responding to an update of a specific table column
Báo cáo hóa học: " The prevalence of polypharmacy in elderly attenders to an emergency department - a problem with a need for an effective solution" doc
... proforma; TFC assisted with collation of the data; AB, DM, AAK and SE actively collected the data from the departmental records All the data have been verified by DM and AB Authors’ information ... Medical School David Mbamalu is a consultant in emergency medicine at Chase Farm Hospital, Enfield Sayed Ebrahimi and Arshad Ali Khan are specialty doctors in emergency medicine at Chase Farm ... This may be because of the close level of monitoring of therapeutic anticoagulation in dedicated anticoagulation clinics in the hospital, and of wider awareness of the potential for drug interactions...
- 3
- 340
- 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... et al Annals of General Psychiatry 2011, 10:6 http://www.annals-general-psychiatry.com/content/10/1/6 Page of Table Spearman rank correlations (rs) between Spanish ‘TOlerability and quality Of ... El-Mallakh RS, Elmaadawi AZ, Loganathan M, Lohano K, Gao Y: Bipolar disorder: an update Postgrad Med 2010, 122:24-31 Buckley PF: Update on the etiology and treatment of schizophrenia and bipolar ... 178:510-517 Page of 20 Colom F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and...
- 8
- 476
- 0
Báo cáo y học: "How to evaluate the microcirculation: report of a round table conference" potx
... several analytic software packages are under development Given this high variability in image analysis and given the importance it may have in separating diseased from nondiseased states [3,5,8] and ... further analysis, especially if analysis is performed using software Clips of 20 s duration are already very large (50 to 100 MB), and the need for adequate storage should be anticipated To enhance ... sublingual sites Theoretical and practical considerations In analyzing microvascular images there are trade-offs to be made, and several theoretical and practical considerations may influence these...
- 9
- 465
- 0
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided
... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... Listing of Companies in Final Sample by Categories of Book-toMarket Ratios 197 Table A2 5: ARE and CAR Means and Standard Deviations for Different Book -to- Market Ratio Categories 198 Table A2 6a: Longer-Term ... Table A1 4: Listing of Companies in Final Sample Under Their Respective Stock Exchange Listing 187 ix Table A1 5: ARE and CAR Means and Standard Deviations by Stock Exchange Listing 188 Table A1 6:...
- 217
- 227
- 0
Adapting to an uncertain climate a world of commercial opportunities
... beverage company, to develop new varieties of blackcurrants that are more resilient and resistant to climate change Healthy business? Challenges ahead Another area that will face new pressures and ... Health Organisation (WHO) notes that diseases such as malaria and dengue could spread as rainfall and temperature patterns change In 2007 Italy reported an outbreak of chikungunya, a tropical ... 1970-89, to US$27 billion annually over the last two decades In 2005 Hurricane Katrina pushed the annual cost to over US$100 billion in that year Allianz, a German insurance and financial services...
- 15
- 202
- 0
Give an account of a visit to a book exhibition
... chắn bạn lớp vui mừng Cikgu Hamid nói với có hai tiếng rưỡi để duyệt sách Chúng không đánh l a xung quanh muốn mua sách đ a cho ông để ông nhận giảm giá tốt Chúng ta h a cư xử Tiếp theo rơi kệ sách ... trường cho chút thời gian để làm việc Sau thức uống giải khát quay trở lại trường để đáp ứng phần lại bạn lớp Cikgu Hamid chờ đợi Một bạn lớp xuất Sau tất lắp ráp Cikgu Hamid mua sách, khỏi hội trường ... trình duyệt phần sách đẹp minh h a động vật thực vật Ch a thấy lượng lớn thông tin liên quan đến hành tinh quý báu Trước biết nó, n a trôi qua My lòng tốt, nghĩ để qua phần lại triển lãm Vì vậy,...
- 3
- 182
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...
- 6
- 611
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources to ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...
- 8
- 492
- 0
Tài liệu Module 1: Introduction to Advanced Administration of a Windows 2000 Network docx
... Centralize Management Delegate Administrative Delegate Administrative Control Control Lead-in As an administrator, you can take advantage of the Windows 2000 Active Directory and Group Policy features ... computers, and network resources Senior administrators can delegate administrative tasks to other administrators Administrators can customize administrative tools for specific administrative tasks and ... install software, you can ensure that the same applications are available on any computer to which a user logs on You can also ensure that missing files and settings are repaired automatically...
- 26
- 444
- 0
Wind tunnel and propulsion test facilities supporting analyses to an assessment of nasa docx
... Administration National Aerospace Plane National Aeronautic Test Alliance Naval Air Systems Command National Full-Scale Aerodynamics Complex National Transonic Facility Office National d’Etudes et ... Command Arnold Engineering and Development Center Air Force Base Air Force Research Laboratory Air Force Office of Scientific Research American Institute of Aeronautics and Astronautics Aero and ... senior advisers and consultants to help analyze the data received and to augment the information based on their own expertise with various national and international facilities In addition, the analysis...
