Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
... AGGACA a AGGTCA [54] Acyl-CoA oxidase B AGGTAG a AGGTCA [54] Lipoprotein Lipase TGCCCT t TCCCCC [58] Apolipoprotein AII CAACCT t TACCCT [68] Enoyl-CoA hydratase GACCTA tt GAACTA t TACCTA [69] 3- Ketoacyl-CoA ... (f) Consensus PPARc response element derived from the acyl-CoA oxidase gene (Kin342; 5¢-dAGCTGGACCAGGACAAAGGTCACGTT -3 . (g) AP-1 (Kin189; 5¢-dGGTGGTGACTGATCCCTCAGG GC -3 ; corre...
Ngày tải lên: 07/03/2014, 21:20
... was amplified by PCR using pWE15:TXR [55] as template and primers Kin1 43 (5¢-dGAGA GGTACCCTCACGCCTGTA ATCCCAG -3 , corresponding to NTs )404 to )38 5) and Kin245 (5¢-dAGAG ACGCGTGCCAGGCCCACCACGC AG -3 , corresponding ... (a) Oct-1 ⁄ 2 WT (Kin195; 5¢-dTAATCACAAGCAAATCTTCTCTC -3 ; corresponding to NTs )115 to )92 of Prm3); (b) mutated Oct-1 ⁄ 2* (Kin1 93; 5¢-dGAATTAATCACAAGCAAGTCTTCTCTC GC...
Ngày tải lên: 19/02/2014, 16:20
... 5¢-CT GCCTTGCTCCACACCTG -3 ; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT -3 ; FU, 5¢-TCAAGCCCCGCTACATAG TT -3 ; and R3, 5¢-AGGAACCAAACACCAAGTGG -3 (Fig. 2A). Luciferase promoter assay Human genomic DNA was isolated ... inactivated in cancer cells. There may be silencer sequence speci c for cancer cells at the promoter 2 region. Such negat- ive regulation of KLK11 expression in prostate...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc
... http:// jjj.biochem.sun.ac.za/database/kaimachnikov/index. html. Results Kinetic analysis background: basic properties of the Src activation/deactivation cycle Kinetic scheme of the Src cycle Src activity is regulated by intramolecular and inter- molecular interactions ... control potential Src responses in the cellular context. The reaction topology of the Src kinetic cyc...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG -3 ;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT -3 ;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG -3 ;Abstop, ... 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG -3 ;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG -3 . The PCR solut...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... of cortical actin patches. Cortical actin-patch polarization in vrp1D (AMY88) cells carrying YCplac111 vector (vect), pAM 236 expressing C- Vrp1p 36 4)817 (C- Vrp1p 36 4)817 ), pAM896 expressing C- Vrp1p 36 4)760 (C- Vrp1p 36 4)760 ). ... affected polarization of the cortical patches (Fig. S3B). A C- Vrp1p fragment comprising residues 465– 533 including the charged clust...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khóa học: Active-site residues and amino acid specificity of the bacterial 4¢-phosphopantothenoylcysteine synthetase CoaB pptx
... synthesized by the C- terminal CoaB domain from 4¢-phosphopantothenic acid, CTP and cysteine. The synthesis of PPC occurs in two half reactions starting with the formation of 4¢-phosphopantothenoyl-CMP ... gene was amplified by PCR using the oligonucleotides, (forward) 5¢-GCCAGTTTT GAATTCTGGAAAGCGC CTCG -3 and (reverse) 5¢-CGGGTCCA AGATCTTAA CGTCGATTTTTTTC -3 as primers (i...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... 5¢-GACGACTCCATTGTTATAGG AAAAGAGT -3 ; ON359, 5 ¢-GCCGCTGGAGAAACAG CAT -3 ; ON360, 5¢-GCCACCCATTCGTCACAATC -3 ; and ON361, 5¢-ATGCAGAAGGGGATCCGG -3 . Direct measurements of [Ca 2+ ] i in single cells Non-transfected HEK2 93 cells ... (F340) increases, whereas the fluorescence intensity at 38 0 nm (F380) decreases upon the binding of Ca 2+ . The change in the ratio of F34...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx
... Demonstration of the Jigsaw Bard Tony Veale Yanfen Hao School of Computer Science and Informatics, School of Computer Science and Informatics, University College Dublin, University College Dublin, Belfield, ... sug- gested by the Bard); and second, that the adjectives connected by the SlipNet really do mutually rein- force each other (this point relates to the coherence o...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... 432 5¢-802 CTCTTTGATGACAGAAGTGCCT -3 Syndecan-4 5¢-85 GAGTCGATTCGAGAGACTGA -3 36 5 5¢-450 AAAAATGTTGCTGCCCTG -3 Glypican-1 5¢-566 GAATGACTCGGAGCGTACACTG -3 488 5¢-1054 CCTTTGAGCACATTTCGGCAA -3 P450 ... aromatase 5¢-1555GCTTCTCATCGCAGAGTATCCGG -3 289 5¢-1821CAAGGGTAAATTCATTGGGCTTGG -3 b-actin 5¢- 235 0 ACAGACTACCTCATGAAGAT -3 665 5¢ -32 22 AGCCATGCCAAATGTCTCAT -3 Fig. 1. Dose-related e...
Ngày tải lên: 21/02/2014, 03:20