentenone prostaglandins are direct inhibitors of IkappaB kinase Nature 403, 103–108 13 Delerive P, De Bosscher K, Besnard S, Vanden Berghe W, Peters JM, Gonzalez FJ, Fruchart JC, Tedgui A, Haegeman G & Staels B (1999) Peroxisome proliferatoractivated receptor alpha negatively regulates the vascular inflammatory gene response by negative cross-talk with transcription factors NF-kappaB and AP-1 J Biol Chem 274, 32048–32054 14 Li M, Pascual G & Glass CK (2000) Peroxisome proliferator-activated receptor gamma-dependent repression of the inducible nitric oxide synthase gene Mol Cell Biol 20, 4699–4707 15 Murphy GJ & Holder JC (2000) PPAR-gamma agonists: therapeutic role in diabetes, inflammation and cancer Trends Pharmacol Sci 21, 469–474 16 Bishop-Bailey D (2000) Peroxisome proliferator-activated receptors in the cardiovascular system Br J Pharmacol 129, 823–834 17 Thiemermann C (2004) Ligands of the peroxisome proliferator-activated receptor-gamma and heart failure Br J Pharmacol 141, 1–3 18 Marx N, Schonbeck U, Lazar MA, Libby P & Plutzky J (1998) Peroxisome proliferator-activated receptor gamma activators inhibit gene expression and migration in human vascular smooth muscle cells Circ Res 83, 1097–1103 19 Delerive P, Martin-Nizard F, Chinetti G, Trottein F, Fruchart JC, Najib J, Duriez P & Staels B (1999) Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway Circ Res 85, 394–402 20 Subbaramaiah K, Lin DT, Hart JC & Dannenberg AJ (2001) Peroxisome proliferator-activated receptor gamma ligands suppress the transcriptional activation of cyclooxygenase-2 Evidence for involvement of activator protein-1 and CREB-binding protein ⁄ p300 J Biol Chem 276, 12440–12448 21 Ikeda Y, Sugawara A, Taniyama Y, Uruno A, Igarashi K, Arima S, Ito S & Takeuchi K (2000) Suppression of rat thromboxane synthase gene transcription by peroxisome proliferator-activated receptor gamma in macrophages via an interaction with NRF2 J Biol Chem 275, 33142–33150 FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS Effect of 15d-PGJ2 action on TP gene expression 22 Sugawara A, Uruno A, Kudo M, Ikeda Y, Sato K, Taniyama Y, Ito S & Takeuchi K (2002) Transcription suppression of thromboxane receptor gene by peroxisome proliferator-activated receptor–gamma via an interaction with Sp1 in vascular smooth muscle cells J Biol Chem 277, 9676–9683 23 Narumiya S, Sugimoto Y & Ushikubi F (1999) Prostanoid receptors: structures, properties, and functions Physiol Rev 79, 1193–1226 24 Oates JA, FitzGerald GA, Branch RA, Jackson EK, Knapp HR, Roberts LJ & 2nd (1988) Clinical implications of prostaglandin and thromboxane A2 formation(1) N Engl J Med 319, 689–698 25 Fitzgerald DJ, Rocki W, Murray R, Mayo G & FitzGerald GA (1990) Thromboxane A2 synthesis in pregnancy-induced hypertension Lancet 335, 751–754 26 Neri Serneri GG, Gensini GF, Masotti G, Abbate R, Morettini A, Poggesi L & Fortini A (1984) Role of prostacyclin and thromboxane A2 in ischaemic heart disease Adv Exp Medical Biol 164, 175–185 27 Mehta JL, Lawson D, Mehta P & Saldeen T (1988) Increased prostacyclin and thromboxane A2 biosynthesis in atherosclerosis Proc Natl Acad Sci USA 85, 4511–4515 28 Remuzzi G, Imberti L, Rossini M, Morelli C, Carminati C, Cattaneo GM & Bertani T (1985) Increased glomerular thromboxane synthesis as a possible cause of proteinuria in experimental nephrosis J Clin Invest 75, 94–101 29 Matsuo Y, Takagawa I, Koshida H, Kawabata T, Nakamura M, Ida T, Zhou L & Marumo F (1995) Antiproteinuric effect of a thromboxane receptor antagonist, S-1452, on rat diabetic nephropathy and murine lupus nephritis Pharmacology 50, 1–8 30 Hirata M, Hayashi Y, Ushikubi F, Yokota Y, Kageyama R, Nakanishi S & Narumiya S (1991) Cloning and expression of cDNA for a human thromboxane A2 receptor Nature 349, 617–620 31 Raychowdhury MK, Yukawa M, Collins LJ, McGrail SH, Kent KC & Ware JA (1994) Alternative splicing produces a divergent cytoplasmic tail in the human endothelial thromboxane A2 receptor J Biol Chem 269, 19256–19261 32 Kinsella BT (2001) Thromboxane A2 signalling in humans: a ‘Tail’ of two receptors Biochem Soc Trans 29, 641–654 33 Hirata T, Ushikubi F, Kakizuka A, Okuma M & Narumiya S (1996) Two thromboxane A2 receptor isoforms in human platelets Opposite coupling to adenylyl cyclase with different sensitivity to Arg60 to Leu mutation J Clin Invest 97, 949–956 34 Vezza R, Habib A & FitzGerald GA (1999) Differential signaling by the thromboxane receptor isoforms via the novel GTP-binding protein, Gh J Biol Chem 274, 12774–12779 4771 Effect of 15d-PGJ2 action on TP gene expression 35 Parent JL, Labrecque P, Orsini MJ & Benovic JL (1999) Internalization of the TXA2 receptor alpha and beta isoforms Role of the differentially spliced cooh terminus in agonist-promoted receptor internalization J Biol Chem 274, 8941–8948 36 Parent JL, Labrecque P, Driss Rochdi M & Benovic JL (2001) Role of the differentially spliced carboxyl terminus in thromboxane A2 receptor trafficking: identification of a distinct motif for tonic internalization J Biol Chem 276, 7079–7085 37 Walsh MT, Foley JF & Kinsella BT (2000) The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for prostacyclin-mediated desensitization J Biol Chem 275, 20412–20423 38 Reid HM & Kinsella BT (2003) The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for nitric oxide-mediated desensitization Independent modualtion of Tp alpha signaling by nitric oxide and prostacyckin J Biol Chem 278, 51190–51202 39 Miggin SM & Kinsella BT (1998) Expression and tissue distribution of the mRNAs encoding the human thromboxane A2 receptor (TP) alpha and beta isoforms Biochim Biophys Acta 1425, 543–559 40 Coyle AT, Miggin SM & Kinsella BT (2002) Characterization of the 5¢ untranslated region of alpha and beta isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms Eur J Biochem 269, 4058–4073 41 Nusing RM, Hirata M, Kakizuka A, Eki T, Ozawa K & Narumiya S (1993) Characterization and chromosomal mapping of the human thromboxane A2 receptor gene J Biol Chem 268, 25253–25259 42 Carr ME (2001) Diabetes mellitus: a hypercoagulable state J Diabetes Complications 15, 44–54 43 Hishinuma T, Koseki Y, Murai Y, Yamazaki T, Suzuki K & Mizugaki M (1999) Urinary thromboxane A2 ⁄ prostacyclin balance reflects the pathological state of a diabetic Prostaglandins Other Lipid Mediat 58, 263–271 44 Okumura M, Imanishi M, Yamashita T, Yamamura Y, Kim S, Iwao H, Tanaka S & Fujii S (2000) Renal production of thromboxane and prostaglandins in a rat model of type diabetes Life Sci 66, 371–377 45 Lasserre B, Navarro-Delmasure C, Pham Huu Chanh A, Catala J & Hollande E (2000) Modifications in the TXA(2) and PGI(2) plasma levels and some other biochemical parameters during the initiation and development of non-insulin-dependent diabetes mellitus (NIDDM) syndrome in the rabbit Prostaglandins Leukot Essent Fatty Acids 62, 285–291 46 Coyle AT & Kinsella BT (2005) Characterization of promoter of the human thromboxane A receptor gene FEBS J 272, 1036–1053 47 Quandt K, Frech K, Karas H, Wingender E & Werner T (1995) MatInd and MatInspector: new fast and versatile 4772 A T Coyle et al 48 49 50 51 52 53 54 55 56 57 58 tools for detection of consensus matches in nucleotide sequence data Nucleic Acids Res 23, 4878–4884 Guardiola-Diaz HM, Rehnmark S, Usuda N, Albrektsen T, Feltkamp D, Gustafsson JA & Alexson SE (1999) Rat peroxisome proliferator-activated receptors and brown adipose tissue function during cold acclimatization J Biol Chem 274, 23368–23377 Lu R, Kanai N, Bao Y & Schuster VL (1996) Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter cDNA (hPGT) J Clin Invest 98, 1142–1149 Nosjean O & Boutin JA (2002) Natural ligands of PPARgamma: are prostaglandin J(2) derivatives really playing the part? Cell Signal 14, 573–583 Nishio T, Adachi H, Nakagomi R, Tokui T, Sato E, Tanemoto M, Fujiwara K, Okabe M, Onogawa T, Suzuki T, Nakai D, Shiiba K, Suzuki M, Ohtani H, Kondo Y, Unno M, Ito S, Iinuma K, Nunoki K, Matsuno S & Abe T (2000) Molecular identification of a rat novel organic anion transporter moat1, which transports prostaglandin D(2), leukotriene C(4), and taurocholate Biochem Biophys Res Commun 275, 831–838 Nakshatri H & Bhat-Nakshatri P (1998) Multiple parameters determine the specificity of transcriptional response by nuclear receptors HNF-4, ARP-1, PPAR, RAR and RXR through common response elements Nucleic Acids Res 26, 2491–2499 Palmer CN, Hsu MH, Griffin HJ & Johnson EF (1995) Novel sequence determinants in peroxisome proliferator signalling J Biol Chem 270, 16114–16121 Kast-Woelbern HR, Dana SL, Cesario RM, Sun L, De Grandpre LY, Brooks ME, Osburn DL, Reifel-Miller A, Klausing K & Leibowitz MD (2004) Rosiglitazone induction of INSIG-1 in white adipose tissue reveals a novel interplay of PPARg and SREBP in the regulation of adipogenesis J Biol Chem 279, 23908–23915 Dussault I & Forman BM (2000) Prostaglandins and fatty acids regulate transcriptional signaling via the peroxisome proliferator activated receptor nuclear receptors Prostaglandins Other Lipid Mediat 62, 1–13 Benson S, Wu J, Padmanabhan S, Kurtz TW & Pershadsingh HA (2000) Peroxisome proliferator-activated receptor (PPAR)-gamma expression in human vascular smooth muscle cells: inhibition of growth, migration, and c-fos expression by the peroxisome proliferator-activated receptor (PPAR)-gamma activator troglitazone Am J Hypertens 13, 74–82 Vivat-Hannah V, Bourguet W, Gottardis M & Gronemeyer H (2003) Separation of retinoid X receptor homo- and heterodimerization functions Mol Cell Biol 23, 7678–7688 Li L, Beauchamp MC & Renier G (2002) Peroxisome proliferator-activated receptor alpha and gamma agonists upregulate human macrophage lipoprotein lipase expression Atherosclerosis 165, 101–110 FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS A T Coyle et al 59 Chen JD & Evans RM (1995) A transcriptional corepressor that interacts with nuclear hormone receptors Nature 377, 454–457 60 Calles-Escandon J, Garcia-Rubi E, Mirza S & Mortensen A (1999) Type diabetes: one disease, multiple cardiovascular risk factors Coron Artery Dis 10, 23–30 61 Tan MH (2000) Current treatment of insulin resistance in type diabetes mellitus Int J Clin Pract Suppl 54–62 62 Ogihara T, Rakugi H, Ikegami H, Mikami H & Masuo K (1995) Enhancement of insulin sensitivity by troglitazone lowers blood pressure in diabetic hypertensives Am J Hypertens 8, 316–320 63 Ghazzi MN, Perez JE, Antonucci TK, Driscoll JH, Huang SM, Faja BW & Whitcomb RW (1997) Cardiac and glycemic benefits of troglitazone treatment in NIDDM The Troglitazone Study Group Diabetes 46, 433–439 64 Hishinuma T, Yamazaki T & Mizugaki M (2000) Troglitazone has a reducing effect on thromboxane production Prostaglandins Other Lipid Mediat 62, 135–143 65 Sambrook J, Maniatis T & Fritsch FE (1989) Molecular Cloning: A Laboratory Manual 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA 66 Kinsella BT, O’Mahony DJ & Fitzgerald GA (1997) The human thromboxane A2 receptor alpha isoform (TP alpha) functionally couples to the G proteins Gq FEBS Journal 272 (2005) 4754–4773 ª 2005 FEBS Effect of 15d-PGJ2 action on TP gene expression 67 68 69 70 71 and G11 in vivo and is activated by the isoprostane 8-epi prostaglandin F2 alpha J Pharmacol Exp Ther 281, 957–964 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 Vu-Dac N, Schoonjans K, Kosykh V, Dallongeville J, Fruchart JC, Staels B & Auwerx J (1995) Fibrates increase human apolipoprotein A-II expression through activation of the peroxisome proliferator-activated receptor J Clin Invest 96, 741–750 Marcus SL, Miyata KS, Zhang B, Subramani S, Rachubinski RA & Capone JP (1993) Diverse peroxisome proliferator-activated receptors bind to the peroxisome proliferator-responsive elements of the rat hydratase ⁄ dehydrogenase and fatty acyl-CoA oxidase genes but differentially induce expression Proc Natl Acad Sci USA 90, 5723–5727 Latruffe N, Nicolas-Frances V, Dasari VK & Osumi T (1999) Studies on regulation of the peroxisomal betaoxidation at the 3-ketothiolase step Dissection of the rat liver thiolase B gene promoter Adv Exp Medical Biol 466, 253–259 Arimura N, Horiba T, Imagawa M, Shimizu M & Sato R (2004) The peroxisome proliferator-activated receptor gamma regulates expression of the perilipin gene in adipocytes J Biol Chem 279, 10070–10076 4773 ... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of. .. (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3? ?; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3? ?; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the consensus retinoic acid X responsive... AGGTACCGCTGCAGTGAGCCTTGATTG -3? ?, nucleotides )276 to )257) Prm3abb; pGL3b:Prm3abb (Primer Kin212, 5¢-dGAG AGGTACCGAGCAAGACTCTGTCTCAAA -3? ?, nucleotides )229 to )209) Prm3abc; pGL3b:Prm3abc (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3? ?,