- 164
- 425
- 0
Mortgage Loan Fraud: An Update of Trends based Upon an Analysis of Suspicious Activity Reports doc
... details to make this determination A cash-out refinance loan is a refinanced loan granted for an amount greater than what the borrower owes on the prior loan The additional amount of the refinance ... 40,781 Apr 06 - Mar 07 Total Mortgage Loan Fraud SARs Appraisal Fraud Reports of fraudulent appraisals continue to increase in SARs reporting mortgage loan fraud Filers of nearly 13% of the narratives ... Financial Crimes Enforcement Network Mortgage Loan Fraud Financial Crimes Enforcement Network Mortgage Loan Fraud An Update of Trends based Upon an Analysis of Suspicious Activity Reports April...
- 54
- 318
- 0
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt
... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... constructing a SAM and an - table simultaneously is preferable; the disaggregation and interlinkage of household demand and primary incomes may lead to improvements in the 1-0 table Once an - table has ... insight into demand and supply of production factors facilitates research on how capital and labour markets operate Depreciation allowances may be treated separately and channelled directly to the...
- 30
- 520
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... signalling mechanisms in Streptococcus agalactiae Mol Microbiol 62, 941–957 Rantanen MK, Lehtio L, Rajagopal L, Rubens CE & ¨ Goldman A (2006) Crystallization and preliminary crystallographic analysis ... described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the SaPPase (Rantanen, unpublished), ... phenylalanine at a concentration of 100 lgÆL)1 and leucine, isoleucine and valine at a concentration of 50 lgÆL)1 Simultaneously, we added selenomethionine at a concentration of 60 lgÆL)1, and after...
- 10
- 542
- 0
CENTRAL BANK INDEPENDENCE: AN UPDATE OF THEORY AND EVIDENCE pptx
... economic analyses: a reappraisal Bank of Japan Monetary and Economic Studies, 14, 79 ±99 Givazzi, F and Pagano, M (1988) The advantage of tying one's hands Ð EMS discipline and central bank credibility ... (see also Walsh, 1997) As already pointed out by Giavazzi and Pagano (1988), fixed exchange rates may alleviate the credibility problem of monetary policy Although Giavazzi and Pagano not analyse ... identify and may change after they have been appointed It is hard to find a clear real world example of a `conservative' central banker Still, one could argue that the statute of the central bank can...
- 38
- 578
- 0
Wind Tunnel and Propulsion Test Facilities - Supporting Analyses to an Assessment of NASA pot
... Administration National Aerospace Plane National Aeronautic Test Alliance Naval Air Systems Command National Full-Scale Aerodynamics Complex National Transonic Facility Office National d’Etudes et ... Command Arnold Engineering and Development Center Air Force Base Air Force Research Laboratory Air Force Office of Scientific Research American Institute of Aeronautics and Astronautics Aero and ... senior advisers and consultants to help analyze the data received and to augment the information based on their own expertise with various national and international facilities In addition, the analysis...
- 164
- 425
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Responding to the challenge of cancer in Europe pdf
... like to thank Marija Seljak, Mojca Gruntar Cinc, Vesna Kerstin Petric and Natasa Hace at the Slovenian Ministry of Health; and Ada Hocevar Grom, Rade Pribakovic, Mateja Gorenc and Tatjana Pokrajac ... Yugoslav Republic of Macedonia Greece Croatia Poland Latvia Bosnia and Herzegovina Belarus Romania Albania Bulgaria Ukraine Serbia and Montenegro Russian Federation Republic of Moldova Prostate cancer ... facilities and technological infrastructure; and the availability of human, financial and material resources for health and economic development The annual rates of newly diagnosed cancer patients...
- 361
- 387
- 0
Báo cáo khoa học: "RESPONDING TO USER QUERIES IN A COLLABORATIVE ENVIRONMENT*" docx
... the feasibility of an action that does not contribute to its parent action is irrelevant Similarly, the well-formedness of a plan that attempts to achieve an infeasible goal is also irrelevant ... the incorrect action which constructs a plan to achieve the posted goal, and a (and all of its children), and Alter-Act, which generalizes discourse realizer to generate natural language text the ... have studied collaboration [1, 3, 10] Proc AAAL pages 169 175, 1984 [6] Lynn Lambert and Sandra Carberry A tripartite plan-based and Allen proposed different plan modalities depending model of...
- 3
- 352
- 0
Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc
... gas analysator (Radiometer Copenhagen, ABL) to assess pH- and electrolyte status Further sample fractions were stored for a later Kidneys from laboratory animals were handled in the same way after ... the x, y data are transformed into logarithmic scaling and linear lines instead of curves are resulting for constant values of the creatinine clearance In that way figure was constructed and the ... removed surgically For organ harvesting by surgery, pigs were set under general anesthesia undergoing median laparotomy The right external jugular vein was cannulated and the animal was heparinized...
- 13
- 548
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... Podder G, Faruque AS, Matthijnssens J, Zaman K, Breiman RF, Sack DA, Van Ranst M, Azim T: Typing of human rotaviruses: nucleotide mismatches between the VP7 gene and primer are associated with ... nucleotide mutation at the 3' end of the primer binding site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine...
- 4
- 329
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose