reading from a udp packet is simplified by applying input streams
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... probe (lanes 1, 2) and binding was FEBS Journal 272 (2005) 5191–5205 ª 2005 FEBS A Parthasarthy and K P Gopinathan completely abolished when the TATATAA sequence was mutated to GATATCA (lanes 3, ... individual members from within a multigene family Gly like tRNA1 may depend on the developmental stage and the overall availability of transcription factors Gly We made a comparative analysis of ... Regulation of pol III transcription A Parthasarthy and K P Gopinathan and making them unavailable for transcription The ‘TATATAA’ sequence present in the flanking regions Gly of tRNA1 -6,7 was responsible...
- 15
- 484
- 0
báo cáo hóa học: " The acute inflammatory response to intranigral a-synuclein differs significantly from intranigral lipopolysaccharide and is exacerbated by peripheral inflammation" pptx
... that MS lesions localize in a random fashion, more careful analysis reveals a distinct symmetry when small plaques and all demyelinating activity are taken into account The signal for contralateral ... Mogi M, Harada M, Riederer P, Narabayashi H, Fujita K, Nagatsu T: Tumor necrosis factor-alpha (TNF-alpha) increases both in the brain and in the cerebrospinal fluid from parkinsonian patients ... dexamethasone, and not mimicked by rh-TNF-alpha, IL1beta and IFN-gamma J Neurochem 2002, 81:150-157 Ariza D, Lima MM, Moreira CG, Dombrowski PA, Avila TV, Allemand A, Mendes DA, Da Cunha C, Vital...
- 14
- 457
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa...
- 9
- 522
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... amplified by PCR from total DNA using the primers pADm1 (forward; 5¢-AGCAGTCGACGA AGCGACGAAGTGAAGCTGCGTGA-3¢) and pADm3 (reverse; 5¢-ATCCGTCGACATGCTTTTTAACTGTT CG-3¢) After digestion with SalI (which ... 365–377 Biswas, G., Adebanjo, O .A. , Freedman, B.D., Anandatheerthavarada, H.K., Vijayasarathy, C., Zaidi, M., Kotlikoff, M & Avadhani, N.G (1999) Retrograde Ca2+ signaling in C2C12 skeletal myocytes ... differentiated, both structurally and functionally, with highly developed cristae full of ATP synthase complexes For this reason, ATP synthase and in particular the a- F1-ATPase and b-F1-ATPase catalytic...
- 11
- 532
- 0
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... following antibodies were used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody against endogenous TACE (Chemikon International, ... substrate CDPstar (Tropix) Emitted light was densitometrically analyzed by using a digital camera and the software AIDA 2.0 (Raytest, Straubenhardt, Germany) Isolation and detection of APPsa by ... 25–31 Takahashi, S., Kasai, K., Hatsuzawa, K., Kitamura, N., Misumi, Y., Ikehara, Y., Murakami, K & Nakayama, K (1993) A mutation of furin causes the lack of precursor-processing activity in human...
- 8
- 422
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... human manganese superoxide dismutase: effects on structure, stability, and catalysis Biochemistry 39, 7131– 7137 31 Hiraoka, B.Y., Yamakura, F., Sugio, S & Nakayama, K (2000) A change of the metal-specific ... Institut Jacques Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template...
- 12
- 740
- 0
Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx
... Gly-Arg-pNA Ala-Ala-Pro-pNA Ala-Phe-Pro-pNA Ala-Ala-Ala-pNA Pro-Leu-Gly-pNA Ala-Ala-Phe-pNA Suc-Ala-Ala-Phe-pNA Val-Leu-Lys-pNA Cbz-Pro-Phe-Arg-pNA Ala-Ala-Val-Ala-pNA Ala-Ala-Pro-Leu-pNA Suc-Ala-Ala-Pro-Phe-pNA ... Substrates Activity (nmolÆmin)1Æml)1) Relative activity (%) Pro-pNA Phe-pNA Leu-pNA Ala-pNA Ala-Pro-pNA Suc-Ala-Pro-pNA Gly-Pro-pNA Cbz-Gly-Pro-pNA Ala-Ala-pNA Ala-Phe-pNA Gly-Glu-pNA Gly-Arg-pNA Ala-Ala-Pro-pNA ... hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reasonable rates clearly indicates exclusive cleavage of the anilide bond of Ala-Ala-Val-Ala-pNA Our results also provide...
- 7
- 480
- 0
báo cáo khoa học: " A membrane-bound matrix-metalloproteinase from Nicotiana tabacum cv. BY-2 is induced by bacterial pathogens" pdf
... CAT GGA CGA GCT GTA CAA GTC TAA CCC AAA TTT TAC TGG G-3') and NtMMP-Cterm_rev (5'-TCT AGA TTT AAA TTA AAT GGA GAA ATG ATA AG-3') Introduced restriction sites are shown in italic The three fragments ... all recombinant forms with APMA, a metallo-organic activator of metalloproteases [16], did not enhance casein degradation, indicating that recombinant NtMMP1 is already present in an active form ... leaves Analysis of recombinant NtMMP1 produced transiently in tobacco leaves A: Immunoblot analysis of fractions from immobilized metal affinity chromatography purification of NtMMP1-apo Equal...
- 12
- 278
- 0
Phonetics Choose one word whose underlined part is pronounced differently from the others. Identify your answer by circling the corresponding letter A, B, C, or D:
... 161 A book 162 A hate 163 A thank 164 A noon 165 A chorus 166 A Italy 167 A say 168 A language 169 A print 170 A English 171 A study 172 A official 173 A language 174 A English 175 A China 176 A ... 85 A rakes A briefcases A theme A hot A that B boats B oranges B there B got B make 86 87 88 89 90 A fat A name A bear A last A page B hate B fame B clear B fast B game 91 92 93 94 95 A find A ... energy 64 A export 65 A plant 66 A nuclear 67 A dollar 68 A food 69 A force 70 A earth 71 A nest 72 A sunrise 73 A worried 74 A physical 75 A advance 76 A pneumonia 77 A world 78 A meat 79 A mankind...
- 9
- 7,726
- 23
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... medical-waste-recycling-products The community awareness of the danger of medical wastes should be raised through various ways, ranging from propaganda, education and dissemination of information ... after surgeries Also from the Ministry of public health, 2/3 of all hospitals have not applied safety waste disposal methods Most wastes have not been classified and disinfected before discharging ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment...
- 10
- 722
- 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... 17 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A DATA ANALYSIS AND DISCUSSION 3.1 Analysis of data 3.1.1 Lexical choice By referring ... as sabbatical, ultimate, eventual, persistent, anew are intentionally used by the speaker for emphatic purposes Most obvious is the case of anew, which stands out in paragraphs: Today America ... Uni 16 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A Apart from the formal salutation at the beginning and farewell at the end,...
- 44
- 578
- 0
Tài liệu Reading Rows from a SqlDataReader Object docx
... reason for this is that a DataReader object ties up the Connection object, and no other commands can be executed while there is an open DataReader for that Connection The following example closes ... discontinuedColPos = productsSqlDataReader.GetOrdinal("Discontinued"); You can then use these int values to get the column values from productsSqlDataReader: while (productsSqlDataReader.Read()) { Console.WriteLine(productsSqlDataReader[productIDColPos]); ... maintenance nightmare Also, hard-coding the column positions makes your programs more difficult to read There is a solution to this problem: you can call the GetOrdinal() method of your DataReader...
- 5
- 305
- 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
... 4.2.4 Headache • A headache resulting from malignant disease may arise from raised intracranial pressure due to brain metastasis or progressive incurable primary brain tumours It may also be a result ... Moscol A, Zaharia M, Zaman S, Perez Escutia MA Fractionated half3 body irradiation (HBI) for the rapid palliation of widespread, symptomatic metastatic bone disease: a randomised phase III trial ... the pain specialist in cancer pain management, which can lead to greater dialogue and liaison between oncology, specialist pain and palliative care professionals The document is accompanied by...
- 116
- 548
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... TMPRSS13 mRNA is expressed in a variety of human adult tissues, and predominantly in lung, placenta, pancreas and prostate [12] HAI-1 mRNA is also highly expressed in placenta, pancreas and prostate ... D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor Biochem Biophys ... 5¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGG GCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles) The GAPDH-specific primer set, 5¢-AGGTGAAGGTCGGAGTCAAC-3¢ and...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa ... Journal compilation ª 2008 FEBS S Ma et al (1) β-gal CMV Transcription start site C β-gal (2) ARS-β-gal CMV Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported by funds from a...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
- 10
- 488
- 0
Tài liệu Title: Elizabethan England From ''''A Description of England,'''' by William Harrison pptx
... I may die at either place My goods to be divided into equal parts 'of which one parte and an halfe shall remaine vnto Marion Harrison alias Marion Isebrande and the daughter of William Isebrande ... that remain must answer and bear them out: for they plead more charge other ways, saying: "I am charged already with a light horse; I am to answer in this sort, and after that matter." And it is ... private gain, evade the laws; also some good advice about draining In his chapter on "Baths and Hot Wells," Harrison says that he's tasted the water of King's Newnham well, near Coventry, and that...
- 193
- 462
- 0
Báo cáo khoa học: The Rieske protein from Paracoccus denitrificans is inserted into the cytoplasmic membrane by the twin-arginine translocase doc
... Program) Three genes annotated as TatA, TatB, and TatC homologues could be found on contig 67; TatB and TatC are adjacent genes and might form a transcriptional unit, whereas the TatA homologue is ... some clear distinctions that may account for its dual role as a Tat signal and as a membrane anchor The ISP h-region exhibits a significantly higher hydrophobicity than average Tat signal peptides ... All enzymatic measurements were performed at ambient temperature on a Hitachi U-3000 spectrophotometer (Hitachi, Tokyo, Japan) Malate dehydrogenase assay Malate dehydrogenase was used as a marker...
- 14
- 535
- 0
Báo cáo khoa học: Kinetics of violaxanthin de-epoxidation by violaxanthin de-epoxidase, a xanthophyll cycle enzyme, is regulated by membrane fluidity in model lipid bilayers pptx
... zeaxanthin (A Z) with a probability AZ It is known from experimental data that these two steps reach equilibrium It means that the parameters VA and AZ must vanish In the model we have assumed a linear ... which all molecules of violaxanthin are converted to antheraxanthin and all molecules of antheraxanthin are converted to zeaxanthin at a given temperature at saturating amount of VDE and at the ... violaxanthin was deepoxidated and more zeaxanthin was formed in the monogalactosyldiacylglycerol system at the plateau stage of the reaction The same was found at °C, although at this temperature...
- 10
- 419
- 0
Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx
... Comparisons of tryptophan hydroxylase from a malignant murine mast cell tumor and rat mesencephalic tegmentum Arch Biochem Biophys 199, 355–361 13 Hasegawa, H., Yanagisawa, M., Inoue, F., Yanaihara, ... Ugai, S., Tamura, T., Tanahashi, N., Takai, S., Komi, N., Chung, C.H., Tanaka, K & Ichihara, A (1993) Purification and characterization of the 26S proteasome complex catalyzing ATPdependent breakdown ... SDS/PAGE for autoradiography as described in Materials and methods The autoradiogram (left panel, 32P) represents treatment with vehicle (lane 1), 0.5 lM okadaic acid (lane 2), and okadaic acid...
- 9
- 404
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose